diff --git a/README.md b/README.md
index c4148e66..fec3e578 100644
--- a/README.md
+++ b/README.md
@@ -1,4 +1,4 @@
-# xCoffeeScript
+# CoffeeScript
 
 Exercism exercises in CoffeeScript
 
diff --git a/docs/INSTALLATION.md b/docs/INSTALLATION.md
index f1f50f03..fdd46fde 100644
--- a/docs/INSTALLATION.md
+++ b/docs/INSTALLATION.md
@@ -4,16 +4,16 @@
 
 [linstall]: https://github.com/joyent/node/wiki/Installing-Node.js-via-package-manager
 
-Install `jasmine-node` and `coffee`:
+Install `jasmine-node` and `coffeescript`:
 
 ```bash
-$ npm install jasmine-node coffeescript -g
+$ npm install -g jasmine-node coffeescript
 ```
 
 Depending on your setup, you may need super user privileges to install an `npm` module globally. This is the case if you've used the official installer linked to above. If NPM gives you an error saying you don't have access, add `sudo` to the command above:
 
 ```bash
-$ sudo npm install jasmine-node coffeescript -g
+$ sudo npm install -g jasmine-node coffeescript
 ```
 
 If you've used the official installer, your `PATH` should have been automatically configured, but if your shell has trouble locating your globally installed modules--or if you build Node.js from source--update your `PATH` to include the `npm` binaries by adding the following to either `~/.bash_profile` or `~/.zshrc`:
diff --git a/exercises/accumulate/accumulate.coffee b/exercises/accumulate/accumulate.coffee
new file mode 100644
index 00000000..0b4171f8
--- /dev/null
+++ b/exercises/accumulate/accumulate.coffee
@@ -0,0 +1,3 @@
+# This is a stub file for the CoffeeScript track
+
+Array::accumulate = (args) ->
diff --git a/exercises/accumulate/accumulate_test.spec.coffee b/exercises/accumulate/accumulate.spec.coffee
similarity index 77%
rename from exercises/accumulate/accumulate_test.spec.coffee
rename to exercises/accumulate/accumulate.spec.coffee
index 6d8d1f27..20fd3f3b 100644
--- a/exercises/accumulate/accumulate_test.spec.coffee
+++ b/exercises/accumulate/accumulate.spec.coffee
@@ -20,10 +20,10 @@ describe '[].accumulate()', ->
     accumulator = (word) -> word.split('').reverse().join('')
     result      = 'the quick brown fox etc'.split(/\s/).accumulate accumulator
 
-    expect(result).toEqual ["eht", "kciuq", "nworb", "xof", "cte"]
+    expect(result).toEqual ['eht', 'kciuq', 'nworb', 'xof', 'cte']
 
   xit 'accumulate recursively', ->
     result = 'a b c'.split(/\s+/).accumulate (char)  ->
-      '1 2 3'.split(/\s+/).accumulate (digit) -> "#{char}#{digit}"
+      '1 2 3'.split(/\s+/).accumulate (digit) -> '#{char}#{digit}'
 
-    expect(result).toEqual([["a1", "a2", "a3"], ["b1", "b2", "b3"], ["c1", "c2", "c3"]])
+    expect(result).toEqual([['a1', 'a2', 'a3'], ['b1', 'b2', 'b3'], ['c1', 'c2', 'c3']])
diff --git a/exercises/anagram/anagram.coffee b/exercises/anagram/anagram.coffee
new file mode 100644
index 00000000..842096d3
--- /dev/null
+++ b/exercises/anagram/anagram.coffee
@@ -0,0 +1,8 @@
+# This is a stub file for the CoffeeScript track
+
+class Anagram
+  constructor: (args) ->
+
+  match: (targets) ->
+
+module.exports = Anagram
diff --git a/exercises/anagram/anagram.spec.coffee b/exercises/anagram/anagram.spec.coffee
new file mode 100644
index 00000000..caa53fd2
--- /dev/null
+++ b/exercises/anagram/anagram.spec.coffee
@@ -0,0 +1,56 @@
+Anagram = require './anagram'
+describe 'Anagram', ->
+  it 'no matches', ->
+    detector = new Anagram 'diaper'
+    matches = detector.match ['hello', 'world', 'zombies', 'pants']
+    expect(matches).toEqual []
+
+  xit 'detects simple anagram', ->
+    detector = new Anagram 'ant'
+    matches = detector.match ['tan', 'stand', 'at']
+    expect(matches).toEqual ['tan']
+
+  xit 'does not detect false positives', ->
+    detector = new Anagram 'galea'
+    matches = detector.match ['eagle']
+    expect(matches).toEqual []
+
+  xit 'detects multiple anagrams', ->
+    detector = new Anagram 'master'
+    matches = detector.match ['stream', 'pigeon', 'maters']
+    expect(matches).toEqual ['stream', 'maters']
+
+  xit 'does not detect anagram subsets', ->
+    detector = new Anagram 'good'
+    matches = detector.match ['dog', 'goody']
+    expect(matches).toEqual []
+
+  xit 'detects anagram', ->
+    detector = new Anagram 'listen'
+    matches = detector.match ['enlists', 'google', 'inlets', 'banana']
+    expect(matches).toEqual ['inlets']
+
+  xit 'detects multiple anagrams', ->
+    detector = new Anagram 'allergy'
+    matches = detector.match ['gallery', 'ballerina', 'regally', 'clergy', 'largely', 'leading']
+    expect(matches).toEqual ['gallery', 'regally', 'largely']
+
+  xit 'does not detect identical words', ->
+    detector = new Anagram 'corn'
+    matches = detector.match ['corn', 'dark', 'Corn', 'rank', 'CORN', 'cron', 'park']
+    expect(matches).toEqual ['cron']
+
+  xit 'does not detect non-anagrams with identical checksum', ->
+    detector = new Anagram 'mass'
+    matches = detector.match ['last']
+    expect(matches).toEqual []
+
+  xit 'detects anagrams using case-insensitive subject', ->
+    detector = new Anagram 'Orchestra'
+    matches = detector.match ['cashregister', 'carthorse', 'radishes']
+    expect(matches).toEqual ['carthorse']
+
+  xit 'detects anagrams using case-insensitive candidates', ->
+    detector = new Anagram 'orchestra'
+    matches = detector.match ['cashregister', 'Carthorse', 'radishes']
+    expect(matches).toEqual ['carthorse']
diff --git a/exercises/anagram/anagram_test.spec.coffee b/exercises/anagram/anagram_test.spec.coffee
deleted file mode 100644
index d1b5d9b1..00000000
--- a/exercises/anagram/anagram_test.spec.coffee
+++ /dev/null
@@ -1,56 +0,0 @@
-Anagram = require "./anagram"
-describe "Anagram", ->
-  it "no matches", ->
-    detector = new Anagram "diaper"
-    matches = detector.match ["hello", "world", "zombies", "pants"]
-    expect(matches).toEqual []
-
-  xit "detects simple anagram", ->
-    detector = new Anagram "ant"
-    matches = detector.match ["tan", "stand", "at"]
-    expect(matches).toEqual ["tan"]
-
-  xit "does not detect false positives", ->
-    detector = new Anagram "galea"
-    matches = detector.match ["eagle"]
-    expect(matches).toEqual []
-
-  xit "detects multiple anagrams", ->
-    detector = new Anagram "master"
-    matches = detector.match ["stream", "pigeon", "maters"]
-    expect(matches).toEqual ["stream", "maters"]
-
-  xit "does not detect anagram subsets", ->
-    detector = new Anagram "good"
-    matches = detector.match ["dog", "goody"]
-    expect(matches).toEqual []
-
-  xit "detects anagram", ->
-    detector = new Anagram "listen"
-    matches = detector.match ["enlists", "google", "inlets", "banana"]
-    expect(matches).toEqual ["inlets"]
-
-  xit "detects multiple anagrams", ->
-    detector = new Anagram "allergy"
-    matches = detector.match ["gallery", "ballerina", "regally", "clergy", "largely", "leading"]
-    expect(matches).toEqual ["gallery", "regally", "largely"]
-
-  xit "does not detect identical words", ->
-    detector = new Anagram "corn"
-    matches = detector.match ["corn", "dark", "Corn", "rank", "CORN", "cron", "park"]
-    expect(matches).toEqual ["cron"]
-
-  xit "does not detect non-anagrams with identical checksum", ->
-    detector = new Anagram "mass"
-    matches = detector.match ["last"]
-    expect(matches).toEqual []
-
-  xit "detects anagrams using case-insensitive subject", ->
-    detector = new Anagram "Orchestra"
-    matches = detector.match ["cashregister", "carthorse", "radishes"]
-    expect(matches).toEqual ["carthorse"]
-
-  xit "detects anagrams using case-insensitive candidates", ->
-    detector = new Anagram "orchestra"
-    matches = detector.match ["cashregister", "Carthorse", "radishes"]
-    expect(matches).toEqual ["carthorse"]
diff --git a/exercises/atbash-cipher/atbash-cipher.coffee b/exercises/atbash-cipher/atbash-cipher.coffee
new file mode 100644
index 00000000..502ad1cb
--- /dev/null
+++ b/exercises/atbash-cipher/atbash-cipher.coffee
@@ -0,0 +1,6 @@
+# This is a stub file for the CoffeeScript track
+
+class AtbashCipher
+  encode: (args) ->
+
+module.exports = AtbashCipher
diff --git a/exercises/atbash-cipher/atbash_cipher_test.spec.coffee b/exercises/atbash-cipher/atbash-cipher.spec.coffee
similarity index 95%
rename from exercises/atbash-cipher/atbash_cipher_test.spec.coffee
rename to exercises/atbash-cipher/atbash-cipher.spec.coffee
index a277f9d0..44e34372 100644
--- a/exercises/atbash-cipher/atbash_cipher_test.spec.coffee
+++ b/exercises/atbash-cipher/atbash-cipher.spec.coffee
@@ -1,4 +1,4 @@
-Atbash = require './atbash'
+Atbash = require './atbash-cipher'
 
 describe 'Atbash', ->
   it 'encodes no', ->
diff --git a/exercises/atbash-cipher/atbash.coffee b/exercises/atbash-cipher/atbash.coffee
new file mode 100644
index 00000000..d5197af8
--- /dev/null
+++ b/exercises/atbash-cipher/atbash.coffee
@@ -0,0 +1,5 @@
+class Atbash
+
+  @encode: (args) ->
+
+module.exports = Atbash
diff --git a/exercises/beer-song/beer-song.coffee b/exercises/beer-song/beer-song.coffee
new file mode 100644
index 00000000..5a3ac0a4
--- /dev/null
+++ b/exercises/beer-song/beer-song.coffee
@@ -0,0 +1,8 @@
+# This is a stub file for the CoffeeScript track
+
+class BeerSong
+  verse: (args) ->
+
+  sing: (args) ->
+
+module.exports = BeerSong
diff --git a/exercises/beer-song/beer-song_test.spec.coffee b/exercises/beer-song/beer-song.spec.coffee
similarity index 63%
rename from exercises/beer-song/beer-song_test.spec.coffee
rename to exercises/beer-song/beer-song.spec.coffee
index cdc82ce5..fdde8cca 100644
--- a/exercises/beer-song/beer-song_test.spec.coffee
+++ b/exercises/beer-song/beer-song.spec.coffee
@@ -1,25 +1,25 @@
-Beer = require("./beer")
-describe "Beer", ->
-  it "prints an arbitrary verse", ->
-    expect(Beer.verse 8).toEqual """
+Beer = require './beer-song'
+describe 'Beer', ->
+  it 'prints an arbitrary verse', ->
+    expect(Beer.verse 8).toEqual '
     8 bottles of beer on the wall, 8 bottles of beer.
     Take one down and pass it around, 7 bottles of beer on the wall.
-    """
+    '
 
-  xit "handles 1 bottle", ->
-    expect(Beer.verse 1).toEqual """
+  xit 'handles 1 bottle', ->
+    expect(Beer.verse 1).toEqual '
     1 bottle of beer on the wall, 1 bottle of beer.
     Take it down and pass it around, no more bottles of beer on the wall.
-    """
+    '
 
-  xit "handles 0 bottles", ->
-    expect(Beer.verse 0).toEqual """
+  xit 'handles 0 bottles', ->
+    expect(Beer.verse 0).toEqual '
     No more bottles of beer on the wall, no more bottles of beer.
     Go to the store and buy some more, 99 bottles of beer on the wall.
-    """
+    '
 
-  xit "sings several verses", ->
-    expect(Beer.sing 8, 6).toEqual """
+  xit 'sings several verses', ->
+    expect(Beer.sing 8, 6).toEqual '
     8 bottles of beer on the wall, 8 bottles of beer.
     Take one down and pass it around, 7 bottles of beer on the wall.
 
@@ -29,10 +29,10 @@ describe "Beer", ->
     6 bottles of beer on the wall, 6 bottles of beer.
     Take one down and pass it around, 5 bottles of beer on the wall.
 
-    """
+    '
 
-  xit "sings the rest of the verses", ->
-    expect(Beer.sing 3).toEqual """
+  xit 'sings the rest of the verses', ->
+    expect(Beer.sing 3).toEqual '
     3 bottles of beer on the wall, 3 bottles of beer.
     Take one down and pass it around, 2 bottles of beer on the wall.
 
@@ -45,6 +45,11 @@ describe "Beer", ->
     No more bottles of beer on the wall, no more bottles of beer.
     Go to the store and buy some more, 99 bottles of beer on the wall.
 
+<<<<<<< HEAD:exercises/beer-song/beer-song.spec.coffee
+    '
+=======
     """
-
-
+<<<<<<< HEAD:exercises/beer-song/beer-song.spec.coffee
+>>>>>>> beer-song stub file:exercises/beer-song/beer-song_test.spec.coffee
+=======
+>>>>>>> b04a45190849e2f4cb3f56024234c4da51df9ab7:exercises/beer-song/beer-song_test.spec.coffee
diff --git a/exercises/binary-search-tree/binary-search-tree.coffee b/exercises/binary-search-tree/binary-search-tree.coffee
new file mode 100644
index 00000000..e843b0e9
--- /dev/null
+++ b/exercises/binary-search-tree/binary-search-tree.coffee
@@ -0,0 +1,9 @@
+# This is a stub file for the CoffeeScript track
+class BinarySearchTree
+  constructor: (args) ->
+
+  insert: (args) ->
+
+  data: ->
+
+module.exports = BinarySearchTree
diff --git a/exercises/binary-search-tree/binary_search_tree_test.spec.coffee b/exercises/binary-search-tree/binary-search-tree.spec.coffee
similarity index 77%
rename from exercises/binary-search-tree/binary_search_tree_test.spec.coffee
rename to exercises/binary-search-tree/binary-search-tree.spec.coffee
index 6355c6a7..03856b5d 100644
--- a/exercises/binary-search-tree/binary_search_tree_test.spec.coffee
+++ b/exercises/binary-search-tree/binary-search-tree.spec.coffee
@@ -1,4 +1,4 @@
-Bst = require './bst'
+BinarySearchTree = require './binary-search-tree'
 
 recordAllData = (bst) ->
   out = []
@@ -8,31 +8,31 @@ recordAllData = (bst) ->
 describe 'BinarySearchTree', ->
 
   it 'data is retained', ->
-    expect(4).toEqual new Bst(4).data
+    expect(4).toEqual new BinarySearchTree(4).data
 
   xit 'inserting less', ->
-    four = new Bst(4)
+    four = new BinarySearchTree(4)
     four.insert(2)
 
     expect(four.data).toEqual 4
     expect(four.left.data).toEqual 2
 
   xit 'inserting same', ->
-    four = new Bst(4)
+    four = new BinarySearchTree(4)
     four.insert(4)
 
     expect(four.data).toEqual 4
     expect(four.left.data).toEqual 4
 
   xit 'inserting right', ->
-    four = new Bst(4)
+    four = new BinarySearchTree(4)
     four.insert(5)
 
     expect(four.data).toEqual 4
     expect(four.right.data).toEqual
 
   xit 'complex tree', ->
-    four = new Bst(4)
+    four = new BinarySearchTree(4)
     four.insert(2)
     four.insert(6)
     four.insert(1)
@@ -49,22 +49,22 @@ describe 'BinarySearchTree', ->
     expect(four.right.right.data).toEqual 7
 
   xit 'iterating one element', ->
-    expect(recordAllData(new Bst(4))).toEqual [4]
+    expect(recordAllData(new BinarySearchTree(4))).toEqual [4]
 
   xit 'iterating over smaller element', ->
-    four = new Bst(4)
+    four = new BinarySearchTree(4)
     four.insert(2)
 
     expect(recordAllData(four)).toEqual [2, 4]
 
   xit 'iterating over larger element', ->
-    four = new Bst(4)
+    four = new BinarySearchTree(4)
     four.insert(5)
 
     expect(recordAllData(four)).toEqual [4, 5]
 
   xit 'iterating over complex tree', ->
-    four = new Bst(4)
+    four = new BinarySearchTree(4)
     four.insert(2)
     four.insert(1)
     four.insert(3)
diff --git a/exercises/binary/binary.coffee b/exercises/binary/binary.coffee
new file mode 100644
index 00000000..16a062d1
--- /dev/null
+++ b/exercises/binary/binary.coffee
@@ -0,0 +1,8 @@
+# This is a stub file for the CoffeeScript track
+
+class Binary
+  constructor: (args) ->
+
+  toDecimal: ->
+
+module.exports = Binary
diff --git a/exercises/binary/binary_test.spec.coffee b/exercises/binary/binary.spec.coffee
similarity index 100%
rename from exercises/binary/binary_test.spec.coffee
rename to exercises/binary/binary.spec.coffee
diff --git a/exercises/bob/.meta/description.md b/exercises/bob/.meta/description.md
deleted file mode 100644
index 1072139f..00000000
--- a/exercises/bob/.meta/description.md
+++ /dev/null
@@ -1,10 +0,0 @@
-Bob is a lackadaisical teenager. In conversation, his responses are very limited.
-
-Bob answers 'Sure.' if you ask him a question.
-
-He answers 'Whoa, chill out!' if you yell at him.
-
-He says 'Fine. Be that way!' if you address him without actually saying
-anything.
-
-He answers 'Whatever.' to anything else.
diff --git a/exercises/bob/bob.coffee b/exercises/bob/bob.coffee
new file mode 100644
index 00000000..6fa2dd90
--- /dev/null
+++ b/exercises/bob/bob.coffee
@@ -0,0 +1,4 @@
+class Bob
+  hey: (args) ->
+
+module.exports = Bob
diff --git a/exercises/bob/bob.spec.coffee b/exercises/bob/bob.spec.coffee
new file mode 100644
index 00000000..428757c3
--- /dev/null
+++ b/exercises/bob/bob.spec.coffee
@@ -0,0 +1,58 @@
+Bob = require './bob'
+describe 'Bob', ->
+  bob = new Bob()
+  it 'stating something', ->
+    result = bob.hey 'Tom-ay-to, tom-aaaah-to.'
+    expect(result).toEqual 'Whatever.'
+
+  xit 'shouting', ->
+    result = bob.hey 'WATCH OUT!'
+    expect(result).toEqual 'Whoa, chill out!'
+
+  xit 'asking a question', ->
+    result = bob.hey 'Does this cryogenic chamber make me look fat?'
+    expect(result).toEqual 'Sure.'
+
+  xit 'talking forcefully', ->
+    result = bob.hey 'Let's go make out behind the gym!'
+    expect(result).toEqual 'Whatever.'
+
+  xit 'using acronyms in regular speech', ->
+    result = bob.hey 'It's OK if you don't want to go to the DMV.'
+    expect(result).toEqual 'Whatever.'
+
+  xit 'forceful questions', ->
+    result = bob.hey 'WHAT THE HELL WERE YOU THINKING?'
+    expect(result).toEqual 'Whoa, chill out!'
+
+  xit 'shouting numbers', ->
+    result = bob.hey '1, 2, 3 GO!'
+    expect(result).toEqual 'Whoa, chill out!'
+
+  xit 'only number', ->
+    result = bob.hey '1, 2, 3'
+    expect(result).toEqual 'Whatever.'
+
+  xit 'shouting with special characters', ->
+    result = bob.hey 'ZOMG THE %^*@#$(*^ ZOMBIES ARE COMING!!11!!1!'
+    expect(result).toEqual 'Whoa, chill out!'
+
+  xit 'shouting with no exclamation mark', ->
+    result = bob.hey 'I HATE YOU'
+    expect(result).toEqual 'Whoa, chill out!'
+
+  xit 'statement containing question mark', ->
+    result = bob.hey 'Ending with a ? means a question.'
+    expect(result).toEqual 'Whatever.'
+
+  xit 'prattling on', ->
+    result = bob.hey 'Wait! Hang on.  Are you going to be OK?'
+    expect(result).toEqual 'Sure.'
+
+  xit 'silence', ->
+    result = bob.hey ''
+    expect(result).toEqual 'Fine. Be that way!'
+
+  xit 'prolonged silence', ->
+    result = bob.hey '   '
+    expect(result).toEqual 'Fine. Be that way!'
diff --git a/exercises/bob/bob_test.spec.coffee b/exercises/bob/bob_test.spec.coffee
deleted file mode 100644
index 435a5e32..00000000
--- a/exercises/bob/bob_test.spec.coffee
+++ /dev/null
@@ -1,58 +0,0 @@
-Bob = require "./bob"
-describe "Bob", ->
-  bob = new Bob()
-  it "stating something", ->
-    result = bob.hey "Tom-ay-to, tom-aaaah-to."
-    expect(result).toEqual "Whatever."
-
-  xit "shouting", ->
-    result = bob.hey "WATCH OUT!"
-    expect(result).toEqual "Whoa, chill out!"
-
-  xit "asking a question", ->
-    result = bob.hey "Does this cryogenic chamber make me look fat?"
-    expect(result).toEqual "Sure."
-
-  xit "talking forcefully", ->
-    result = bob.hey "Let's go make out behind the gym!"
-    expect(result).toEqual "Whatever."
-
-  xit "using acronyms in regular speech", ->
-    result = bob.hey "It's OK if you don't want to go to the DMV."
-    expect(result).toEqual "Whatever."
-
-  xit "forceful questions", ->
-    result = bob.hey "WHAT THE HELL WERE YOU THINKING?"
-    expect(result).toEqual "Whoa, chill out!"
-
-  xit "shouting numbers", ->
-    result = bob.hey "1, 2, 3 GO!"
-    expect(result).toEqual "Whoa, chill out!"
-
-  xit "only number", ->
-    result = bob.hey "1, 2, 3"
-    expect(result).toEqual "Whatever."
-
-  xit "shouting with special characters", ->
-    result = bob.hey "ZOMG THE %^*@#$(*^ ZOMBIES ARE COMING!!11!!1!"
-    expect(result).toEqual "Whoa, chill out!"
-
-  xit "shouting with no exclamation mark", ->
-    result = bob.hey "I HATE YOU"
-    expect(result).toEqual "Whoa, chill out!"
-
-  xit "statement containing question mark", ->
-    result = bob.hey "Ending with a ? means a question."
-    expect(result).toEqual "Whatever."
-
-  xit "prattling on", ->
-    result = bob.hey "Wait! Hang on.  Are you going to be OK?"
-    expect(result).toEqual "Sure."
-
-  xit "silence", ->
-    result = bob.hey ""
-    expect(result).toEqual "Fine. Be that way!"
-
-  xit "prolonged silence", ->
-    result = bob.hey "   "
-    expect(result).toEqual "Fine. Be that way!"
diff --git a/exercises/clock/clock.spec.coffee b/exercises/clock/clock.spec.coffee
new file mode 100644
index 00000000..ee7dd276
--- /dev/null
+++ b/exercises/clock/clock.spec.coffee
@@ -0,0 +1,46 @@
+Clock = require './clock'
+
+describe 'Clock', ->
+  it 'prints the hour', ->
+    expect(Clock.at(8).toString()).toEqual '08:00'
+    expect(Clock.at(9).toString()).toEqual '09:00'
+
+  xit 'prints past the hour', ->
+    expect(Clock.at(11, 9).toString()).toEqual '11:09'
+    expect(Clock.at(11, 19).toString()).toEqual '11:19'
+
+  xit 'can add minutes', ->
+    clock = Clock.at(10).plus 3
+    expect(clock.toString()).toEqual '10:03'
+
+  xit 'can add over an hour', ->
+    clock = Clock.at(10).plus 61
+    expect(clock.toString()).toEqual '11:01'
+
+  xit 'wraps around midnight', ->
+    clock = Clock.at(23, 59).plus 2
+    expect(clock.toString()).toEqual '00:01'
+
+  xit 'can subtract minutes', ->
+    clock = Clock.at(10, 3).minus 3
+    expect(clock.toString()).toEqual '10:00'
+
+  xit 'can subtract over an hour', ->
+    clock = Clock.at(10, 3).minus 30
+    expect(clock.toString()).toEqual '09:33'
+    clock = Clock.at(10, 3).minus 70
+    expect(clock.toString()).toEqual '08:53'
+
+  xit 'can know if it's equal to another clock', ->
+    clock1 = Clock.at(10, 3)
+    clock2 = Clock.at(10, 3)
+    expect(clock1.equals clock2).toBe true
+
+  xit 'can know if it's not equal to another clock', ->
+    clock1 = Clock.at(10, 3)
+    clock2 = Clock.at(10, 4)
+    expect(clock1.equals clock2).toBe false
+
+  xit 'wraps around midnight backwards', ->
+    clock = Clock.at(0, 3).minus 4
+    expect(clock.toString()).toEqual '23:59'
diff --git a/exercises/clock/clock_test.spec.coffee b/exercises/clock/clock_test.spec.coffee
deleted file mode 100644
index 815f2870..00000000
--- a/exercises/clock/clock_test.spec.coffee
+++ /dev/null
@@ -1,47 +0,0 @@
-Clock = require './clock'
-
-describe "Clock", ->
-  it "prints the hour", ->
-    expect(Clock.at(8).toString()).toEqual "08:00"
-    expect(Clock.at(9).toString()).toEqual "09:00"
-
-  xit "prints past the hour", ->
-    expect(Clock.at(11, 9).toString()).toEqual "11:09"
-    expect(Clock.at(11, 19).toString()).toEqual "11:19"
-
-  xit "can add minutes", ->
-    clock = Clock.at(10).plus 3
-    expect(clock.toString()).toEqual "10:03"
-
-  xit "can add over an hour", ->
-    clock = Clock.at(10).plus 61
-    expect(clock.toString()).toEqual "11:01"
-
-  xit "wraps around midnight", ->
-    clock = Clock.at(23, 59).plus 2
-    expect(clock.toString()).toEqual "00:01"
-
-  xit "can subtract minutes", ->
-    clock = Clock.at(10, 3).minus 3
-    expect(clock.toString()).toEqual "10:00"
-
-  xit "can subtract over an hour", ->
-    clock = Clock.at(10, 3).minus 30
-    expect(clock.toString()).toEqual "09:33"
-    clock = Clock.at(10, 3).minus 70
-    expect(clock.toString()).toEqual "08:53"
-
-  xit "can know if it's equal to another clock", ->
-    clock1 = Clock.at(10, 3)
-    clock2 = Clock.at(10, 3)
-    expect(clock1.equals clock2).toBe true
-
-  xit "can know if it's not equal to another clock", ->
-    clock1 = Clock.at(10, 3)
-    clock2 = Clock.at(10, 4)
-    expect(clock1.equals clock2).toBe false
-
-  xit "wraps around midnight backwards", ->
-    clock = Clock.at(0, 3).minus 4
-    expect(clock.toString()).toEqual "23:59"
-
diff --git a/exercises/hello-world/hello_world.coffee b/exercises/hello-world/hello-world.coffee
similarity index 55%
rename from exercises/hello-world/hello_world.coffee
rename to exercises/hello-world/hello-world.coffee
index 7f253da3..09c28c85 100644
--- a/exercises/hello-world/hello_world.coffee
+++ b/exercises/hello-world/hello-world.coffee
@@ -1,5 +1,4 @@
-# Simply return the string 'Hello, World!'
-
+# This is a stub file for the CoffeeScript track
 class HelloWorld
   hello: -> ''
 
diff --git a/exercises/hello-world/hello_world.spec.coffee b/exercises/hello-world/hello-world.spec.coffee
similarity index 65%
rename from exercises/hello-world/hello_world.spec.coffee
rename to exercises/hello-world/hello-world.spec.coffee
index c5e6e037..f457f579 100644
--- a/exercises/hello-world/hello_world.spec.coffee
+++ b/exercises/hello-world/hello-world.spec.coffee
@@ -1,8 +1,8 @@
-HelloWorld = require "./hello_world"
+HelloWorld = require './hello-world'
 
 describe 'HelloWorld', ->
   hello_world = new HelloWorld()
 
-  it "says 'Hello, World!'", ->
+  it 'says \'Hello, World!\'', ->
     result = hello_world.hello()
     expect(result).toEqual 'Hello, World!'
diff --git a/exercises/hexadecimal/hexadecimal.coffee b/exercises/hexadecimal/hexadecimal.coffee
new file mode 100644
index 00000000..c78c6d3b
--- /dev/null
+++ b/exercises/hexadecimal/hexadecimal.coffee
@@ -0,0 +1,7 @@
+# This is a stub file for the CoffeeScript track
+class Hexadecimal
+  constructor: (args) ->
+
+  toDecimal: (args) ->
+
+module.exports = Hexadecimal
diff --git a/exercises/hexadecimal/hexadecimal.spec.coffee b/exercises/hexadecimal/hexadecimal.spec.coffee
new file mode 100644
index 00000000..a786126b
--- /dev/null
+++ b/exercises/hexadecimal/hexadecimal.spec.coffee
@@ -0,0 +1,43 @@
+Hexadecimal = require './hexadecimal'
+
+describe 'Hexadecimal', ->
+
+  it 'hex 1 is decimal 1', ->
+    hex = new Hexadecimal('1')
+    expect(hex.toDecimal()).toEqual(1)
+
+  xit 'hex c is decimal 12', ->
+    hex = new Hexadecimal('c')
+    expect(hex.toDecimal()).toEqual(12)
+
+  xit 'hex 10 is decimal 16', ->
+    hex = new Hexadecimal('10')
+    expect(hex.toDecimal()).toEqual(16)
+
+  xit 'hex af is decimal 175', ->
+    hex = new Hexadecimal('af')
+    expect(hex.toDecimal()).toEqual(175)
+
+  xit 'hex 100 is decimal 256', ->
+    hex = new Hexadecimal('100')
+    expect(hex.toDecimal()).toEqual(256)
+
+  xit 'hex 19ace is decimal 105166', ->
+    hex = new Hexadecimal('19ace')
+    expect(hex.toDecimal()).toEqual(105166)
+
+  xit 'invalid hex is decimal 0', ->
+    hex = new Hexadecimal('carrot')
+    expect(hex.toDecimal()).toEqual(0)
+
+  xit 'black', ->
+    hex = new Hexadecimal('000000')
+    expect(hex.toDecimal()).toEqual(0)
+
+  xit 'white', ->
+    hex = new Hexadecimal('ffffff')
+    expect(hex.toDecimal()).toEqual(16777215)
+
+  xit 'yellow', ->
+    hex = new Hexadecimal('ffff00')
+    expect(hex.toDecimal()).toEqual(16776960)
diff --git a/exercises/hexadecimal/hexadecimal_test.spec.coffee b/exercises/hexadecimal/hexadecimal_test.spec.coffee
deleted file mode 100644
index a442565e..00000000
--- a/exercises/hexadecimal/hexadecimal_test.spec.coffee
+++ /dev/null
@@ -1,43 +0,0 @@
-Hexadecimal = require('./hexadecimal')
-
-describe "Hexadecimal", ->
-
-  it "hex 1 is decimal 1", ->
-    hex = new Hexadecimal("1")
-    expect(hex.toDecimal()).toEqual(1)
-
-  xit "hex c is decimal 12", ->
-    hex = new Hexadecimal("c")
-    expect(hex.toDecimal()).toEqual(12)
-
-  xit "hex 10 is decimal 16", ->
-    hex = new Hexadecimal("10")
-    expect(hex.toDecimal()).toEqual(16)
-
-  xit "hex af is decimal 175", ->
-    hex = new Hexadecimal("af")
-    expect(hex.toDecimal()).toEqual(175)
-
-  xit "hex 100 is decimal 256", ->
-    hex = new Hexadecimal("100")
-    expect(hex.toDecimal()).toEqual(256)
-
-  xit "hex 19ace is decimal 105166", ->
-    hex = new Hexadecimal("19ace")
-    expect(hex.toDecimal()).toEqual(105166)
-
-  xit "invalid hex is decimal 0", ->
-    hex = new Hexadecimal("carrot")
-    expect(hex.toDecimal()).toEqual(0)
-
-  xit "black", ->
-    hex = new Hexadecimal("000000")
-    expect(hex.toDecimal()).toEqual(0)
-
-  xit "white", ->
-    hex = new Hexadecimal("ffffff")
-    expect(hex.toDecimal()).toEqual(16777215)
-
-  xit "yellow", ->
-    hex = new Hexadecimal("ffff00")
-    expect(hex.toDecimal()).toEqual(16776960)
diff --git a/exercises/linked-list/linked-list.coffee b/exercises/linked-list/linked-list.coffee
new file mode 100644
index 00000000..3112d8eb
--- /dev/null
+++ b/exercises/linked-list/linked-list.coffee
@@ -0,0 +1,17 @@
+class LinkedList
+  count: ->
+
+  pushNode: (args) ->
+
+  popNode: (args) ->
+
+  deleteNode: (args) ->
+
+  shiftNode: (args) ->
+
+  unshiftNode: (args) ->
+
+  countNodes: ->
+
+
+module.exports = LinkedList
diff --git a/exercises/linked-list/linked-list_test.spec.coffee b/exercises/linked-list/linked-list.spec.coffee
similarity index 97%
rename from exercises/linked-list/linked-list_test.spec.coffee
rename to exercises/linked-list/linked-list.spec.coffee
index 64760f43..930c7cdb 100644
--- a/exercises/linked-list/linked-list_test.spec.coffee
+++ b/exercises/linked-list/linked-list.spec.coffee
@@ -1,9 +1,10 @@
-LinkedList = require('./linkedList')
+LinkedList = require './linked-list'
 
 describe 'LinkedList', ->
     it 'init', ->
         list = new LinkedList()
         expect(list.count).toBe 0
+
     xit 'push/pop', ->
         list = new LinkedList()
         list.pushNode(10)
@@ -11,12 +12,14 @@ describe 'LinkedList', ->
         list.pushNode(30)
         expect(list.popNode()).toBe 30
         expect(list.popNode()).toBe 20
+
     xit 'push/shift', ->
         list = new LinkedList()
         list.pushNode(10)
         list.pushNode(20)
         expect(list.shiftNode()).toBe 10
         expect(list.shiftNode()).toBe 20
+
     xit 'unshift/shift', ->
         list = new LinkedList()
         list.unshiftNode(20)
@@ -24,11 +27,13 @@ describe 'LinkedList', ->
         list.unshiftNode(30)
         expect(list.shiftNode()).toBe 30
         expect(list.shiftNode()).toBe 10
+
     xit 'unshift/pop', ->
         list = new LinkedList()
         list.unshiftNode(20)
         list.unshiftNode(30)
         expect(list.popNode()).toBe 20
+
     xit 'example', ->
         list = new LinkedList()
         list.pushNode(10)
@@ -44,9 +49,11 @@ describe 'LinkedList', ->
         list.deleteNode(60)
         expect(list.countNodes()).toBe 1
         expect(list.shiftNode()).toBe 30
+
     xit 'pops undefined when there are no elements', ->
         list = new LinkedList()
         expect(list.popNode()).toBe undefined
+
     xit ' can count its elements', ->
         list = new LinkedList()
         list.pushNode(20)
@@ -61,9 +68,9 @@ describe 'LinkedList', ->
         list.deleteNode(10)
         expect(list.countNodes()).toBe 2
         expect(list.shiftNode()).toBe 20
+        
     xit 'deletes only the last element', ->
         list = new LinkedList()
         list.pushNode(10)
         list.deleteNode(10)
         expect(list.countNodes()).toBe 0
-
diff --git a/exercises/luhn/luhn.coffee b/exercises/luhn/luhn.coffee
new file mode 100644
index 00000000..d7c04f2e
--- /dev/null
+++ b/exercises/luhn/luhn.coffee
@@ -0,0 +1,7 @@
+class Luhn
+  constructor: (args) ->
+
+  valid: ->
+    
+
+module.exports = Luhn
diff --git a/exercises/luhn/luhn.spec.coffee b/exercises/luhn/luhn.spec.coffee
new file mode 100644
index 00000000..03386724
--- /dev/null
+++ b/exercises/luhn/luhn.spec.coffee
@@ -0,0 +1,71 @@
+Luhn = require './luhn'
+
+describe 'Luhn', ->
+
+  it 'single digit strings can not be valid', ->
+    luhn = new Luhn('1')
+    expect(luhn.valid).toEqual(false)
+
+  xit 'a single zero is invalid', ->
+    luhn = new Luhn('0')
+    expect(luhn.valid).toEqual(false)
+
+  xit 'a simple valid SIN that remains valid if reversed', ->
+    luhn = new Luhn('059')
+    expect(luhn.valid).toEqual(true)
+
+  xit 'a simple valid SIN that becomes invalid if reversed', ->
+    luhn = new Luhn('59')
+    expect(luhn.valid).toEqual(true)
+
+  xit 'a valid Canadian SIN', ->
+    luhn = new Luhn('055 444 286')
+    expect(luhn.valid).toEqual(true)
+
+  xit 'invalid credit card', ->
+    luhn = new Luhn('8273 1232 7352 0569')
+    expect(luhn.valid).toEqual(false)
+
+  xit 'invalid credit card', ->
+    luhn = new Luhn('8273 1232 7352 0569')
+    expect(luhn.valid).toEqual(false)
+
+  xit 'valid number with an even number of digits', ->
+    luhn = new Luhn('095 245 88')
+    expect(luhn.valid).toEqual(true)
+
+  xit 'valid number with an odd number of spaces', ->
+    luhn = new Luhn('234 567 891 234')
+    expect(luhn.valid).toEqual(true)
+
+  xit 'valid strings with a non-digit added at the end become invalid', ->
+    luhn = new Luhn('059a')
+    expect(luhn.valid).toEqual(false)
+
+  xit 'valid strings with punctuation included become invalid', ->
+    luhn = new Luhn('055-444-285')
+    expect(luhn.valid).toEqual(false)
+
+  xit 'valid strings with symbols included become invalid', ->
+    luhn = new Luhn('055# 444$ 285')
+    expect(luhn.valid).toEqual(false)
+
+  xit 'single zero with space is invalid', ->
+    luhn = new Luhn(' 0')
+    expect(luhn.valid).toEqual(false)
+
+  xit 'more than a single zero is valid', ->
+    luhn = new Luhn('0000 0')
+    expect(luhn.valid).toEqual(true)
+
+  xit 'input digit 9 is correctly converted to output digit 9', ->
+    luhn = new Luhn('091')
+    expect(luhn.valid).toEqual(true)
+
+  xit 'using ascii value for non-doubled non-digit isn\'t allowed', ->
+    luhn = new Luhn('055b 444 285')
+    expect(luhn.valid).toEqual(false)
+
+  xit 'using ascii value for doubled non-digit isn\'t allowed', ->
+    luhn = new Luhn(':9')
+    expect(luhn.valid).toEqual(false)
diff --git a/exercises/luhn/luhn_test.spec.coffee b/exercises/luhn/luhn_test.spec.coffee
deleted file mode 100644
index 08703886..00000000
--- a/exercises/luhn/luhn_test.spec.coffee
+++ /dev/null
@@ -1,47 +0,0 @@
-Luhn = require './luhn'
-
-describe 'Luhn', ->
-
-  it "check digit", ->
-    luhn = new Luhn(34567)
-    expect(luhn.checkDigit).toEqual(7)
-
-  xit "check digit again", ->
-    luhn = new Luhn(91370)
-    expect(luhn.checkDigit).toEqual(0)
-
-  xit "addends", ->
-    luhn = new Luhn(12121)
-    expect(luhn.addends).toEqual([1, 4, 1, 4, 1])
-
-  xit "too large added", ->
-    luhn = new Luhn(8631)
-    expect(luhn.addends).toEqual([7, 6, 6, 1])
-
-  xit "checksum", ->
-    luhn = new Luhn(4913)
-    expect(luhn.checksum).toEqual(22)
-
-  xit "checksum again", ->
-    luhn = new Luhn(201773)
-    expect(luhn.checksum).toEqual(21)
-
-  xit "invalid number", ->
-    luhn = new Luhn(738)
-    expect(luhn.valid).toEqual(false)
-
-  xit "valid number", ->
-    luhn = new Luhn(8739567)
-    expect(luhn.valid).toEqual(true)
-
-  xit "create valid number", ->
-    number = Luhn.create(123)
-    expect(number).toEqual(1230)
-
-  xit "create other valid number", ->
-    number = Luhn.create(873956)
-    expect(number).toEqual(8739567)
-
-  xit "create yet another valid number", ->
-    number = Luhn.create(837263756)
-    expect(number).toEqual(8372637564)
diff --git a/exercises/nth-prime/nth-prime.coffee b/exercises/nth-prime/nth-prime.coffee
new file mode 100644
index 00000000..2e03189a
--- /dev/null
+++ b/exercises/nth-prime/nth-prime.coffee
@@ -0,0 +1,4 @@
+class NthPrime
+  nth: (args) ->
+
+module.exports = NthPrime
diff --git a/exercises/nth-prime/nth_prime_test.spec.coffee b/exercises/nth-prime/nth-prime.spec.coffee
similarity index 79%
rename from exercises/nth-prime/nth_prime_test.spec.coffee
rename to exercises/nth-prime/nth-prime.spec.coffee
index 581e7324..4fdef710 100644
--- a/exercises/nth-prime/nth_prime_test.spec.coffee
+++ b/exercises/nth-prime/nth-prime.spec.coffee
@@ -1,4 +1,4 @@
-Prime = require './prime'
+Prime = require './nth-prime'
 
 describe 'Prime', ->
 
@@ -19,4 +19,4 @@ describe 'Prime', ->
     expect(prime).toEqual(104743)
 
   xit 'weird case', ->
-    expect(-> Prime.nth(0)).toThrow("Prime is not possible")
+    expect(-> Prime.nth(0)).toThrow('Prime is not possible')
diff --git a/exercises/nucleotide-count/nucleotide-count.coffee b/exercises/nucleotide-count/nucleotide-count.coffee
new file mode 100644
index 00000000..0e0edd59
--- /dev/null
+++ b/exercises/nucleotide-count/nucleotide-count.coffee
@@ -0,0 +1,7 @@
+class NucleotideCount
+  constructor: (args) ->
+    @nucleotideCounts =
+
+  count: (args) ->
+
+module.exports = NucleotideCount
diff --git a/exercises/nucleotide-count/nucleotide-count_test.spec.coffee b/exercises/nucleotide-count/nucleotide-count.spec.coffee
similarity index 56%
rename from exercises/nucleotide-count/nucleotide-count_test.spec.coffee
rename to exercises/nucleotide-count/nucleotide-count.spec.coffee
index 49aa0a1d..c97ef99a 100644
--- a/exercises/nucleotide-count/nucleotide-count_test.spec.coffee
+++ b/exercises/nucleotide-count/nucleotide-count.spec.coffee
@@ -1,25 +1,25 @@
-DNA = require './example'
+NucleotideCount = require './nucleotide-count'
 
-describe 'DNA', ->
+describe 'NucleotideCount', ->
   it 'has no nucleotides', ->
     expected =
       A: 0
       T: 0
       C: 0
       G: 0
-    dna = new DNA('')
+    dna = new NucleotideCount('')
     expect(dna.nucleotideCounts).toEqual expected
 
   xit 'has no adoenosine', ->
-    dna = new DNA('')
+    dna = new NucleotideCount('')
     expect(dna.count('A')).toEqual 0
 
   xit 'repetitive cytidine gets counts', ->
-    dna = new DNA('CCCCC')
+    dna = new NucleotideCount('CCCCC')
     expect(dna.count('C')).toEqual 5
 
   xit 'repetitive sequence has only gaunosine', ->
-    dna = new DNA('GGGGGGGG')
+    dna = new NucleotideCount('GGGGGGGG')
     expected =
       A: 0
       T: 0
@@ -28,22 +28,28 @@ describe 'DNA', ->
     expect(dna.nucleotideCounts).toEqual expected
 
   xit 'counts only thymidine', ->
-    dna = new DNA('GGGGTAACCCGG')
+    dna = new NucleotideCount('GGGGTAACCCGG')
     expect(dna.count('T')).toEqual 1
 
   xit 'counts a nucleotide only once', ->
-    dna = new DNA('GGTTGG')
+    dna = new NucleotideCount('GGTTGG')
     dna.count('T')
     expect(dna.count('T')).toEqual 2
 
+  xit 'validates strand', ->
+    dna = new NucleotideCount('AGTXCG')
+    expect ->
+      dna.count 'G'
+    .toThrow new Error('Invalid nucleotide strand')
+
   xit 'validates nucleotides', ->
-    dna = new DNA('GGTTGG')
+    dna = new NucleotideCount('GGTTGG')
     expect ->
       dna.count 'X'
-    .toThrow new Error('Invalid Nucleotide')
+    .toThrow new Error('Invalid nucleotide')
 
   xit 'counts all nucleotides', ->
-    dna = new DNA('AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC')
+    dna = new NucleotideCount('AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC')
     expected =
       A: 20
       T: 21
diff --git a/exercises/palindrome-products/palindrome-products.coffee b/exercises/palindrome-products/palindrome-products.coffee
new file mode 100644
index 00000000..926f6a7c
--- /dev/null
+++ b/exercises/palindrome-products/palindrome-products.coffee
@@ -0,0 +1,10 @@
+class PalindromeProducts
+  constructor: (args) ->
+
+  generate: ->
+
+  smallest: ->
+
+  largest: ->
+
+module.export = PalindromeProducts
diff --git a/exercises/palindrome-products/palindrome_products_test.spec.coffee b/exercises/palindrome-products/palindrome-products.spec.coffee
similarity index 52%
rename from exercises/palindrome-products/palindrome_products_test.spec.coffee
rename to exercises/palindrome-products/palindrome-products.spec.coffee
index 7296cc88..8fe0bf8f 100644
--- a/exercises/palindrome-products/palindrome_products_test.spec.coffee
+++ b/exercises/palindrome-products/palindrome-products.spec.coffee
@@ -1,37 +1,37 @@
-Palindromes = require('./palindromes')
+Palindromes = require './palindrome-products'
 
-describe "Palindrome", ->
+describe 'Palindrome', ->
 
-  it "largest palindrome from single digit factors", ->
-    palindromes = new Palindromes({maxFactor: 9})
+  it 'largest palindrome from single digit factors', ->
+    palindromes = new PalindromeProducts({maxFactor: 9})
     palindromes.generate()
     largest = palindromes.largest()
     expect(largest.value).toEqual(9)
     expect([[[3, 3], [1, 9]], [[1, 9], [3, 3]]]).toContain(largest.factors)
 
-  xit "largest palindrome from double digit factors", ->
-    palindromes = new Palindromes({ maxFactor: 99, minFactor: 10 })
+  xit 'largest palindrome from double digit factors', ->
+    palindromes = new PalindromeProducts({ maxFactor: 99, minFactor: 10 })
     palindromes.generate()
     largest = palindromes.largest()
     expect(largest.value).toEqual(9009)
     expect(largest.factors).toEqual([[91, 99]])
 
-  xit "smallest palindrome from double digit factors", ->
-    palindromes = new Palindromes({ maxFactor: 99, minFactor: 10 })
+  xit 'smallest palindrome from double digit factors', ->
+    palindromes = new PalindromeProducts({ maxFactor: 99, minFactor: 10 })
     palindromes.generate()
     smallest = palindromes.smallest()
     expect(smallest.value).toEqual(121)
     expect(smallest.factors).toEqual([[11, 11]])
 
-  xit "largest palindrome from triple digit factors", ->
-    palindromes = new Palindromes({ maxFactor: 999, minFactor: 100 })
+  xit 'largest palindrome from triple digit factors', ->
+    palindromes = new PalindromeProducts({ maxFactor: 999, minFactor: 100 })
     palindromes.generate()
     largest = palindromes.largest()
     expect(largest.value).toEqual(906609)
     expect(largest.factors).toEqual([[913, 993]])
 
-  xit "smallest palindrome from triple digit factors", ->
-    palindromes = new Palindromes({ maxFactor: 999, minFactor: 100 })
+  xit 'smallest palindrome from triple digit factors', ->
+    palindromes = new PalindromeProducts({ maxFactor: 999, minFactor: 100 })
     palindromes.generate()
     smallest = palindromes.smallest()
     expect(smallest.value).toEqual(10201)
diff --git a/exercises/pascals-triangle/pascals-triangle.coffee b/exercises/pascals-triangle/pascals-triangle.coffee
new file mode 100644
index 00000000..c59ec36d
--- /dev/null
+++ b/exercises/pascals-triangle/pascals-triangle.coffee
@@ -0,0 +1,5 @@
+class PascalsTriangle
+  constructor: (args) ->
+    @array =
+
+module.exports = PascalsTriangle
diff --git a/exercises/pascals-triangle/pascal-triangle-spec.coffee b/exercises/pascals-triangle/pascals-triangle.spec.coffee
similarity index 72%
rename from exercises/pascals-triangle/pascal-triangle-spec.coffee
rename to exercises/pascals-triangle/pascals-triangle.spec.coffee
index af441c13..4028a0fc 100644
--- a/exercises/pascals-triangle/pascal-triangle-spec.coffee
+++ b/exercises/pascals-triangle/pascals-triangle.spec.coffee
@@ -1,27 +1,26 @@
-Pascal = require './example.coffee'
+Pascal = require './pascals-triangle'
 
 describe 'Pascal', ->
   it 'with one row', ->
-    arr = new Pascal(1)
+    arr = new PascalsTriangle(1)
     expect(arr.array).toEqual [[1]]
 
   xit 'with two rows', ->
-    arr = new Pascal(2)
+    arr = new PascalsTriangle(2)
     expect(arr.array).toEqual [[1], [1,1]]
 
   xit 'with three rows', ->
-    arr = new Pascal(3)
+    arr = new PascalsTriangle(3)
     expect(arr.array).toEqual [[1], [1,1], [1,2,1]]
 
   xit 'with four rows', ->
-    arr = new Pascal(4)
+    arr = new PascalsTriangle(4)
     expect(arr.array).toEqual [[1], [1,1], [1,2,1], [1,3,3,1]]
 
   xit 'with five rows', ->
-    arr = new Pascal(5)
+    arr = new PascalsTriangle(5)
     expect(arr.array).toEqual [[1], [1,1], [1,2,1], [1,3,3,1], [1,4,6,4,1]]
 
   xit 'should equal 20th row', ->
-    arr = new Pascal(20)
+    arr = new PascalsTriangle(20)
     expect(arr.array[19]).toEqual [1, 19, 171, 969, 3876, 11628, 27132, 50388, 75582, 92378, 92378, 75582, 50388, 27132, 11628, 3876, 969, 171, 19, 1]
-
diff --git a/exercises/queen-attack/queen-attack.coffee b/exercises/queen-attack/queen-attack.coffee
new file mode 100644
index 00000000..e0b55a07
--- /dev/null
+++ b/exercises/queen-attack/queen-attack.coffee
@@ -0,0 +1,6 @@
+class QueenAttack
+  constructor: (args) ->
+    @white =
+    @black =
+
+module.exports = QueenAttack
diff --git a/exercises/queen-attack/queen-attack.spec.coffee b/exercises/queen-attack/queen-attack.spec.coffee
new file mode 100644
index 00000000..3a891c1d
--- /dev/null
+++ b/exercises/queen-attack/queen-attack.spec.coffee
@@ -0,0 +1,58 @@
+Queens = require './queen-attack'
+
+describe 'Queens', ->
+  it 'has the correct default positions', ->
+    queens = new QueenAttack
+    expect(queens.white).toEqual([0,3])
+    expect(queens.black).toEqual([7,3])
+
+  xit 'initialized with specific placement', ->
+    queens = new QueenAttack({white: [3,7], black: [6,1] })
+    expect(queens.white).toEqual([3, 7])
+    expect(queens.black).toEqual([6, 1])
+
+
+  xit 'cannot occupy the same space', ->
+    positioning = { white: [2,4], black: [2,4] }
+    expect(-> new QueenAttack(positioning)).toThrow('Queens cannot share the same space')
+
+
+  xit 'toString representation', ->
+    positioning = {white: [2, 4], black: [6, 6]}
+    queens = new QueenAttack(positioning)
+    board = '_ _ _ _ _ _ _ _\n_ _ _ _ _ _ _ _\n_ _ _ _ _ _ _ _\n_ _ _ _ _ _ _ _\n' +
+      '_ _ W _ _ _ _ _\n_ _ _ _ _ _ _ _\n_ _ _ _ _ _ B _\n_ _ _ _ _ _ _ _'
+    expect(queens.toString()).toEqual(board)
+
+  xit 'queens cannot attack', ->
+    queens = new QueenAttack({ white: [2,3], black: [4,7] })
+    expect(queens.canAttack()).toEqual(false)
+
+
+  xit 'queens can attack when they are on the same row', ->
+    queens = new QueenAttack({ white: [2,4], black: [2,7] })
+    expect(queens.canAttack()).toEqual(true)
+
+
+  xit 'queens can attack when they are on the same column', ->
+    queens = new QueenAttack({ white: [5,4], black: [2,4] })
+    expect(queens.canAttack()).toEqual(true)
+
+
+  xit 'queens can attack diagonally', ->
+    queens = new Queens({ white: [1, 1], black: [6, 6] })
+    expect(queens.canAttack()).toEqual(true)
+
+
+  xit 'queens can attack another diagonally', ->
+    queens = new Queens({ white: [0, 6], black: [1, 7] })
+    expect(queens.canAttack()).toEqual(true)
+
+
+  xit 'queens can attack yet another diagonally', ->
+    queens = new Queens({ white: [4, 1], black: [6, 3] })
+    expect(queens.canAttack()).toEqual(true)
+
+  xit 'queens can attack yet yet another diagonally', ->
+    queens = new Queens({ white: [6, 1], black: [1, 6] })
+    expect(queens.canAttack()).toEqual(true)
diff --git a/exercises/queen-attack/queen_attack_test.spec.coffee b/exercises/queen-attack/queen_attack_test.spec.coffee
deleted file mode 100644
index 38ff743b..00000000
--- a/exercises/queen-attack/queen_attack_test.spec.coffee
+++ /dev/null
@@ -1,59 +0,0 @@
-Queens = require './queens'
-
-describe "Queens", ->
-  it "has the correct default positions", ->
-    queens = new Queens
-    expect(queens.white).toEqual([0,3])
-    expect(queens.black).toEqual([7,3])
-
-  xit "initialized with specific placement", ->
-    queens = new Queens({white: [3,7], black: [6,1] })
-    expect(queens.white).toEqual([3, 7])
-    expect(queens.black).toEqual([6, 1])
-
-
-  xit "cannot occupy the same space", ->
-    positioning = { white: [2,4], black: [2,4] }
-    expect(-> new Queens(positioning)).toThrow("Queens cannot share the same space")
-
-
-  xit "toString representation", ->
-    positioning = {white: [2, 4], black: [6, 6]}
-    queens = new Queens(positioning)
-    board = "_ _ _ _ _ _ _ _\n_ _ _ _ _ _ _ _\n_ _ _ _ _ _ _ _\n_ _ _ _ _ _ _ _\n" +
-      "_ _ W _ _ _ _ _\n_ _ _ _ _ _ _ _\n_ _ _ _ _ _ B _\n_ _ _ _ _ _ _ _"
-    expect(queens.toString()).toEqual(board)
-
-  xit "queens cannot attack", ->
-    queens = new Queens({ white: [2,3], black: [4,7] })
-    expect(queens.canAttack()).toEqual(false)
-
-
-  xit "queens can attack when they are on the same row", ->
-    queens = new Queens({ white: [2,4], black: [2,7] })
-    expect(queens.canAttack()).toEqual(true)
-
-
-  xit "queens can attack when they are on the same column", ->
-    queens = new Queens({ white: [5,4], black: [2,4] })
-    expect(queens.canAttack()).toEqual(true)
-
-
-  xit "queens can attack diagonally", ->
-    queens = new Queens({ white: [1, 1], black: [6, 6] })
-    expect(queens.canAttack()).toEqual(true)
-
-
-  xit "queens can attack another diagonally", ->
-    queens = new Queens({ white: [0, 6], black: [1, 7] })
-    expect(queens.canAttack()).toEqual(true)
-
-
-  xit "queens can attack yet another diagonally", ->
-    queens = new Queens({ white: [4, 1], black: [6, 3] })
-    expect(queens.canAttack()).toEqual(true)
-
-  xit "queens can attack yet yet another diagonally", ->
-    queens = new Queens({ white: [6, 1], black: [1, 6] })
-    expect(queens.canAttack()).toEqual(true)
-
diff --git a/exercises/triangle/triangle.coffee b/exercises/triangle/triangle.coffee
new file mode 100644
index 00000000..5816d817
--- /dev/null
+++ b/exercises/triangle/triangle.coffee
@@ -0,0 +1,6 @@
+class Triangle
+  constructor: (args) ->
+
+  kind: ->
+
+module.exports = Triangle
diff --git a/exercises/triangle/triangle_test.spec.coffee b/exercises/triangle/triangle.spec.coffee
similarity index 82%
rename from exercises/triangle/triangle_test.spec.coffee
rename to exercises/triangle/triangle.spec.coffee
index a36be19b..664691dd 100644
--- a/exercises/triangle/triangle_test.spec.coffee
+++ b/exercises/triangle/triangle.spec.coffee
@@ -1,6 +1,6 @@
 Triangle = require './triangle'
 
-describe "Triangle", ->
+describe 'Triangle', ->
   it 'is equilateral with equal sides', ->
     triangle = new Triangle(2,2,2)
     expect(triangle.kind()).toBe 'equilateral'
@@ -42,13 +42,13 @@ describe "Triangle", ->
     expect(triangle.kind()).toBe 'scalene'
 
   xit 'is illegal when a side is negative', ->
-    expect(-> new Triangle(2,3,-5)).toThrow("negative sides are illegal")
+    expect(-> new Triangle(2,3,-5)).toThrow('negative sides are illegal')
 
   xit 'is illegal when violating triangle inequality', ->
-    expect(-> new Triangle(1,1,3)).toThrow("violation of triangle inequality")
+    expect(-> new Triangle(1,1,3)).toThrow('violation of triangle inequality')
 
   xit 'is illegal when violating triangle inequality 2', ->
-    expect(-> new Triangle(2,2,5)).toThrow("violation of triangle inequality")
+    expect(-> new Triangle(2,2,5)).toThrow('violation of triangle inequality')
 
   xit 'is illegal when violating triangle inequality 3', ->
-    expect(-> new Triangle(7,3,2)).toThrow("violation of triangle inequality")
+    expect(-> new Triangle(7,3,2)).toThrow('violation of triangle inequality')
diff --git a/exercises/trinary/trinary.coffee b/exercises/trinary/trinary.coffee
new file mode 100644
index 00000000..a2039910
--- /dev/null
+++ b/exercises/trinary/trinary.coffee
@@ -0,0 +1,4 @@
+class Trinary
+  constructor: (args) ->
+
+module.exports = Trinary
diff --git a/exercises/trinary/trinary_test.spec.coffee b/exercises/trinary/trinary.spec.coffee
similarity index 100%
rename from exercises/trinary/trinary_test.spec.coffee
rename to exercises/trinary/trinary.spec.coffee
diff --git a/exercises/word-count/word-count.coffee b/exercises/word-count/word-count.coffee
new file mode 100644
index 00000000..ba5f1a47
--- /dev/null
+++ b/exercises/word-count/word-count.coffee
@@ -0,0 +1,7 @@
+class WordCount
+  constructor: (args) ->
+
+  count: ->
+    
+
+module.exports = WordCount
diff --git a/exercises/word-count/word-count.spec.coffee b/exercises/word-count/word-count.spec.coffee
new file mode 100644
index 00000000..339f1ae9
--- /dev/null
+++ b/exercises/word-count/word-count.spec.coffee
@@ -0,0 +1,44 @@
+WordCount = require './word-count'
+
+describe 'WordCount', ->
+  it 'counts one word', ->
+    words = new WordCount 'word'
+    expect(words.count()).toEqual
+      word: 1
+
+  xit 'counts one of each', ->
+    words = new WordCount 'one of each'
+    expect(words.count()).toEqual
+      one: 1
+      of: 1
+      each: 1
+
+  xit 'counts multiple occurrences', ->
+    words = new WordCount 'one fish two fish red fish blue fish'
+    expect(words.count()).toEqual
+      one: 1
+      fish: 4
+      two: 1
+      red: 1
+      blue: 1
+
+  xit 'ignores punctuation', ->
+    words = new WordCount 'car : carpet as java : javascript!!&@$%^&'
+    expect(words.count()).toEqual
+      car: 1
+      carpet: 1
+      as: 1
+      java: 1
+      javascript: 1
+
+  xit 'includes numbers', ->
+    words = new WordCount 'testing, 1, 2 testing'
+    expect(words.count()).toEqual
+      testing: 2
+      1: 1
+      2: 1
+
+  xit 'normalizes case', ->
+    words = new WordCount 'go Go GO'
+    expect(words.count()).toEqual
+      go: 3
diff --git a/exercises/word-count/word-count_test.spec.coffee b/exercises/word-count/word-count_test.spec.coffee
deleted file mode 100644
index 134ae701..00000000
--- a/exercises/word-count/word-count_test.spec.coffee
+++ /dev/null
@@ -1,44 +0,0 @@
-Words = require "./words"
-
-describe "Words", ->
-  it "counts one word", ->
-    words = new Words "word"
-    expect(words.count()).toEqual
-      word: 1
-
-  xit "counts one of each", ->
-    words = new Words "one of each"
-    expect(words.count()).toEqual
-      one: 1
-      of: 1
-      each: 1
-
-  xit "counts multiple occurrences", ->
-    words = new Words "one fish two fish red fish blue fish"
-    expect(words.count()).toEqual
-      one: 1
-      fish: 4
-      two: 1
-      red: 1
-      blue: 1
-
-  xit "ignores punctuation", ->
-    words = new Words "car : carpet as java : javascript!!&@$%^&"
-    expect(words.count()).toEqual
-      car: 1
-      carpet: 1
-      as: 1
-      java: 1
-      javascript: 1
-
-  xit "includes numbers", ->
-    words = new Words "testing, 1, 2 testing"
-    expect(words.count()).toEqual
-      testing: 2
-      1: 1
-      2: 1
-
-  xit "normalizes case", ->
-    words = new Words "go Go GO"
-    expect(words.count()).toEqual
-      go: 3
diff --git a/exercises/wordy/wordy.coffee b/exercises/wordy/wordy.coffee
new file mode 100644
index 00000000..098a910e
--- /dev/null
+++ b/exercises/wordy/wordy.coffee
@@ -0,0 +1,6 @@
+class Wordy
+  constructor: (args) ->
+
+  answer: ->
+
+module.exports = Wordy
diff --git a/exercises/wordy/wordy_test.spec.coffee b/exercises/wordy/wordy.spec.coffee
similarity index 100%
rename from exercises/wordy/wordy_test.spec.coffee
rename to exercises/wordy/wordy.spec.coffee