diff --git a/exercises/grade-school/CMakeLists.txt b/exercises/grade-school/CMakeLists.txt index 97f8615d..b81b3564 100644 --- a/exercises/grade-school/CMakeLists.txt +++ b/exercises/grade-school/CMakeLists.txt @@ -7,12 +7,6 @@ cmake_minimum_required(VERSION 3.1.3) # Name the project after the exercise project(${exercise} CXX) -# Locate Boost libraries: unit_test_framework and date_time -set(Boost_USE_STATIC_LIBS ON) -set(Boost_USE_MULTITHREADED ON) -set(Boost_USE_STATIC_RUNTIME OFF) -find_package(Boost 1.59 REQUIRED COMPONENTS unit_test_framework date_time) - # Get a source filename from the exercise name by replacing -'s with _'s string(REPLACE "-" "_" file ${exercise}) @@ -38,13 +32,6 @@ if("${CMAKE_CXX_COMPILER_ID}" MATCHES "(GNU|Clang)") ) endif() -# We need boost libraries -target_link_libraries(${exercise} - PRIVATE - Boost::unit_test_framework - Boost::date_time -) - # Configure to run all the tests? if(${EXERCISM_RUN_ALL_TESTS}) target_compile_definitions(${exercise} PRIVATE EXERCISM_RUN_ALL_TESTS) diff --git a/exercises/grade-school/grade_school_test.cpp b/exercises/grade-school/grade_school_test.cpp index 9803c6e7..e384ceb3 100644 --- a/exercises/grade-school/grade_school_test.cpp +++ b/exercises/grade-school/grade_school_test.cpp @@ -1,35 +1,31 @@ #include "grade_school.h" -#define BOOST_TEST_MAIN +#define CATCH_CONFIG_MAIN #include -#include +#include "test/catch.hpp" using namespace std; -struct school_fixture +TEST_CASE("a_new_school_has_an_empty_roster") { grade_school::school school_; -}; - -BOOST_FIXTURE_TEST_SUITE(school_suite, school_fixture) - -BOOST_AUTO_TEST_CASE(a_new_school_has_an_empty_roster) -{ - BOOST_REQUIRE(school_.roster().empty()); + REQUIRE(school_.roster().empty()); } #if defined(EXERCISM_RUN_ALL_TESTS) -BOOST_AUTO_TEST_CASE(adding_a_student_adds_them_to_the_roster_for_the_given_grade) +TEST_CASE("adding_a_student_adds_them_to_the_roster_for_the_given_grade") { + grade_school::school school_; school_.add("Aimee", 2); const auto actual = school_.roster(); const map> expected{{2, {"Aimee"}}}; - BOOST_TEST(expected == actual); + REQUIRE(expected == actual); } -BOOST_AUTO_TEST_CASE(adding_more_students_to_the_same_grade_adds_them_to_the_roster) +TEST_CASE("adding_more_students_to_the_same_grade_adds_them_to_the_roster") { + grade_school::school school_; school_.add("Blair", 2); school_.add("James", 2); school_.add("Paul", 2); @@ -37,22 +33,24 @@ BOOST_AUTO_TEST_CASE(adding_more_students_to_the_same_grade_adds_them_to_the_ros const auto actual = school_.roster(); const map> expected{{2, {"Blair", "James", "Paul"}}}; - BOOST_TEST(expected == actual); + REQUIRE(expected == actual); } -BOOST_AUTO_TEST_CASE(adding_students_to_different_grades_adds_them_to_the_roster) +TEST_CASE("adding_students_to_different_grades_adds_them_to_the_roster") { + grade_school::school school_; school_.add("Chelsea", 3); school_.add("Logan", 7); const auto actual = school_.roster(); const map> expected{{3, {"Chelsea"}}, {7, {"Logan"}}}; - BOOST_TEST(expected == actual); + REQUIRE(expected == actual); } -BOOST_AUTO_TEST_CASE(grade_returns_the_students_in_that_grade_in_alphabetical_order) +TEST_CASE("grade_returns_the_students_in_that_grade_in_alphabetical_order") { + grade_school::school school_; school_.add("Franklin", 5); school_.add("Bradley", 5); school_.add("Jeff", 1); @@ -60,18 +58,20 @@ BOOST_AUTO_TEST_CASE(grade_returns_the_students_in_that_grade_in_alphabetical_or const auto actual = school_.grade(5); const vector expected{"Bradley", "Franklin"}; - BOOST_TEST(expected == actual); + REQUIRE(expected == actual); } -BOOST_AUTO_TEST_CASE(grade_returns_an_empty_array_if_there_are_no_students_in_that_grade) +TEST_CASE("grade_returns_an_empty_array_if_there_are_no_students_in_that_grade") { + grade_school::school school_; const auto actual = school_.grade(1); - BOOST_REQUIRE(actual.empty()); + REQUIRE(actual.empty()); } -BOOST_AUTO_TEST_CASE(the_student_names_in_each_grade_in_the_roster_are_sorted) +TEST_CASE("the_student_names_in_each_grade_in_the_roster_are_sorted") { + grade_school::school school_; school_.add("Jennifer", 4); school_.add("Kareem", 6); school_.add("Christopher", 4); @@ -84,15 +84,14 @@ BOOST_AUTO_TEST_CASE(the_student_names_in_each_grade_in_the_roster_are_sorted) {4, {"Christopher", "Jennifer"}}, {6, {"Kareem"}} }; - BOOST_TEST(expected == actual); + REQUIRE(expected == actual); } -BOOST_AUTO_TEST_CASE(checking_a_grade_should_not_change_the_roster) +TEST_CASE("checking_a_grade_should_not_change_the_roster") { + grade_school::school school_; school_.grade(1); - BOOST_REQUIRE(school_.roster().empty()); + REQUIRE(school_.roster().empty()); } #endif - -BOOST_AUTO_TEST_SUITE_END() diff --git a/exercises/grade-school/test/catch.hpp b/exercises/grade-school/test/catch.hpp new file mode 100644 index 00000000..1850fff1 --- /dev/null +++ b/exercises/grade-school/test/catch.hpp @@ -0,0 +1,14934 @@ +/* + * Catch v2.7.0 + * Generated: 2019-03-07 21:34:30.252164 + * ---------------------------------------------------------- + * This file has been merged from multiple headers. Please don't edit it directly + * Copyright (c) 2019 Two Blue Cubes Ltd. All rights reserved. + * + * Distributed under the Boost Software License, Version 1.0. (See accompanying + * file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt) + */ +#ifndef TWOBLUECUBES_SINGLE_INCLUDE_CATCH_HPP_INCLUDED +#define TWOBLUECUBES_SINGLE_INCLUDE_CATCH_HPP_INCLUDED +// start catch.hpp + + +#define CATCH_VERSION_MAJOR 2 +#define CATCH_VERSION_MINOR 7 +#define CATCH_VERSION_PATCH 0 + +#ifdef __clang__ +# pragma clang system_header +#elif defined __GNUC__ +# pragma GCC system_header +#endif + +// start catch_suppress_warnings.h + +#ifdef __clang__ +# ifdef __ICC // icpc defines the __clang__ macro +# pragma warning(push) +# pragma warning(disable: 161 1682) +# else // __ICC +# pragma clang diagnostic push +# pragma clang diagnostic ignored "-Wpadded" +# pragma clang diagnostic ignored "-Wswitch-enum" +# pragma clang diagnostic ignored "-Wcovered-switch-default" +# endif +#elif defined __GNUC__ + // Because REQUIREs trigger GCC's -Wparentheses, and because still + // supported version of g++ have only buggy support for _Pragmas, + // Wparentheses have to be suppressed globally. +# pragma GCC diagnostic ignored "-Wparentheses" // See #674 for details + +# pragma GCC diagnostic push +# pragma GCC diagnostic ignored "-Wunused-variable" +# pragma GCC diagnostic ignored "-Wpadded" +#endif +// end catch_suppress_warnings.h +#if defined(CATCH_CONFIG_MAIN) || defined(CATCH_CONFIG_RUNNER) +# define CATCH_IMPL +# define CATCH_CONFIG_ALL_PARTS +#endif + +// In the impl file, we want to have access to all parts of the headers +// Can also be used to sanely support PCHs +#if defined(CATCH_CONFIG_ALL_PARTS) +# define CATCH_CONFIG_EXTERNAL_INTERFACES +# if defined(CATCH_CONFIG_DISABLE_MATCHERS) +# undef CATCH_CONFIG_DISABLE_MATCHERS +# endif +# if !defined(CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER) +# define CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER +# endif +#endif + +#if !defined(CATCH_CONFIG_IMPL_ONLY) +// start catch_platform.h + +#ifdef __APPLE__ +# include +# if TARGET_OS_OSX == 1 +# define CATCH_PLATFORM_MAC +# elif TARGET_OS_IPHONE == 1 +# define CATCH_PLATFORM_IPHONE +# endif + +#elif defined(linux) || defined(__linux) || defined(__linux__) +# define CATCH_PLATFORM_LINUX + +#elif defined(WIN32) || defined(__WIN32__) || defined(_WIN32) || defined(_MSC_VER) || defined(__MINGW32__) +# define CATCH_PLATFORM_WINDOWS +#endif + +// end catch_platform.h + +#ifdef CATCH_IMPL +# ifndef CLARA_CONFIG_MAIN +# define CLARA_CONFIG_MAIN_NOT_DEFINED +# define CLARA_CONFIG_MAIN +# endif +#endif + +// start catch_user_interfaces.h + +namespace Catch { + unsigned int rngSeed(); +} + +// end catch_user_interfaces.h +// start catch_tag_alias_autoregistrar.h + +// start catch_common.h + +// start catch_compiler_capabilities.h + +// Detect a number of compiler features - by compiler +// The following features are defined: +// +// CATCH_CONFIG_COUNTER : is the __COUNTER__ macro supported? +// CATCH_CONFIG_WINDOWS_SEH : is Windows SEH supported? +// CATCH_CONFIG_POSIX_SIGNALS : are POSIX signals supported? +// CATCH_CONFIG_DISABLE_EXCEPTIONS : Are exceptions enabled? +// **************** +// Note to maintainers: if new toggles are added please document them +// in configuration.md, too +// **************** + +// In general each macro has a _NO_ form +// (e.g. CATCH_CONFIG_NO_POSIX_SIGNALS) which disables the feature. +// Many features, at point of detection, define an _INTERNAL_ macro, so they +// can be combined, en-mass, with the _NO_ forms later. + +#ifdef __cplusplus + +# if (__cplusplus >= 201402L) || (defined(_MSVC_LANG) && _MSVC_LANG >= 201402L) +# define CATCH_CPP14_OR_GREATER +# endif + +# if (__cplusplus >= 201703L) || (defined(_MSVC_LANG) && _MSVC_LANG >= 201703L) +# define CATCH_CPP17_OR_GREATER +# endif + +#endif + +#if defined(CATCH_CPP17_OR_GREATER) +# define CATCH_INTERNAL_CONFIG_CPP17_UNCAUGHT_EXCEPTIONS +#endif + +#ifdef __clang__ + +# define CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + _Pragma( "clang diagnostic push" ) \ + _Pragma( "clang diagnostic ignored \"-Wexit-time-destructors\"" ) \ + _Pragma( "clang diagnostic ignored \"-Wglobal-constructors\"") +# define CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS \ + _Pragma( "clang diagnostic pop" ) + +# define CATCH_INTERNAL_SUPPRESS_PARENTHESES_WARNINGS \ + _Pragma( "clang diagnostic push" ) \ + _Pragma( "clang diagnostic ignored \"-Wparentheses\"" ) +# define CATCH_INTERNAL_UNSUPPRESS_PARENTHESES_WARNINGS \ + _Pragma( "clang diagnostic pop" ) + +# define CATCH_INTERNAL_SUPPRESS_UNUSED_WARNINGS \ + _Pragma( "clang diagnostic push" ) \ + _Pragma( "clang diagnostic ignored \"-Wunused-variable\"" ) +# define CATCH_INTERNAL_UNSUPPRESS_UNUSED_WARNINGS \ + _Pragma( "clang diagnostic pop" ) + +#endif // __clang__ + +//////////////////////////////////////////////////////////////////////////////// +// Assume that non-Windows platforms support posix signals by default +#if !defined(CATCH_PLATFORM_WINDOWS) + #define CATCH_INTERNAL_CONFIG_POSIX_SIGNALS +#endif + +//////////////////////////////////////////////////////////////////////////////// +// We know some environments not to support full POSIX signals +#if defined(__CYGWIN__) || defined(__QNX__) || defined(__EMSCRIPTEN__) || defined(__DJGPP__) + #define CATCH_INTERNAL_CONFIG_NO_POSIX_SIGNALS +#endif + +#ifdef __OS400__ +# define CATCH_INTERNAL_CONFIG_NO_POSIX_SIGNALS +# define CATCH_CONFIG_COLOUR_NONE +#endif + +//////////////////////////////////////////////////////////////////////////////// +// Android somehow still does not support std::to_string +#if defined(__ANDROID__) +# define CATCH_INTERNAL_CONFIG_NO_CPP11_TO_STRING +#endif + +//////////////////////////////////////////////////////////////////////////////// +// Not all Windows environments support SEH properly +#if defined(__MINGW32__) +# define CATCH_INTERNAL_CONFIG_NO_WINDOWS_SEH +#endif + +//////////////////////////////////////////////////////////////////////////////// +// PS4 +#if defined(__ORBIS__) +# define CATCH_INTERNAL_CONFIG_NO_NEW_CAPTURE +#endif + +//////////////////////////////////////////////////////////////////////////////// +// Cygwin +#ifdef __CYGWIN__ + +// Required for some versions of Cygwin to declare gettimeofday +// see: http://stackoverflow.com/questions/36901803/gettimeofday-not-declared-in-this-scope-cygwin +# define _BSD_SOURCE +// some versions of cygwin (most) do not support std::to_string. Use the libstd check. +// https://gcc.gnu.org/onlinedocs/gcc-4.8.2/libstdc++/api/a01053_source.html line 2812-2813 +# if !((__cplusplus >= 201103L) && defined(_GLIBCXX_USE_C99) \ + && !defined(_GLIBCXX_HAVE_BROKEN_VSWPRINTF)) + +# define CATCH_INTERNAL_CONFIG_NO_CPP11_TO_STRING + +# endif +#endif // __CYGWIN__ + +//////////////////////////////////////////////////////////////////////////////// +// Visual C++ +#ifdef _MSC_VER + +# if _MSC_VER >= 1900 // Visual Studio 2015 or newer +# define CATCH_INTERNAL_CONFIG_CPP17_UNCAUGHT_EXCEPTIONS +# endif + +// Universal Windows platform does not support SEH +// Or console colours (or console at all...) +# if defined(WINAPI_FAMILY) && (WINAPI_FAMILY == WINAPI_FAMILY_APP) +# define CATCH_CONFIG_COLOUR_NONE +# else +# define CATCH_INTERNAL_CONFIG_WINDOWS_SEH +# endif + +// MSVC traditional preprocessor needs some workaround for __VA_ARGS__ +// _MSVC_TRADITIONAL == 0 means new conformant preprocessor +// _MSVC_TRADITIONAL == 1 means old traditional non-conformant preprocessor +# if !defined(_MSVC_TRADITIONAL) || (defined(_MSVC_TRADITIONAL) && _MSVC_TRADITIONAL) +# define CATCH_INTERNAL_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +# endif + +#endif // _MSC_VER + +//////////////////////////////////////////////////////////////////////////////// +// Check if we are compiled with -fno-exceptions or equivalent +#if defined(__EXCEPTIONS) || defined(__cpp_exceptions) || defined(_CPPUNWIND) +# define CATCH_INTERNAL_CONFIG_EXCEPTIONS_ENABLED +#endif + +//////////////////////////////////////////////////////////////////////////////// +// DJGPP +#ifdef __DJGPP__ +# define CATCH_INTERNAL_CONFIG_NO_WCHAR +#endif // __DJGPP__ + +//////////////////////////////////////////////////////////////////////////////// +// Embarcadero C++Build +#if defined(__BORLANDC__) + #define CATCH_INTERNAL_CONFIG_POLYFILL_ISNAN +#endif + +//////////////////////////////////////////////////////////////////////////////// + +// Use of __COUNTER__ is suppressed during code analysis in +// CLion/AppCode 2017.2.x and former, because __COUNTER__ is not properly +// handled by it. +// Otherwise all supported compilers support COUNTER macro, +// but user still might want to turn it off +#if ( !defined(__JETBRAINS_IDE__) || __JETBRAINS_IDE__ >= 20170300L ) + #define CATCH_INTERNAL_CONFIG_COUNTER +#endif + +//////////////////////////////////////////////////////////////////////////////// +// Check if string_view is available and usable +// The check is split apart to work around v140 (VS2015) preprocessor issue... +#if defined(__has_include) +#if __has_include() && defined(CATCH_CPP17_OR_GREATER) +# define CATCH_INTERNAL_CONFIG_CPP17_STRING_VIEW +#endif +#endif + +//////////////////////////////////////////////////////////////////////////////// +// Check if optional is available and usable +#if defined(__has_include) +# if __has_include() && defined(CATCH_CPP17_OR_GREATER) +# define CATCH_INTERNAL_CONFIG_CPP17_OPTIONAL +# endif // __has_include() && defined(CATCH_CPP17_OR_GREATER) +#endif // __has_include + +//////////////////////////////////////////////////////////////////////////////// +// Check if variant is available and usable +#if defined(__has_include) +# if __has_include() && defined(CATCH_CPP17_OR_GREATER) +# if defined(__clang__) && (__clang_major__ < 8) + // work around clang bug with libstdc++ https://bugs.llvm.org/show_bug.cgi?id=31852 + // fix should be in clang 8, workaround in libstdc++ 8.2 +# include +# if defined(__GLIBCXX__) && defined(_GLIBCXX_RELEASE) && (_GLIBCXX_RELEASE < 9) +# define CATCH_CONFIG_NO_CPP17_VARIANT +# else +# define CATCH_INTERNAL_CONFIG_CPP17_VARIANT +# endif // defined(__GLIBCXX__) && defined(_GLIBCXX_RELEASE) && (_GLIBCXX_RELEASE < 9) +# else +# define CATCH_INTERNAL_CONFIG_CPP17_VARIANT +# endif // defined(__clang__) && (__clang_major__ < 8) +# endif // __has_include() && defined(CATCH_CPP17_OR_GREATER) +#endif // __has_include + +#if defined(CATCH_INTERNAL_CONFIG_COUNTER) && !defined(CATCH_CONFIG_NO_COUNTER) && !defined(CATCH_CONFIG_COUNTER) +# define CATCH_CONFIG_COUNTER +#endif +#if defined(CATCH_INTERNAL_CONFIG_WINDOWS_SEH) && !defined(CATCH_CONFIG_NO_WINDOWS_SEH) && !defined(CATCH_CONFIG_WINDOWS_SEH) && !defined(CATCH_INTERNAL_CONFIG_NO_WINDOWS_SEH) +# define CATCH_CONFIG_WINDOWS_SEH +#endif +// This is set by default, because we assume that unix compilers are posix-signal-compatible by default. +#if defined(CATCH_INTERNAL_CONFIG_POSIX_SIGNALS) && !defined(CATCH_INTERNAL_CONFIG_NO_POSIX_SIGNALS) && !defined(CATCH_CONFIG_NO_POSIX_SIGNALS) && !defined(CATCH_CONFIG_POSIX_SIGNALS) +# define CATCH_CONFIG_POSIX_SIGNALS +#endif +// This is set by default, because we assume that compilers with no wchar_t support are just rare exceptions. +#if !defined(CATCH_INTERNAL_CONFIG_NO_WCHAR) && !defined(CATCH_CONFIG_NO_WCHAR) && !defined(CATCH_CONFIG_WCHAR) +# define CATCH_CONFIG_WCHAR +#endif + +#if !defined(CATCH_INTERNAL_CONFIG_NO_CPP11_TO_STRING) && !defined(CATCH_CONFIG_NO_CPP11_TO_STRING) && !defined(CATCH_CONFIG_CPP11_TO_STRING) +# define CATCH_CONFIG_CPP11_TO_STRING +#endif + +#if defined(CATCH_INTERNAL_CONFIG_CPP17_OPTIONAL) && !defined(CATCH_CONFIG_NO_CPP17_OPTIONAL) && !defined(CATCH_CONFIG_CPP17_OPTIONAL) +# define CATCH_CONFIG_CPP17_OPTIONAL +#endif + +#if defined(CATCH_INTERNAL_CONFIG_CPP17_UNCAUGHT_EXCEPTIONS) && !defined(CATCH_CONFIG_NO_CPP17_UNCAUGHT_EXCEPTIONS) && !defined(CATCH_CONFIG_CPP17_UNCAUGHT_EXCEPTIONS) +# define CATCH_CONFIG_CPP17_UNCAUGHT_EXCEPTIONS +#endif + +#if defined(CATCH_INTERNAL_CONFIG_CPP17_STRING_VIEW) && !defined(CATCH_CONFIG_NO_CPP17_STRING_VIEW) && !defined(CATCH_CONFIG_CPP17_STRING_VIEW) +# define CATCH_CONFIG_CPP17_STRING_VIEW +#endif + +#if defined(CATCH_INTERNAL_CONFIG_CPP17_VARIANT) && !defined(CATCH_CONFIG_NO_CPP17_VARIANT) && !defined(CATCH_CONFIG_CPP17_VARIANT) +# define CATCH_CONFIG_CPP17_VARIANT +#endif + +#if defined(CATCH_CONFIG_EXPERIMENTAL_REDIRECT) +# define CATCH_INTERNAL_CONFIG_NEW_CAPTURE +#endif + +#if defined(CATCH_INTERNAL_CONFIG_NEW_CAPTURE) && !defined(CATCH_INTERNAL_CONFIG_NO_NEW_CAPTURE) && !defined(CATCH_CONFIG_NO_NEW_CAPTURE) && !defined(CATCH_CONFIG_NEW_CAPTURE) +# define CATCH_CONFIG_NEW_CAPTURE +#endif + +#if !defined(CATCH_INTERNAL_CONFIG_EXCEPTIONS_ENABLED) && !defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) +# define CATCH_CONFIG_DISABLE_EXCEPTIONS +#endif + +#if defined(CATCH_INTERNAL_CONFIG_POLYFILL_ISNAN) && !defined(CATCH_CONFIG_NO_POLYFILL_ISNAN) && !defined(CATCH_CONFIG_POLYFILL_ISNAN) +# define CATCH_CONFIG_POLYFILL_ISNAN +#endif + +#if !defined(CATCH_INTERNAL_SUPPRESS_PARENTHESES_WARNINGS) +# define CATCH_INTERNAL_SUPPRESS_PARENTHESES_WARNINGS +# define CATCH_INTERNAL_UNSUPPRESS_PARENTHESES_WARNINGS +#endif +#if !defined(CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS) +# define CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS +# define CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS +#endif +#if !defined(CATCH_INTERNAL_SUPPRESS_UNUSED_WARNINGS) +# define CATCH_INTERNAL_SUPPRESS_UNUSED_WARNINGS +# define CATCH_INTERNAL_UNSUPPRESS_UNUSED_WARNINGS +#endif + +#if defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) +#define CATCH_TRY if ((true)) +#define CATCH_CATCH_ALL if ((false)) +#define CATCH_CATCH_ANON(type) if ((false)) +#else +#define CATCH_TRY try +#define CATCH_CATCH_ALL catch (...) +#define CATCH_CATCH_ANON(type) catch (type) +#endif + +#if defined(CATCH_INTERNAL_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR) && !defined(CATCH_CONFIG_NO_TRADITIONAL_MSVC_PREPROCESSOR) && !defined(CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR) +#define CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#endif + +// end catch_compiler_capabilities.h +#define INTERNAL_CATCH_UNIQUE_NAME_LINE2( name, line ) name##line +#define INTERNAL_CATCH_UNIQUE_NAME_LINE( name, line ) INTERNAL_CATCH_UNIQUE_NAME_LINE2( name, line ) +#ifdef CATCH_CONFIG_COUNTER +# define INTERNAL_CATCH_UNIQUE_NAME( name ) INTERNAL_CATCH_UNIQUE_NAME_LINE( name, __COUNTER__ ) +#else +# define INTERNAL_CATCH_UNIQUE_NAME( name ) INTERNAL_CATCH_UNIQUE_NAME_LINE( name, __LINE__ ) +#endif + +#include +#include +#include + +// We need a dummy global operator<< so we can bring it into Catch namespace later +struct Catch_global_namespace_dummy {}; +std::ostream& operator<<(std::ostream&, Catch_global_namespace_dummy); + +namespace Catch { + + struct CaseSensitive { enum Choice { + Yes, + No + }; }; + + class NonCopyable { + NonCopyable( NonCopyable const& ) = delete; + NonCopyable( NonCopyable && ) = delete; + NonCopyable& operator = ( NonCopyable const& ) = delete; + NonCopyable& operator = ( NonCopyable && ) = delete; + + protected: + NonCopyable(); + virtual ~NonCopyable(); + }; + + struct SourceLineInfo { + + SourceLineInfo() = delete; + SourceLineInfo( char const* _file, std::size_t _line ) noexcept + : file( _file ), + line( _line ) + {} + + SourceLineInfo( SourceLineInfo const& other ) = default; + SourceLineInfo& operator = ( SourceLineInfo const& ) = default; + SourceLineInfo( SourceLineInfo&& ) noexcept = default; + SourceLineInfo& operator = ( SourceLineInfo&& ) noexcept = default; + + bool empty() const noexcept; + bool operator == ( SourceLineInfo const& other ) const noexcept; + bool operator < ( SourceLineInfo const& other ) const noexcept; + + char const* file; + std::size_t line; + }; + + std::ostream& operator << ( std::ostream& os, SourceLineInfo const& info ); + + // Bring in operator<< from global namespace into Catch namespace + // This is necessary because the overload of operator<< above makes + // lookup stop at namespace Catch + using ::operator<<; + + // Use this in variadic streaming macros to allow + // >> +StreamEndStop + // as well as + // >> stuff +StreamEndStop + struct StreamEndStop { + std::string operator+() const; + }; + template + T const& operator + ( T const& value, StreamEndStop ) { + return value; + } +} + +#define CATCH_INTERNAL_LINEINFO \ + ::Catch::SourceLineInfo( __FILE__, static_cast( __LINE__ ) ) + +// end catch_common.h +namespace Catch { + + struct RegistrarForTagAliases { + RegistrarForTagAliases( char const* alias, char const* tag, SourceLineInfo const& lineInfo ); + }; + +} // end namespace Catch + +#define CATCH_REGISTER_TAG_ALIAS( alias, spec ) \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ Catch::RegistrarForTagAliases INTERNAL_CATCH_UNIQUE_NAME( AutoRegisterTagAlias )( alias, spec, CATCH_INTERNAL_LINEINFO ); } \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS + +// end catch_tag_alias_autoregistrar.h +// start catch_test_registry.h + +// start catch_interfaces_testcase.h + +#include + +namespace Catch { + + class TestSpec; + + struct ITestInvoker { + virtual void invoke () const = 0; + virtual ~ITestInvoker(); + }; + + class TestCase; + struct IConfig; + + struct ITestCaseRegistry { + virtual ~ITestCaseRegistry(); + virtual std::vector const& getAllTests() const = 0; + virtual std::vector const& getAllTestsSorted( IConfig const& config ) const = 0; + }; + + bool matchTest( TestCase const& testCase, TestSpec const& testSpec, IConfig const& config ); + std::vector filterTests( std::vector const& testCases, TestSpec const& testSpec, IConfig const& config ); + std::vector const& getAllTestCasesSorted( IConfig const& config ); + +} + +// end catch_interfaces_testcase.h +// start catch_stringref.h + +#include +#include +#include + +namespace Catch { + + /// A non-owning string class (similar to the forthcoming std::string_view) + /// Note that, because a StringRef may be a substring of another string, + /// it may not be null terminated. c_str() must return a null terminated + /// string, however, and so the StringRef will internally take ownership + /// (taking a copy), if necessary. In theory this ownership is not externally + /// visible - but it does mean (substring) StringRefs should not be shared between + /// threads. + class StringRef { + public: + using size_type = std::size_t; + + private: + friend struct StringRefTestAccess; + + char const* m_start; + size_type m_size; + + char* m_data = nullptr; + + void takeOwnership(); + + static constexpr char const* const s_empty = ""; + + public: // construction/ assignment + StringRef() noexcept + : StringRef( s_empty, 0 ) + {} + + StringRef( StringRef const& other ) noexcept + : m_start( other.m_start ), + m_size( other.m_size ) + {} + + StringRef( StringRef&& other ) noexcept + : m_start( other.m_start ), + m_size( other.m_size ), + m_data( other.m_data ) + { + other.m_data = nullptr; + } + + StringRef( char const* rawChars ) noexcept; + + StringRef( char const* rawChars, size_type size ) noexcept + : m_start( rawChars ), + m_size( size ) + {} + + StringRef( std::string const& stdString ) noexcept + : m_start( stdString.c_str() ), + m_size( stdString.size() ) + {} + + ~StringRef() noexcept { + delete[] m_data; + } + + auto operator = ( StringRef const &other ) noexcept -> StringRef& { + delete[] m_data; + m_data = nullptr; + m_start = other.m_start; + m_size = other.m_size; + return *this; + } + + operator std::string() const; + + void swap( StringRef& other ) noexcept; + + public: // operators + auto operator == ( StringRef const& other ) const noexcept -> bool; + auto operator != ( StringRef const& other ) const noexcept -> bool; + + auto operator[] ( size_type index ) const noexcept -> char; + + public: // named queries + auto empty() const noexcept -> bool { + return m_size == 0; + } + auto size() const noexcept -> size_type { + return m_size; + } + + auto numberOfCharacters() const noexcept -> size_type; + auto c_str() const -> char const*; + + public: // substrings and searches + auto substr( size_type start, size_type size ) const noexcept -> StringRef; + + // Returns the current start pointer. + // Note that the pointer can change when if the StringRef is a substring + auto currentData() const noexcept -> char const*; + + private: // ownership queries - may not be consistent between calls + auto isOwned() const noexcept -> bool; + auto isSubstring() const noexcept -> bool; + }; + + auto operator + ( StringRef const& lhs, StringRef const& rhs ) -> std::string; + auto operator + ( StringRef const& lhs, char const* rhs ) -> std::string; + auto operator + ( char const* lhs, StringRef const& rhs ) -> std::string; + + auto operator += ( std::string& lhs, StringRef const& sr ) -> std::string&; + auto operator << ( std::ostream& os, StringRef const& sr ) -> std::ostream&; + + inline auto operator "" _sr( char const* rawChars, std::size_t size ) noexcept -> StringRef { + return StringRef( rawChars, size ); + } + +} // namespace Catch + +inline auto operator "" _catch_sr( char const* rawChars, std::size_t size ) noexcept -> Catch::StringRef { + return Catch::StringRef( rawChars, size ); +} + +// end catch_stringref.h +// start catch_type_traits.hpp + + +#include + +namespace Catch{ + +#ifdef CATCH_CPP17_OR_GREATER + template + inline constexpr auto is_unique = std::true_type{}; + + template + inline constexpr auto is_unique = std::bool_constant< + (!std::is_same_v && ...) && is_unique + >{}; +#else + +template +struct is_unique : std::true_type{}; + +template +struct is_unique : std::integral_constant +::value + && is_unique::value + && is_unique::value +>{}; + +#endif +} + +// end catch_type_traits.hpp +// start catch_preprocessor.hpp + + +#define CATCH_RECURSION_LEVEL0(...) __VA_ARGS__ +#define CATCH_RECURSION_LEVEL1(...) CATCH_RECURSION_LEVEL0(CATCH_RECURSION_LEVEL0(CATCH_RECURSION_LEVEL0(__VA_ARGS__))) +#define CATCH_RECURSION_LEVEL2(...) CATCH_RECURSION_LEVEL1(CATCH_RECURSION_LEVEL1(CATCH_RECURSION_LEVEL1(__VA_ARGS__))) +#define CATCH_RECURSION_LEVEL3(...) CATCH_RECURSION_LEVEL2(CATCH_RECURSION_LEVEL2(CATCH_RECURSION_LEVEL2(__VA_ARGS__))) +#define CATCH_RECURSION_LEVEL4(...) CATCH_RECURSION_LEVEL3(CATCH_RECURSION_LEVEL3(CATCH_RECURSION_LEVEL3(__VA_ARGS__))) +#define CATCH_RECURSION_LEVEL5(...) CATCH_RECURSION_LEVEL4(CATCH_RECURSION_LEVEL4(CATCH_RECURSION_LEVEL4(__VA_ARGS__))) + +#ifdef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define INTERNAL_CATCH_EXPAND_VARGS(...) __VA_ARGS__ +// MSVC needs more evaluations +#define CATCH_RECURSION_LEVEL6(...) CATCH_RECURSION_LEVEL5(CATCH_RECURSION_LEVEL5(CATCH_RECURSION_LEVEL5(__VA_ARGS__))) +#define CATCH_RECURSE(...) CATCH_RECURSION_LEVEL6(CATCH_RECURSION_LEVEL6(__VA_ARGS__)) +#else +#define CATCH_RECURSE(...) CATCH_RECURSION_LEVEL5(__VA_ARGS__) +#endif + +#define CATCH_REC_END(...) +#define CATCH_REC_OUT + +#define CATCH_EMPTY() +#define CATCH_DEFER(id) id CATCH_EMPTY() + +#define CATCH_REC_GET_END2() 0, CATCH_REC_END +#define CATCH_REC_GET_END1(...) CATCH_REC_GET_END2 +#define CATCH_REC_GET_END(...) CATCH_REC_GET_END1 +#define CATCH_REC_NEXT0(test, next, ...) next CATCH_REC_OUT +#define CATCH_REC_NEXT1(test, next) CATCH_DEFER ( CATCH_REC_NEXT0 ) ( test, next, 0) +#define CATCH_REC_NEXT(test, next) CATCH_REC_NEXT1(CATCH_REC_GET_END test, next) + +#define CATCH_REC_LIST0(f, x, peek, ...) , f(x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST1) ) ( f, peek, __VA_ARGS__ ) +#define CATCH_REC_LIST1(f, x, peek, ...) , f(x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST0) ) ( f, peek, __VA_ARGS__ ) +#define CATCH_REC_LIST2(f, x, peek, ...) f(x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST1) ) ( f, peek, __VA_ARGS__ ) + +#define CATCH_REC_LIST0_UD(f, userdata, x, peek, ...) , f(userdata, x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST1_UD) ) ( f, userdata, peek, __VA_ARGS__ ) +#define CATCH_REC_LIST1_UD(f, userdata, x, peek, ...) , f(userdata, x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST0_UD) ) ( f, userdata, peek, __VA_ARGS__ ) +#define CATCH_REC_LIST2_UD(f, userdata, x, peek, ...) f(userdata, x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST1_UD) ) ( f, userdata, peek, __VA_ARGS__ ) + +// Applies the function macro `f` to each of the remaining parameters, inserts commas between the results, +// and passes userdata as the first parameter to each invocation, +// e.g. CATCH_REC_LIST_UD(f, x, a, b, c) evaluates to f(x, a), f(x, b), f(x, c) +#define CATCH_REC_LIST_UD(f, userdata, ...) CATCH_RECURSE(CATCH_REC_LIST2_UD(f, userdata, __VA_ARGS__, ()()(), ()()(), ()()(), 0)) + +#define CATCH_REC_LIST(f, ...) CATCH_RECURSE(CATCH_REC_LIST2(f, __VA_ARGS__, ()()(), ()()(), ()()(), 0)) + +#define INTERNAL_CATCH_EXPAND1(param) INTERNAL_CATCH_EXPAND2(param) +#define INTERNAL_CATCH_EXPAND2(...) INTERNAL_CATCH_NO## __VA_ARGS__ +#define INTERNAL_CATCH_DEF(...) INTERNAL_CATCH_DEF __VA_ARGS__ +#define INTERNAL_CATCH_NOINTERNAL_CATCH_DEF +#define INTERNAL_CATCH_STRINGIZE(...) INTERNAL_CATCH_STRINGIZE2(__VA_ARGS__) +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define INTERNAL_CATCH_STRINGIZE2(...) #__VA_ARGS__ +#define INTERNAL_CATCH_STRINGIZE_WITHOUT_PARENS(param) INTERNAL_CATCH_STRINGIZE(INTERNAL_CATCH_REMOVE_PARENS(param)) +#else +// MSVC is adding extra space and needs another indirection to expand INTERNAL_CATCH_NOINTERNAL_CATCH_DEF +#define INTERNAL_CATCH_STRINGIZE2(...) INTERNAL_CATCH_STRINGIZE3(__VA_ARGS__) +#define INTERNAL_CATCH_STRINGIZE3(...) #__VA_ARGS__ +#define INTERNAL_CATCH_STRINGIZE_WITHOUT_PARENS(param) (INTERNAL_CATCH_STRINGIZE(INTERNAL_CATCH_REMOVE_PARENS(param)) + 1) +#endif + +#define INTERNAL_CATCH_REMOVE_PARENS(...) INTERNAL_CATCH_EXPAND1(INTERNAL_CATCH_DEF __VA_ARGS__) + +#define INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME2(Name, ...) INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME3(Name, __VA_ARGS__) +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME3(Name,...) Name " - " #__VA_ARGS__ +#define INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME(Name,...) INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME2(Name, INTERNAL_CATCH_REMOVE_PARENS(__VA_ARGS__)) +#else +// MSVC is adding extra space and needs more calls to properly remove () +#define INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME3(Name,...) Name " -" #__VA_ARGS__ +#define INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME1(Name, ...) INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME2(Name, __VA_ARGS__) +#define INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME(Name, ...) INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME1(Name, INTERNAL_CATCH_EXPAND_VARGS(INTERNAL_CATCH_REMOVE_PARENS(__VA_ARGS__))) +#endif + +#define INTERNAL_CATCH_MAKE_TYPE_LIST(types) Catch::TypeList + +#define INTERNAL_CATCH_MAKE_TYPE_LISTS_FROM_TYPES(types)\ + CATCH_REC_LIST(INTERNAL_CATCH_MAKE_TYPE_LIST,INTERNAL_CATCH_REMOVE_PARENS(types)) + +// end catch_preprocessor.hpp +// start catch_meta.hpp + + +#include + +namespace Catch { +template< typename... > +struct TypeList {}; + +template< typename... > +struct append; + +template< template class L1 + , typename...E1 + , template class L2 + , typename...E2 +> +struct append< L1, L2 > { + using type = L1; +}; + +template< template class L1 + , typename...E1 + , template class L2 + , typename...E2 + , typename...Rest +> +struct append< L1, L2, Rest...> { + using type = typename append< L1, Rest... >::type; +}; + +template< template class + , typename... +> +struct rewrap; + +template< template class Container + , template class List + , typename...elems +> +struct rewrap> { + using type = TypeList< Container< elems... > >; +}; + +template< template class Container + , template class List + , class...Elems + , typename...Elements> + struct rewrap, Elements...> { + using type = typename append>, typename rewrap::type>::type; +}; + +template< template class...Containers > +struct combine { + template< typename...Types > + struct with_types { + template< template class Final > + struct into { + using type = typename append, typename rewrap::type...>::type; + }; + }; +}; + +template +struct always_false : std::false_type {}; + +} // namespace Catch + +// end catch_meta.hpp +namespace Catch { + +template +class TestInvokerAsMethod : public ITestInvoker { + void (C::*m_testAsMethod)(); +public: + TestInvokerAsMethod( void (C::*testAsMethod)() ) noexcept : m_testAsMethod( testAsMethod ) {} + + void invoke() const override { + C obj; + (obj.*m_testAsMethod)(); + } +}; + +auto makeTestInvoker( void(*testAsFunction)() ) noexcept -> ITestInvoker*; + +template +auto makeTestInvoker( void (C::*testAsMethod)() ) noexcept -> ITestInvoker* { + return new(std::nothrow) TestInvokerAsMethod( testAsMethod ); +} + +struct NameAndTags { + NameAndTags( StringRef const& name_ = StringRef(), StringRef const& tags_ = StringRef() ) noexcept; + StringRef name; + StringRef tags; +}; + +struct AutoReg : NonCopyable { + AutoReg( ITestInvoker* invoker, SourceLineInfo const& lineInfo, StringRef const& classOrMethod, NameAndTags const& nameAndTags ) noexcept; + ~AutoReg(); +}; + +} // end namespace Catch + +#if defined(CATCH_CONFIG_DISABLE) + #define INTERNAL_CATCH_TESTCASE_NO_REGISTRATION( TestName, ... ) \ + static void TestName() + #define INTERNAL_CATCH_TESTCASE_METHOD_NO_REGISTRATION( TestName, ClassName, ... ) \ + namespace{ \ + struct TestName : INTERNAL_CATCH_REMOVE_PARENS(ClassName) { \ + void test(); \ + }; \ + } \ + void TestName::test() + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE_NO_REGISTRATION( TestName, ... ) \ + template \ + static void TestName() + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_NO_REGISTRATION( TestName, ClassName, ... ) \ + namespace{ \ + template \ + struct TestName : INTERNAL_CATCH_REMOVE_PARENS(ClassName ) { \ + void test(); \ + }; \ + } \ + template \ + void TestName::test() +#endif + + /////////////////////////////////////////////////////////////////////////////// + #define INTERNAL_CATCH_TESTCASE2( TestName, ... ) \ + static void TestName(); \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ Catch::AutoReg INTERNAL_CATCH_UNIQUE_NAME( autoRegistrar )( Catch::makeTestInvoker( &TestName ), CATCH_INTERNAL_LINEINFO, Catch::StringRef(), Catch::NameAndTags{ __VA_ARGS__ } ); } /* NOLINT */ \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS \ + static void TestName() + #define INTERNAL_CATCH_TESTCASE( ... ) \ + INTERNAL_CATCH_TESTCASE2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ ), __VA_ARGS__ ) + + /////////////////////////////////////////////////////////////////////////////// + #define INTERNAL_CATCH_METHOD_AS_TEST_CASE( QualifiedMethod, ... ) \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ Catch::AutoReg INTERNAL_CATCH_UNIQUE_NAME( autoRegistrar )( Catch::makeTestInvoker( &QualifiedMethod ), CATCH_INTERNAL_LINEINFO, "&" #QualifiedMethod, Catch::NameAndTags{ __VA_ARGS__ } ); } /* NOLINT */ \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS + + /////////////////////////////////////////////////////////////////////////////// + #define INTERNAL_CATCH_TEST_CASE_METHOD2( TestName, ClassName, ... )\ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ \ + struct TestName : INTERNAL_CATCH_REMOVE_PARENS(ClassName) { \ + void test(); \ + }; \ + Catch::AutoReg INTERNAL_CATCH_UNIQUE_NAME( autoRegistrar ) ( Catch::makeTestInvoker( &TestName::test ), CATCH_INTERNAL_LINEINFO, #ClassName, Catch::NameAndTags{ __VA_ARGS__ } ); /* NOLINT */ \ + } \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS \ + void TestName::test() + #define INTERNAL_CATCH_TEST_CASE_METHOD( ClassName, ... ) \ + INTERNAL_CATCH_TEST_CASE_METHOD2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ ), ClassName, __VA_ARGS__ ) + + /////////////////////////////////////////////////////////////////////////////// + #define INTERNAL_CATCH_REGISTER_TESTCASE( Function, ... ) \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + Catch::AutoReg INTERNAL_CATCH_UNIQUE_NAME( autoRegistrar )( Catch::makeTestInvoker( Function ), CATCH_INTERNAL_LINEINFO, Catch::StringRef(), Catch::NameAndTags{ __VA_ARGS__ } ); /* NOLINT */ \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS + + /////////////////////////////////////////////////////////////////////////////// + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE_2(TestName, TestFunc, Name, Tags, ... )\ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + template \ + static void TestFunc();\ + namespace {\ + template \ + struct TestName{\ + template \ + TestName(Ts...names){\ + CATCH_INTERNAL_CHECK_UNIQUE_TYPES(CATCH_REC_LIST(INTERNAL_CATCH_REMOVE_PARENS, __VA_ARGS__)) \ + using expander = int[];\ + (void)expander{(Catch::AutoReg( Catch::makeTestInvoker( &TestFunc ), CATCH_INTERNAL_LINEINFO, Catch::StringRef(), Catch::NameAndTags{ names, Tags } ), 0)... };/* NOLINT */ \ + }\ + };\ + INTERNAL_CATCH_TEMPLATE_REGISTRY_INITIATE(TestName, Name, __VA_ARGS__) \ + }\ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS \ + template \ + static void TestFunc() + +#if defined(CATCH_CPP17_OR_GREATER) +#define CATCH_INTERNAL_CHECK_UNIQUE_TYPES(...) static_assert(Catch::is_unique<__VA_ARGS__>,"Duplicate type detected in declaration of template test case"); +#else +#define CATCH_INTERNAL_CHECK_UNIQUE_TYPES(...) static_assert(Catch::is_unique<__VA_ARGS__>::value,"Duplicate type detected in declaration of template test case"); +#endif + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE(Name, Tags, ...) \ + INTERNAL_CATCH_TEMPLATE_TEST_CASE_2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____F_U_N_C____ ), Name, Tags, __VA_ARGS__ ) +#else + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE(Name, Tags, ...) \ + INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____F_U_N_C____ ), Name, Tags, __VA_ARGS__ ) ) +#endif + + #define INTERNAL_CATCH_TEMPLATE_REGISTRY_INITIATE(TestName, Name, ...)\ + static int INTERNAL_CATCH_UNIQUE_NAME( globalRegistrar ) = [](){\ + TestName(CATCH_REC_LIST_UD(INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME,Name, __VA_ARGS__));\ + return 0;\ + }(); + + #define INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE2(TestName, TestFuncName, Name, Tags, TmplTypes, TypesList) \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + template static void TestFuncName(); \ + namespace { \ + template \ + struct TestName { \ + TestName() { \ + CATCH_INTERNAL_CHECK_UNIQUE_TYPES(Types...) \ + int index = 0; \ + using expander = int[]; \ + constexpr char const* tmpl_types[] = {CATCH_REC_LIST(INTERNAL_CATCH_STRINGIZE_WITHOUT_PARENS, INTERNAL_CATCH_REMOVE_PARENS(TmplTypes))};\ + constexpr char const* types_list[] = {CATCH_REC_LIST(INTERNAL_CATCH_STRINGIZE_WITHOUT_PARENS, INTERNAL_CATCH_REMOVE_PARENS(TypesList))};\ + constexpr auto num_types = sizeof(types_list) / sizeof(types_list[0]);\ + (void)expander{(Catch::AutoReg( Catch::makeTestInvoker( &TestFuncName ), CATCH_INTERNAL_LINEINFO, Catch::StringRef(), Catch::NameAndTags{ Name " - " + std::string(tmpl_types[index / num_types]) + "<" + std::string(types_list[index % num_types]) + ">", Tags } ), index++, 0)... };/* NOLINT */\ + } \ + }; \ + static int INTERNAL_CATCH_UNIQUE_NAME( globalRegistrar ) = [](){ \ + using TestInit = Catch::combine \ + ::with_types::into::type; \ + TestInit(); \ + return 0; \ + }(); \ + } \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS \ + template \ + static void TestFuncName() + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR + #define INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE(Name, Tags, ...)\ + INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE2(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____F_U_N_C____ ),Name,Tags,__VA_ARGS__) +#else + #define INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE(Name, Tags, ...)\ + INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____F_U_N_C____ ), Name, Tags, __VA_ARGS__ ) ) +#endif + + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_2( TestNameClass, TestName, ClassName, Name, Tags, ... ) \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ \ + template \ + struct TestName : INTERNAL_CATCH_REMOVE_PARENS(ClassName ) { \ + void test();\ + };\ + template \ + struct TestNameClass{\ + template \ + TestNameClass(Ts...names){\ + CATCH_INTERNAL_CHECK_UNIQUE_TYPES(CATCH_REC_LIST(INTERNAL_CATCH_REMOVE_PARENS, __VA_ARGS__)) \ + using expander = int[];\ + (void)expander{(Catch::AutoReg( Catch::makeTestInvoker( &TestName::test ), CATCH_INTERNAL_LINEINFO, #ClassName, Catch::NameAndTags{ names, Tags } ), 0)... };/* NOLINT */ \ + }\ + };\ + INTERNAL_CATCH_TEMPLATE_REGISTRY_INITIATE(TestNameClass, Name, __VA_ARGS__)\ + }\ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS\ + template \ + void TestName::test() + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD( ClassName, Name, Tags,... ) \ + INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____C_L_A_S_S____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ) , ClassName, Name, Tags, __VA_ARGS__ ) +#else + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD( ClassName, Name, Tags,... ) \ + INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____C_L_A_S_S____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ) , ClassName, Name, Tags, __VA_ARGS__ ) ) +#endif + + #define INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD_2(TestNameClass, TestName, ClassName, Name, Tags, TmplTypes, TypesList)\ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + template \ + struct TestName : INTERNAL_CATCH_REMOVE_PARENS(ClassName ) { \ + void test();\ + };\ + namespace {\ + template\ + struct TestNameClass{\ + TestNameClass(){\ + CATCH_INTERNAL_CHECK_UNIQUE_TYPES(Types...)\ + int index = 0;\ + using expander = int[];\ + constexpr char const* tmpl_types[] = {CATCH_REC_LIST(INTERNAL_CATCH_STRINGIZE_WITHOUT_PARENS, INTERNAL_CATCH_REMOVE_PARENS(TmplTypes))};\ + constexpr char const* types_list[] = {CATCH_REC_LIST(INTERNAL_CATCH_STRINGIZE_WITHOUT_PARENS, INTERNAL_CATCH_REMOVE_PARENS(TypesList))};\ + constexpr auto num_types = sizeof(types_list) / sizeof(types_list[0]);\ + (void)expander{(Catch::AutoReg( Catch::makeTestInvoker( &TestName::test ), CATCH_INTERNAL_LINEINFO, #ClassName, Catch::NameAndTags{ Name " - " + std::string(tmpl_types[index / num_types]) + "<" + std::string(types_list[index % num_types]) + ">", Tags } ), index++, 0)... };/* NOLINT */ \ + }\ + };\ + static int INTERNAL_CATCH_UNIQUE_NAME( globalRegistrar ) = [](){\ + using TestInit = Catch::combine\ + ::with_types::into::type;\ + TestInit();\ + return 0;\ + }(); \ + }\ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS \ + template \ + void TestName::test() + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR + #define INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( ClassName, Name, Tags, ... )\ + INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD_2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____F_U_N_C____ ), ClassName, Name, Tags, __VA_ARGS__ ) +#else + #define INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( ClassName, Name, Tags, ... )\ + INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD_2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____F_U_N_C____ ), ClassName, Name, Tags, __VA_ARGS__ ) ) +#endif + +// end catch_test_registry.h +// start catch_capture.hpp + +// start catch_assertionhandler.h + +// start catch_assertioninfo.h + +// start catch_result_type.h + +namespace Catch { + + // ResultWas::OfType enum + struct ResultWas { enum OfType { + Unknown = -1, + Ok = 0, + Info = 1, + Warning = 2, + + FailureBit = 0x10, + + ExpressionFailed = FailureBit | 1, + ExplicitFailure = FailureBit | 2, + + Exception = 0x100 | FailureBit, + + ThrewException = Exception | 1, + DidntThrowException = Exception | 2, + + FatalErrorCondition = 0x200 | FailureBit + + }; }; + + bool isOk( ResultWas::OfType resultType ); + bool isJustInfo( int flags ); + + // ResultDisposition::Flags enum + struct ResultDisposition { enum Flags { + Normal = 0x01, + + ContinueOnFailure = 0x02, // Failures fail test, but execution continues + FalseTest = 0x04, // Prefix expression with ! + SuppressFail = 0x08 // Failures are reported but do not fail the test + }; }; + + ResultDisposition::Flags operator | ( ResultDisposition::Flags lhs, ResultDisposition::Flags rhs ); + + bool shouldContinueOnFailure( int flags ); + inline bool isFalseTest( int flags ) { return ( flags & ResultDisposition::FalseTest ) != 0; } + bool shouldSuppressFailure( int flags ); + +} // end namespace Catch + +// end catch_result_type.h +namespace Catch { + + struct AssertionInfo + { + StringRef macroName; + SourceLineInfo lineInfo; + StringRef capturedExpression; + ResultDisposition::Flags resultDisposition; + + // We want to delete this constructor but a compiler bug in 4.8 means + // the struct is then treated as non-aggregate + //AssertionInfo() = delete; + }; + +} // end namespace Catch + +// end catch_assertioninfo.h +// start catch_decomposer.h + +// start catch_tostring.h + +#include +#include +#include +#include +// start catch_stream.h + +#include +#include +#include + +namespace Catch { + + std::ostream& cout(); + std::ostream& cerr(); + std::ostream& clog(); + + class StringRef; + + struct IStream { + virtual ~IStream(); + virtual std::ostream& stream() const = 0; + }; + + auto makeStream( StringRef const &filename ) -> IStream const*; + + class ReusableStringStream { + std::size_t m_index; + std::ostream* m_oss; + public: + ReusableStringStream(); + ~ReusableStringStream(); + + auto str() const -> std::string; + + template + auto operator << ( T const& value ) -> ReusableStringStream& { + *m_oss << value; + return *this; + } + auto get() -> std::ostream& { return *m_oss; } + }; +} + +// end catch_stream.h + +#ifdef CATCH_CONFIG_CPP17_STRING_VIEW +#include +#endif + +#ifdef __OBJC__ +// start catch_objc_arc.hpp + +#import + +#ifdef __has_feature +#define CATCH_ARC_ENABLED __has_feature(objc_arc) +#else +#define CATCH_ARC_ENABLED 0 +#endif + +void arcSafeRelease( NSObject* obj ); +id performOptionalSelector( id obj, SEL sel ); + +#if !CATCH_ARC_ENABLED +inline void arcSafeRelease( NSObject* obj ) { + [obj release]; +} +inline id performOptionalSelector( id obj, SEL sel ) { + if( [obj respondsToSelector: sel] ) + return [obj performSelector: sel]; + return nil; +} +#define CATCH_UNSAFE_UNRETAINED +#define CATCH_ARC_STRONG +#else +inline void arcSafeRelease( NSObject* ){} +inline id performOptionalSelector( id obj, SEL sel ) { +#ifdef __clang__ +#pragma clang diagnostic push +#pragma clang diagnostic ignored "-Warc-performSelector-leaks" +#endif + if( [obj respondsToSelector: sel] ) + return [obj performSelector: sel]; +#ifdef __clang__ +#pragma clang diagnostic pop +#endif + return nil; +} +#define CATCH_UNSAFE_UNRETAINED __unsafe_unretained +#define CATCH_ARC_STRONG __strong +#endif + +// end catch_objc_arc.hpp +#endif + +#ifdef _MSC_VER +#pragma warning(push) +#pragma warning(disable:4180) // We attempt to stream a function (address) by const&, which MSVC complains about but is harmless +#endif + +namespace Catch { + namespace Detail { + + extern const std::string unprintableString; + + std::string rawMemoryToString( const void *object, std::size_t size ); + + template + std::string rawMemoryToString( const T& object ) { + return rawMemoryToString( &object, sizeof(object) ); + } + + template + class IsStreamInsertable { + template + static auto test(int) + -> decltype(std::declval() << std::declval(), std::true_type()); + + template + static auto test(...)->std::false_type; + + public: + static const bool value = decltype(test(0))::value; + }; + + template + std::string convertUnknownEnumToString( E e ); + + template + typename std::enable_if< + !std::is_enum::value && !std::is_base_of::value, + std::string>::type convertUnstreamable( T const& ) { + return Detail::unprintableString; + } + template + typename std::enable_if< + !std::is_enum::value && std::is_base_of::value, + std::string>::type convertUnstreamable(T const& ex) { + return ex.what(); + } + + template + typename std::enable_if< + std::is_enum::value + , std::string>::type convertUnstreamable( T const& value ) { + return convertUnknownEnumToString( value ); + } + +#if defined(_MANAGED) + //! Convert a CLR string to a utf8 std::string + template + std::string clrReferenceToString( T^ ref ) { + if (ref == nullptr) + return std::string("null"); + auto bytes = System::Text::Encoding::UTF8->GetBytes(ref->ToString()); + cli::pin_ptr p = &bytes[0]; + return std::string(reinterpret_cast(p), bytes->Length); + } +#endif + + } // namespace Detail + + // If we decide for C++14, change these to enable_if_ts + template + struct StringMaker { + template + static + typename std::enable_if<::Catch::Detail::IsStreamInsertable::value, std::string>::type + convert(const Fake& value) { + ReusableStringStream rss; + // NB: call using the function-like syntax to avoid ambiguity with + // user-defined templated operator<< under clang. + rss.operator<<(value); + return rss.str(); + } + + template + static + typename std::enable_if::value, std::string>::type + convert( const Fake& value ) { +#if !defined(CATCH_CONFIG_FALLBACK_STRINGIFIER) + return Detail::convertUnstreamable(value); +#else + return CATCH_CONFIG_FALLBACK_STRINGIFIER(value); +#endif + } + }; + + namespace Detail { + + // This function dispatches all stringification requests inside of Catch. + // Should be preferably called fully qualified, like ::Catch::Detail::stringify + template + std::string stringify(const T& e) { + return ::Catch::StringMaker::type>::type>::convert(e); + } + + template + std::string convertUnknownEnumToString( E e ) { + return ::Catch::Detail::stringify(static_cast::type>(e)); + } + +#if defined(_MANAGED) + template + std::string stringify( T^ e ) { + return ::Catch::StringMaker::convert(e); + } +#endif + + } // namespace Detail + + // Some predefined specializations + + template<> + struct StringMaker { + static std::string convert(const std::string& str); + }; + +#ifdef CATCH_CONFIG_CPP17_STRING_VIEW + template<> + struct StringMaker { + static std::string convert(std::string_view str); + }; +#endif + + template<> + struct StringMaker { + static std::string convert(char const * str); + }; + template<> + struct StringMaker { + static std::string convert(char * str); + }; + +#ifdef CATCH_CONFIG_WCHAR + template<> + struct StringMaker { + static std::string convert(const std::wstring& wstr); + }; + +# ifdef CATCH_CONFIG_CPP17_STRING_VIEW + template<> + struct StringMaker { + static std::string convert(std::wstring_view str); + }; +# endif + + template<> + struct StringMaker { + static std::string convert(wchar_t const * str); + }; + template<> + struct StringMaker { + static std::string convert(wchar_t * str); + }; +#endif + + // TBD: Should we use `strnlen` to ensure that we don't go out of the buffer, + // while keeping string semantics? + template + struct StringMaker { + static std::string convert(char const* str) { + return ::Catch::Detail::stringify(std::string{ str }); + } + }; + template + struct StringMaker { + static std::string convert(signed char const* str) { + return ::Catch::Detail::stringify(std::string{ reinterpret_cast(str) }); + } + }; + template + struct StringMaker { + static std::string convert(unsigned char const* str) { + return ::Catch::Detail::stringify(std::string{ reinterpret_cast(str) }); + } + }; + + template<> + struct StringMaker { + static std::string convert(int value); + }; + template<> + struct StringMaker { + static std::string convert(long value); + }; + template<> + struct StringMaker { + static std::string convert(long long value); + }; + template<> + struct StringMaker { + static std::string convert(unsigned int value); + }; + template<> + struct StringMaker { + static std::string convert(unsigned long value); + }; + template<> + struct StringMaker { + static std::string convert(unsigned long long value); + }; + + template<> + struct StringMaker { + static std::string convert(bool b); + }; + + template<> + struct StringMaker { + static std::string convert(char c); + }; + template<> + struct StringMaker { + static std::string convert(signed char c); + }; + template<> + struct StringMaker { + static std::string convert(unsigned char c); + }; + + template<> + struct StringMaker { + static std::string convert(std::nullptr_t); + }; + + template<> + struct StringMaker { + static std::string convert(float value); + }; + template<> + struct StringMaker { + static std::string convert(double value); + }; + + template + struct StringMaker { + template + static std::string convert(U* p) { + if (p) { + return ::Catch::Detail::rawMemoryToString(p); + } else { + return "nullptr"; + } + } + }; + + template + struct StringMaker { + static std::string convert(R C::* p) { + if (p) { + return ::Catch::Detail::rawMemoryToString(p); + } else { + return "nullptr"; + } + } + }; + +#if defined(_MANAGED) + template + struct StringMaker { + static std::string convert( T^ ref ) { + return ::Catch::Detail::clrReferenceToString(ref); + } + }; +#endif + + namespace Detail { + template + std::string rangeToString(InputIterator first, InputIterator last) { + ReusableStringStream rss; + rss << "{ "; + if (first != last) { + rss << ::Catch::Detail::stringify(*first); + for (++first; first != last; ++first) + rss << ", " << ::Catch::Detail::stringify(*first); + } + rss << " }"; + return rss.str(); + } + } + +#ifdef __OBJC__ + template<> + struct StringMaker { + static std::string convert(NSString * nsstring) { + if (!nsstring) + return "nil"; + return std::string("@") + [nsstring UTF8String]; + } + }; + template<> + struct StringMaker { + static std::string convert(NSObject* nsObject) { + return ::Catch::Detail::stringify([nsObject description]); + } + + }; + namespace Detail { + inline std::string stringify( NSString* nsstring ) { + return StringMaker::convert( nsstring ); + } + + } // namespace Detail +#endif // __OBJC__ + +} // namespace Catch + +////////////////////////////////////////////////////// +// Separate std-lib types stringification, so it can be selectively enabled +// This means that we do not bring in + +#if defined(CATCH_CONFIG_ENABLE_ALL_STRINGMAKERS) +# define CATCH_CONFIG_ENABLE_PAIR_STRINGMAKER +# define CATCH_CONFIG_ENABLE_TUPLE_STRINGMAKER +# define CATCH_CONFIG_ENABLE_VARIANT_STRINGMAKER +# define CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER +# define CATCH_CONFIG_ENABLE_OPTIONAL_STRINGMAKER +#endif + +// Separate std::pair specialization +#if defined(CATCH_CONFIG_ENABLE_PAIR_STRINGMAKER) +#include +namespace Catch { + template + struct StringMaker > { + static std::string convert(const std::pair& pair) { + ReusableStringStream rss; + rss << "{ " + << ::Catch::Detail::stringify(pair.first) + << ", " + << ::Catch::Detail::stringify(pair.second) + << " }"; + return rss.str(); + } + }; +} +#endif // CATCH_CONFIG_ENABLE_PAIR_STRINGMAKER + +#if defined(CATCH_CONFIG_ENABLE_OPTIONAL_STRINGMAKER) && defined(CATCH_CONFIG_CPP17_OPTIONAL) +#include +namespace Catch { + template + struct StringMaker > { + static std::string convert(const std::optional& optional) { + ReusableStringStream rss; + if (optional.has_value()) { + rss << ::Catch::Detail::stringify(*optional); + } else { + rss << "{ }"; + } + return rss.str(); + } + }; +} +#endif // CATCH_CONFIG_ENABLE_OPTIONAL_STRINGMAKER + +// Separate std::tuple specialization +#if defined(CATCH_CONFIG_ENABLE_TUPLE_STRINGMAKER) +#include +namespace Catch { + namespace Detail { + template< + typename Tuple, + std::size_t N = 0, + bool = (N < std::tuple_size::value) + > + struct TupleElementPrinter { + static void print(const Tuple& tuple, std::ostream& os) { + os << (N ? ", " : " ") + << ::Catch::Detail::stringify(std::get(tuple)); + TupleElementPrinter::print(tuple, os); + } + }; + + template< + typename Tuple, + std::size_t N + > + struct TupleElementPrinter { + static void print(const Tuple&, std::ostream&) {} + }; + + } + + template + struct StringMaker> { + static std::string convert(const std::tuple& tuple) { + ReusableStringStream rss; + rss << '{'; + Detail::TupleElementPrinter>::print(tuple, rss.get()); + rss << " }"; + return rss.str(); + } + }; +} +#endif // CATCH_CONFIG_ENABLE_TUPLE_STRINGMAKER + +#if defined(CATCH_CONFIG_ENABLE_VARIANT_STRINGMAKER) && defined(CATCH_CONFIG_CPP17_VARIANT) +#include +namespace Catch { + template<> + struct StringMaker { + static std::string convert(const std::monostate&) { + return "{ }"; + } + }; + + template + struct StringMaker> { + static std::string convert(const std::variant& variant) { + if (variant.valueless_by_exception()) { + return "{valueless variant}"; + } else { + return std::visit( + [](const auto& value) { + return ::Catch::Detail::stringify(value); + }, + variant + ); + } + } + }; +} +#endif // CATCH_CONFIG_ENABLE_VARIANT_STRINGMAKER + +namespace Catch { + struct not_this_one {}; // Tag type for detecting which begin/ end are being selected + + // Import begin/ end from std here so they are considered alongside the fallback (...) overloads in this namespace + using std::begin; + using std::end; + + not_this_one begin( ... ); + not_this_one end( ... ); + + template + struct is_range { + static const bool value = + !std::is_same())), not_this_one>::value && + !std::is_same())), not_this_one>::value; + }; + +#if defined(_MANAGED) // Managed types are never ranges + template + struct is_range { + static const bool value = false; + }; +#endif + + template + std::string rangeToString( Range const& range ) { + return ::Catch::Detail::rangeToString( begin( range ), end( range ) ); + } + + // Handle vector specially + template + std::string rangeToString( std::vector const& v ) { + ReusableStringStream rss; + rss << "{ "; + bool first = true; + for( bool b : v ) { + if( first ) + first = false; + else + rss << ", "; + rss << ::Catch::Detail::stringify( b ); + } + rss << " }"; + return rss.str(); + } + + template + struct StringMaker::value && !::Catch::Detail::IsStreamInsertable::value>::type> { + static std::string convert( R const& range ) { + return rangeToString( range ); + } + }; + + template + struct StringMaker { + static std::string convert(T const(&arr)[SZ]) { + return rangeToString(arr); + } + }; + +} // namespace Catch + +// Separate std::chrono::duration specialization +#if defined(CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER) +#include +#include +#include + +namespace Catch { + +template +struct ratio_string { + static std::string symbol(); +}; + +template +std::string ratio_string::symbol() { + Catch::ReusableStringStream rss; + rss << '[' << Ratio::num << '/' + << Ratio::den << ']'; + return rss.str(); +} +template <> +struct ratio_string { + static std::string symbol(); +}; +template <> +struct ratio_string { + static std::string symbol(); +}; +template <> +struct ratio_string { + static std::string symbol(); +}; +template <> +struct ratio_string { + static std::string symbol(); +}; +template <> +struct ratio_string { + static std::string symbol(); +}; +template <> +struct ratio_string { + static std::string symbol(); +}; + + //////////// + // std::chrono::duration specializations + template + struct StringMaker> { + static std::string convert(std::chrono::duration const& duration) { + ReusableStringStream rss; + rss << duration.count() << ' ' << ratio_string::symbol() << 's'; + return rss.str(); + } + }; + template + struct StringMaker>> { + static std::string convert(std::chrono::duration> const& duration) { + ReusableStringStream rss; + rss << duration.count() << " s"; + return rss.str(); + } + }; + template + struct StringMaker>> { + static std::string convert(std::chrono::duration> const& duration) { + ReusableStringStream rss; + rss << duration.count() << " m"; + return rss.str(); + } + }; + template + struct StringMaker>> { + static std::string convert(std::chrono::duration> const& duration) { + ReusableStringStream rss; + rss << duration.count() << " h"; + return rss.str(); + } + }; + + //////////// + // std::chrono::time_point specialization + // Generic time_point cannot be specialized, only std::chrono::time_point + template + struct StringMaker> { + static std::string convert(std::chrono::time_point const& time_point) { + return ::Catch::Detail::stringify(time_point.time_since_epoch()) + " since epoch"; + } + }; + // std::chrono::time_point specialization + template + struct StringMaker> { + static std::string convert(std::chrono::time_point const& time_point) { + auto converted = std::chrono::system_clock::to_time_t(time_point); + +#ifdef _MSC_VER + std::tm timeInfo = {}; + gmtime_s(&timeInfo, &converted); +#else + std::tm* timeInfo = std::gmtime(&converted); +#endif + + auto const timeStampSize = sizeof("2017-01-16T17:06:45Z"); + char timeStamp[timeStampSize]; + const char * const fmt = "%Y-%m-%dT%H:%M:%SZ"; + +#ifdef _MSC_VER + std::strftime(timeStamp, timeStampSize, fmt, &timeInfo); +#else + std::strftime(timeStamp, timeStampSize, fmt, timeInfo); +#endif + return std::string(timeStamp); + } + }; +} +#endif // CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER + +#ifdef _MSC_VER +#pragma warning(pop) +#endif + +// end catch_tostring.h +#include + +#ifdef _MSC_VER +#pragma warning(push) +#pragma warning(disable:4389) // '==' : signed/unsigned mismatch +#pragma warning(disable:4018) // more "signed/unsigned mismatch" +#pragma warning(disable:4312) // Converting int to T* using reinterpret_cast (issue on x64 platform) +#pragma warning(disable:4180) // qualifier applied to function type has no meaning +#pragma warning(disable:4800) // Forcing result to true or false +#endif + +namespace Catch { + + struct ITransientExpression { + auto isBinaryExpression() const -> bool { return m_isBinaryExpression; } + auto getResult() const -> bool { return m_result; } + virtual void streamReconstructedExpression( std::ostream &os ) const = 0; + + ITransientExpression( bool isBinaryExpression, bool result ) + : m_isBinaryExpression( isBinaryExpression ), + m_result( result ) + {} + + // We don't actually need a virtual destructor, but many static analysers + // complain if it's not here :-( + virtual ~ITransientExpression(); + + bool m_isBinaryExpression; + bool m_result; + + }; + + void formatReconstructedExpression( std::ostream &os, std::string const& lhs, StringRef op, std::string const& rhs ); + + template + class BinaryExpr : public ITransientExpression { + LhsT m_lhs; + StringRef m_op; + RhsT m_rhs; + + void streamReconstructedExpression( std::ostream &os ) const override { + formatReconstructedExpression + ( os, Catch::Detail::stringify( m_lhs ), m_op, Catch::Detail::stringify( m_rhs ) ); + } + + public: + BinaryExpr( bool comparisonResult, LhsT lhs, StringRef op, RhsT rhs ) + : ITransientExpression{ true, comparisonResult }, + m_lhs( lhs ), + m_op( op ), + m_rhs( rhs ) + {} + + template + auto operator && ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator || ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator == ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator != ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator > ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator < ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator >= ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator <= ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + }; + + template + class UnaryExpr : public ITransientExpression { + LhsT m_lhs; + + void streamReconstructedExpression( std::ostream &os ) const override { + os << Catch::Detail::stringify( m_lhs ); + } + + public: + explicit UnaryExpr( LhsT lhs ) + : ITransientExpression{ false, static_cast(lhs) }, + m_lhs( lhs ) + {} + }; + + // Specialised comparison functions to handle equality comparisons between ints and pointers (NULL deduces as an int) + template + auto compareEqual( LhsT const& lhs, RhsT const& rhs ) -> bool { return static_cast(lhs == rhs); } + template + auto compareEqual( T* const& lhs, int rhs ) -> bool { return lhs == reinterpret_cast( rhs ); } + template + auto compareEqual( T* const& lhs, long rhs ) -> bool { return lhs == reinterpret_cast( rhs ); } + template + auto compareEqual( int lhs, T* const& rhs ) -> bool { return reinterpret_cast( lhs ) == rhs; } + template + auto compareEqual( long lhs, T* const& rhs ) -> bool { return reinterpret_cast( lhs ) == rhs; } + + template + auto compareNotEqual( LhsT const& lhs, RhsT&& rhs ) -> bool { return static_cast(lhs != rhs); } + template + auto compareNotEqual( T* const& lhs, int rhs ) -> bool { return lhs != reinterpret_cast( rhs ); } + template + auto compareNotEqual( T* const& lhs, long rhs ) -> bool { return lhs != reinterpret_cast( rhs ); } + template + auto compareNotEqual( int lhs, T* const& rhs ) -> bool { return reinterpret_cast( lhs ) != rhs; } + template + auto compareNotEqual( long lhs, T* const& rhs ) -> bool { return reinterpret_cast( lhs ) != rhs; } + + template + class ExprLhs { + LhsT m_lhs; + public: + explicit ExprLhs( LhsT lhs ) : m_lhs( lhs ) {} + + template + auto operator == ( RhsT const& rhs ) -> BinaryExpr const { + return { compareEqual( m_lhs, rhs ), m_lhs, "==", rhs }; + } + auto operator == ( bool rhs ) -> BinaryExpr const { + return { m_lhs == rhs, m_lhs, "==", rhs }; + } + + template + auto operator != ( RhsT const& rhs ) -> BinaryExpr const { + return { compareNotEqual( m_lhs, rhs ), m_lhs, "!=", rhs }; + } + auto operator != ( bool rhs ) -> BinaryExpr const { + return { m_lhs != rhs, m_lhs, "!=", rhs }; + } + + template + auto operator > ( RhsT const& rhs ) -> BinaryExpr const { + return { static_cast(m_lhs > rhs), m_lhs, ">", rhs }; + } + template + auto operator < ( RhsT const& rhs ) -> BinaryExpr const { + return { static_cast(m_lhs < rhs), m_lhs, "<", rhs }; + } + template + auto operator >= ( RhsT const& rhs ) -> BinaryExpr const { + return { static_cast(m_lhs >= rhs), m_lhs, ">=", rhs }; + } + template + auto operator <= ( RhsT const& rhs ) -> BinaryExpr const { + return { static_cast(m_lhs <= rhs), m_lhs, "<=", rhs }; + } + + template + auto operator && ( RhsT const& ) -> BinaryExpr const { + static_assert(always_false::value, + "operator&& is not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator || ( RhsT const& ) -> BinaryExpr const { + static_assert(always_false::value, + "operator|| is not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + auto makeUnaryExpr() const -> UnaryExpr { + return UnaryExpr{ m_lhs }; + } + }; + + void handleExpression( ITransientExpression const& expr ); + + template + void handleExpression( ExprLhs const& expr ) { + handleExpression( expr.makeUnaryExpr() ); + } + + struct Decomposer { + template + auto operator <= ( T const& lhs ) -> ExprLhs { + return ExprLhs{ lhs }; + } + + auto operator <=( bool value ) -> ExprLhs { + return ExprLhs{ value }; + } + }; + +} // end namespace Catch + +#ifdef _MSC_VER +#pragma warning(pop) +#endif + +// end catch_decomposer.h +// start catch_interfaces_capture.h + +#include + +namespace Catch { + + class AssertionResult; + struct AssertionInfo; + struct SectionInfo; + struct SectionEndInfo; + struct MessageInfo; + struct MessageBuilder; + struct Counts; + struct BenchmarkInfo; + struct BenchmarkStats; + struct AssertionReaction; + struct SourceLineInfo; + + struct ITransientExpression; + struct IGeneratorTracker; + + struct IResultCapture { + + virtual ~IResultCapture(); + + virtual bool sectionStarted( SectionInfo const& sectionInfo, + Counts& assertions ) = 0; + virtual void sectionEnded( SectionEndInfo const& endInfo ) = 0; + virtual void sectionEndedEarly( SectionEndInfo const& endInfo ) = 0; + + virtual auto acquireGeneratorTracker( SourceLineInfo const& lineInfo ) -> IGeneratorTracker& = 0; + + virtual void benchmarkStarting( BenchmarkInfo const& info ) = 0; + virtual void benchmarkEnded( BenchmarkStats const& stats ) = 0; + + virtual void pushScopedMessage( MessageInfo const& message ) = 0; + virtual void popScopedMessage( MessageInfo const& message ) = 0; + + virtual void emplaceUnscopedMessage( MessageBuilder const& builder ) = 0; + + virtual void handleFatalErrorCondition( StringRef message ) = 0; + + virtual void handleExpr + ( AssertionInfo const& info, + ITransientExpression const& expr, + AssertionReaction& reaction ) = 0; + virtual void handleMessage + ( AssertionInfo const& info, + ResultWas::OfType resultType, + StringRef const& message, + AssertionReaction& reaction ) = 0; + virtual void handleUnexpectedExceptionNotThrown + ( AssertionInfo const& info, + AssertionReaction& reaction ) = 0; + virtual void handleUnexpectedInflightException + ( AssertionInfo const& info, + std::string const& message, + AssertionReaction& reaction ) = 0; + virtual void handleIncomplete + ( AssertionInfo const& info ) = 0; + virtual void handleNonExpr + ( AssertionInfo const &info, + ResultWas::OfType resultType, + AssertionReaction &reaction ) = 0; + + virtual bool lastAssertionPassed() = 0; + virtual void assertionPassed() = 0; + + // Deprecated, do not use: + virtual std::string getCurrentTestName() const = 0; + virtual const AssertionResult* getLastResult() const = 0; + virtual void exceptionEarlyReported() = 0; + }; + + IResultCapture& getResultCapture(); +} + +// end catch_interfaces_capture.h +namespace Catch { + + struct TestFailureException{}; + struct AssertionResultData; + struct IResultCapture; + class RunContext; + + class LazyExpression { + friend class AssertionHandler; + friend struct AssertionStats; + friend class RunContext; + + ITransientExpression const* m_transientExpression = nullptr; + bool m_isNegated; + public: + LazyExpression( bool isNegated ); + LazyExpression( LazyExpression const& other ); + LazyExpression& operator = ( LazyExpression const& ) = delete; + + explicit operator bool() const; + + friend auto operator << ( std::ostream& os, LazyExpression const& lazyExpr ) -> std::ostream&; + }; + + struct AssertionReaction { + bool shouldDebugBreak = false; + bool shouldThrow = false; + }; + + class AssertionHandler { + AssertionInfo m_assertionInfo; + AssertionReaction m_reaction; + bool m_completed = false; + IResultCapture& m_resultCapture; + + public: + AssertionHandler + ( StringRef const& macroName, + SourceLineInfo const& lineInfo, + StringRef capturedExpression, + ResultDisposition::Flags resultDisposition ); + ~AssertionHandler() { + if ( !m_completed ) { + m_resultCapture.handleIncomplete( m_assertionInfo ); + } + } + + template + void handleExpr( ExprLhs const& expr ) { + handleExpr( expr.makeUnaryExpr() ); + } + void handleExpr( ITransientExpression const& expr ); + + void handleMessage(ResultWas::OfType resultType, StringRef const& message); + + void handleExceptionThrownAsExpected(); + void handleUnexpectedExceptionNotThrown(); + void handleExceptionNotThrownAsExpected(); + void handleThrowingCallSkipped(); + void handleUnexpectedInflightException(); + + void complete(); + void setCompleted(); + + // query + auto allowThrows() const -> bool; + }; + + void handleExceptionMatchExpr( AssertionHandler& handler, std::string const& str, StringRef const& matcherString ); + +} // namespace Catch + +// end catch_assertionhandler.h +// start catch_message.h + +#include +#include + +namespace Catch { + + struct MessageInfo { + MessageInfo( StringRef const& _macroName, + SourceLineInfo const& _lineInfo, + ResultWas::OfType _type ); + + StringRef macroName; + std::string message; + SourceLineInfo lineInfo; + ResultWas::OfType type; + unsigned int sequence; + + bool operator == ( MessageInfo const& other ) const; + bool operator < ( MessageInfo const& other ) const; + private: + static unsigned int globalCount; + }; + + struct MessageStream { + + template + MessageStream& operator << ( T const& value ) { + m_stream << value; + return *this; + } + + ReusableStringStream m_stream; + }; + + struct MessageBuilder : MessageStream { + MessageBuilder( StringRef const& macroName, + SourceLineInfo const& lineInfo, + ResultWas::OfType type ); + + template + MessageBuilder& operator << ( T const& value ) { + m_stream << value; + return *this; + } + + MessageInfo m_info; + }; + + class ScopedMessage { + public: + explicit ScopedMessage( MessageBuilder const& builder ); + ScopedMessage( ScopedMessage& duplicate ) = delete; + ScopedMessage( ScopedMessage&& old ); + ~ScopedMessage(); + + MessageInfo m_info; + bool m_moved; + }; + + class Capturer { + std::vector m_messages; + IResultCapture& m_resultCapture = getResultCapture(); + size_t m_captured = 0; + public: + Capturer( StringRef macroName, SourceLineInfo const& lineInfo, ResultWas::OfType resultType, StringRef names ); + ~Capturer(); + + void captureValue( size_t index, std::string const& value ); + + template + void captureValues( size_t index, T const& value ) { + captureValue( index, Catch::Detail::stringify( value ) ); + } + + template + void captureValues( size_t index, T const& value, Ts const&... values ) { + captureValue( index, Catch::Detail::stringify(value) ); + captureValues( index+1, values... ); + } + }; + +} // end namespace Catch + +// end catch_message.h +#if !defined(CATCH_CONFIG_DISABLE) + +#if !defined(CATCH_CONFIG_DISABLE_STRINGIFICATION) + #define CATCH_INTERNAL_STRINGIFY(...) #__VA_ARGS__ +#else + #define CATCH_INTERNAL_STRINGIFY(...) "Disabled by CATCH_CONFIG_DISABLE_STRINGIFICATION" +#endif + +#if defined(CATCH_CONFIG_FAST_COMPILE) || defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) + +/////////////////////////////////////////////////////////////////////////////// +// Another way to speed-up compilation is to omit local try-catch for REQUIRE* +// macros. +#define INTERNAL_CATCH_TRY +#define INTERNAL_CATCH_CATCH( capturer ) + +#else // CATCH_CONFIG_FAST_COMPILE + +#define INTERNAL_CATCH_TRY try +#define INTERNAL_CATCH_CATCH( handler ) catch(...) { handler.handleUnexpectedInflightException(); } + +#endif + +#define INTERNAL_CATCH_REACT( handler ) handler.complete(); + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_TEST( macroName, resultDisposition, ... ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, CATCH_INTERNAL_STRINGIFY(__VA_ARGS__), resultDisposition ); \ + INTERNAL_CATCH_TRY { \ + CATCH_INTERNAL_SUPPRESS_PARENTHESES_WARNINGS \ + catchAssertionHandler.handleExpr( Catch::Decomposer() <= __VA_ARGS__ ); \ + CATCH_INTERNAL_UNSUPPRESS_PARENTHESES_WARNINGS \ + } INTERNAL_CATCH_CATCH( catchAssertionHandler ) \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( (void)0, (false) && static_cast( !!(__VA_ARGS__) ) ) // the expression here is never evaluated at runtime but it forces the compiler to give it a look + // The double negation silences MSVC's C4800 warning, the static_cast forces short-circuit evaluation if the type has overloaded &&. + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_IF( macroName, resultDisposition, ... ) \ + INTERNAL_CATCH_TEST( macroName, resultDisposition, __VA_ARGS__ ); \ + if( Catch::getResultCapture().lastAssertionPassed() ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_ELSE( macroName, resultDisposition, ... ) \ + INTERNAL_CATCH_TEST( macroName, resultDisposition, __VA_ARGS__ ); \ + if( !Catch::getResultCapture().lastAssertionPassed() ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_NO_THROW( macroName, resultDisposition, ... ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, CATCH_INTERNAL_STRINGIFY(__VA_ARGS__), resultDisposition ); \ + try { \ + static_cast(__VA_ARGS__); \ + catchAssertionHandler.handleExceptionNotThrownAsExpected(); \ + } \ + catch( ... ) { \ + catchAssertionHandler.handleUnexpectedInflightException(); \ + } \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( false ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_THROWS( macroName, resultDisposition, ... ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, CATCH_INTERNAL_STRINGIFY(__VA_ARGS__), resultDisposition); \ + if( catchAssertionHandler.allowThrows() ) \ + try { \ + static_cast(__VA_ARGS__); \ + catchAssertionHandler.handleUnexpectedExceptionNotThrown(); \ + } \ + catch( ... ) { \ + catchAssertionHandler.handleExceptionThrownAsExpected(); \ + } \ + else \ + catchAssertionHandler.handleThrowingCallSkipped(); \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( false ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_THROWS_AS( macroName, exceptionType, resultDisposition, expr ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, CATCH_INTERNAL_STRINGIFY(expr) ", " CATCH_INTERNAL_STRINGIFY(exceptionType), resultDisposition ); \ + if( catchAssertionHandler.allowThrows() ) \ + try { \ + static_cast(expr); \ + catchAssertionHandler.handleUnexpectedExceptionNotThrown(); \ + } \ + catch( exceptionType const& ) { \ + catchAssertionHandler.handleExceptionThrownAsExpected(); \ + } \ + catch( ... ) { \ + catchAssertionHandler.handleUnexpectedInflightException(); \ + } \ + else \ + catchAssertionHandler.handleThrowingCallSkipped(); \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( false ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_MSG( macroName, messageType, resultDisposition, ... ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, Catch::StringRef(), resultDisposition ); \ + catchAssertionHandler.handleMessage( messageType, ( Catch::MessageStream() << __VA_ARGS__ + ::Catch::StreamEndStop() ).m_stream.str() ); \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( false ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_CAPTURE( varName, macroName, ... ) \ + auto varName = Catch::Capturer( macroName, CATCH_INTERNAL_LINEINFO, Catch::ResultWas::Info, #__VA_ARGS__ ); \ + varName.captureValues( 0, __VA_ARGS__ ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_INFO( macroName, log ) \ + Catch::ScopedMessage INTERNAL_CATCH_UNIQUE_NAME( scopedMessage )( Catch::MessageBuilder( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, Catch::ResultWas::Info ) << log ); + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_UNSCOPED_INFO( macroName, log ) \ + Catch::getResultCapture().emplaceUnscopedMessage( Catch::MessageBuilder( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, Catch::ResultWas::Info ) << log ) + +/////////////////////////////////////////////////////////////////////////////// +// Although this is matcher-based, it can be used with just a string +#define INTERNAL_CATCH_THROWS_STR_MATCHES( macroName, resultDisposition, matcher, ... ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, CATCH_INTERNAL_STRINGIFY(__VA_ARGS__) ", " CATCH_INTERNAL_STRINGIFY(matcher), resultDisposition ); \ + if( catchAssertionHandler.allowThrows() ) \ + try { \ + static_cast(__VA_ARGS__); \ + catchAssertionHandler.handleUnexpectedExceptionNotThrown(); \ + } \ + catch( ... ) { \ + Catch::handleExceptionMatchExpr( catchAssertionHandler, matcher, #matcher##_catch_sr ); \ + } \ + else \ + catchAssertionHandler.handleThrowingCallSkipped(); \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( false ) + +#endif // CATCH_CONFIG_DISABLE + +// end catch_capture.hpp +// start catch_section.h + +// start catch_section_info.h + +// start catch_totals.h + +#include + +namespace Catch { + + struct Counts { + Counts operator - ( Counts const& other ) const; + Counts& operator += ( Counts const& other ); + + std::size_t total() const; + bool allPassed() const; + bool allOk() const; + + std::size_t passed = 0; + std::size_t failed = 0; + std::size_t failedButOk = 0; + }; + + struct Totals { + + Totals operator - ( Totals const& other ) const; + Totals& operator += ( Totals const& other ); + + Totals delta( Totals const& prevTotals ) const; + + int error = 0; + Counts assertions; + Counts testCases; + }; +} + +// end catch_totals.h +#include + +namespace Catch { + + struct SectionInfo { + SectionInfo + ( SourceLineInfo const& _lineInfo, + std::string const& _name ); + + // Deprecated + SectionInfo + ( SourceLineInfo const& _lineInfo, + std::string const& _name, + std::string const& ) : SectionInfo( _lineInfo, _name ) {} + + std::string name; + std::string description; // !Deprecated: this will always be empty + SourceLineInfo lineInfo; + }; + + struct SectionEndInfo { + SectionInfo sectionInfo; + Counts prevAssertions; + double durationInSeconds; + }; + +} // end namespace Catch + +// end catch_section_info.h +// start catch_timer.h + +#include + +namespace Catch { + + auto getCurrentNanosecondsSinceEpoch() -> uint64_t; + auto getEstimatedClockResolution() -> uint64_t; + + class Timer { + uint64_t m_nanoseconds = 0; + public: + void start(); + auto getElapsedNanoseconds() const -> uint64_t; + auto getElapsedMicroseconds() const -> uint64_t; + auto getElapsedMilliseconds() const -> unsigned int; + auto getElapsedSeconds() const -> double; + }; + +} // namespace Catch + +// end catch_timer.h +#include + +namespace Catch { + + class Section : NonCopyable { + public: + Section( SectionInfo const& info ); + ~Section(); + + // This indicates whether the section should be executed or not + explicit operator bool() const; + + private: + SectionInfo m_info; + + std::string m_name; + Counts m_assertions; + bool m_sectionIncluded; + Timer m_timer; + }; + +} // end namespace Catch + +#define INTERNAL_CATCH_SECTION( ... ) \ + CATCH_INTERNAL_SUPPRESS_UNUSED_WARNINGS \ + if( Catch::Section const& INTERNAL_CATCH_UNIQUE_NAME( catch_internal_Section ) = Catch::SectionInfo( CATCH_INTERNAL_LINEINFO, __VA_ARGS__ ) ) \ + CATCH_INTERNAL_UNSUPPRESS_UNUSED_WARNINGS + +#define INTERNAL_CATCH_DYNAMIC_SECTION( ... ) \ + CATCH_INTERNAL_SUPPRESS_UNUSED_WARNINGS \ + if( Catch::Section const& INTERNAL_CATCH_UNIQUE_NAME( catch_internal_Section ) = Catch::SectionInfo( CATCH_INTERNAL_LINEINFO, (Catch::ReusableStringStream() << __VA_ARGS__).str() ) ) \ + CATCH_INTERNAL_UNSUPPRESS_UNUSED_WARNINGS + +// end catch_section.h +// start catch_benchmark.h + +#include +#include + +namespace Catch { + + class BenchmarkLooper { + + std::string m_name; + std::size_t m_count = 0; + std::size_t m_iterationsToRun = 1; + uint64_t m_resolution; + Timer m_timer; + + static auto getResolution() -> uint64_t; + public: + // Keep most of this inline as it's on the code path that is being timed + BenchmarkLooper( StringRef name ) + : m_name( name ), + m_resolution( getResolution() ) + { + reportStart(); + m_timer.start(); + } + + explicit operator bool() { + if( m_count < m_iterationsToRun ) + return true; + return needsMoreIterations(); + } + + void increment() { + ++m_count; + } + + void reportStart(); + auto needsMoreIterations() -> bool; + }; + +} // end namespace Catch + +#define BENCHMARK( name ) \ + for( Catch::BenchmarkLooper looper( name ); looper; looper.increment() ) + +// end catch_benchmark.h +// start catch_interfaces_exception.h + +// start catch_interfaces_registry_hub.h + +#include +#include + +namespace Catch { + + class TestCase; + struct ITestCaseRegistry; + struct IExceptionTranslatorRegistry; + struct IExceptionTranslator; + struct IReporterRegistry; + struct IReporterFactory; + struct ITagAliasRegistry; + class StartupExceptionRegistry; + + using IReporterFactoryPtr = std::shared_ptr; + + struct IRegistryHub { + virtual ~IRegistryHub(); + + virtual IReporterRegistry const& getReporterRegistry() const = 0; + virtual ITestCaseRegistry const& getTestCaseRegistry() const = 0; + virtual ITagAliasRegistry const& getTagAliasRegistry() const = 0; + + virtual IExceptionTranslatorRegistry const& getExceptionTranslatorRegistry() const = 0; + + virtual StartupExceptionRegistry const& getStartupExceptionRegistry() const = 0; + }; + + struct IMutableRegistryHub { + virtual ~IMutableRegistryHub(); + virtual void registerReporter( std::string const& name, IReporterFactoryPtr const& factory ) = 0; + virtual void registerListener( IReporterFactoryPtr const& factory ) = 0; + virtual void registerTest( TestCase const& testInfo ) = 0; + virtual void registerTranslator( const IExceptionTranslator* translator ) = 0; + virtual void registerTagAlias( std::string const& alias, std::string const& tag, SourceLineInfo const& lineInfo ) = 0; + virtual void registerStartupException() noexcept = 0; + }; + + IRegistryHub const& getRegistryHub(); + IMutableRegistryHub& getMutableRegistryHub(); + void cleanUp(); + std::string translateActiveException(); + +} + +// end catch_interfaces_registry_hub.h +#if defined(CATCH_CONFIG_DISABLE) + #define INTERNAL_CATCH_TRANSLATE_EXCEPTION_NO_REG( translatorName, signature) \ + static std::string translatorName( signature ) +#endif + +#include +#include +#include + +namespace Catch { + using exceptionTranslateFunction = std::string(*)(); + + struct IExceptionTranslator; + using ExceptionTranslators = std::vector>; + + struct IExceptionTranslator { + virtual ~IExceptionTranslator(); + virtual std::string translate( ExceptionTranslators::const_iterator it, ExceptionTranslators::const_iterator itEnd ) const = 0; + }; + + struct IExceptionTranslatorRegistry { + virtual ~IExceptionTranslatorRegistry(); + + virtual std::string translateActiveException() const = 0; + }; + + class ExceptionTranslatorRegistrar { + template + class ExceptionTranslator : public IExceptionTranslator { + public: + + ExceptionTranslator( std::string(*translateFunction)( T& ) ) + : m_translateFunction( translateFunction ) + {} + + std::string translate( ExceptionTranslators::const_iterator it, ExceptionTranslators::const_iterator itEnd ) const override { + try { + if( it == itEnd ) + std::rethrow_exception(std::current_exception()); + else + return (*it)->translate( it+1, itEnd ); + } + catch( T& ex ) { + return m_translateFunction( ex ); + } + } + + protected: + std::string(*m_translateFunction)( T& ); + }; + + public: + template + ExceptionTranslatorRegistrar( std::string(*translateFunction)( T& ) ) { + getMutableRegistryHub().registerTranslator + ( new ExceptionTranslator( translateFunction ) ); + } + }; +} + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_TRANSLATE_EXCEPTION2( translatorName, signature ) \ + static std::string translatorName( signature ); \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ Catch::ExceptionTranslatorRegistrar INTERNAL_CATCH_UNIQUE_NAME( catch_internal_ExceptionRegistrar )( &translatorName ); } \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS \ + static std::string translatorName( signature ) + +#define INTERNAL_CATCH_TRANSLATE_EXCEPTION( signature ) INTERNAL_CATCH_TRANSLATE_EXCEPTION2( INTERNAL_CATCH_UNIQUE_NAME( catch_internal_ExceptionTranslator ), signature ) + +// end catch_interfaces_exception.h +// start catch_approx.h + +#include + +namespace Catch { +namespace Detail { + + class Approx { + private: + bool equalityComparisonImpl(double other) const; + // Validates the new margin (margin >= 0) + // out-of-line to avoid including stdexcept in the header + void setMargin(double margin); + // Validates the new epsilon (0 < epsilon < 1) + // out-of-line to avoid including stdexcept in the header + void setEpsilon(double epsilon); + + public: + explicit Approx ( double value ); + + static Approx custom(); + + Approx operator-() const; + + template ::value>::type> + Approx operator()( T const& value ) { + Approx approx( static_cast(value) ); + approx.m_epsilon = m_epsilon; + approx.m_margin = m_margin; + approx.m_scale = m_scale; + return approx; + } + + template ::value>::type> + explicit Approx( T const& value ): Approx(static_cast(value)) + {} + + template ::value>::type> + friend bool operator == ( const T& lhs, Approx const& rhs ) { + auto lhs_v = static_cast(lhs); + return rhs.equalityComparisonImpl(lhs_v); + } + + template ::value>::type> + friend bool operator == ( Approx const& lhs, const T& rhs ) { + return operator==( rhs, lhs ); + } + + template ::value>::type> + friend bool operator != ( T const& lhs, Approx const& rhs ) { + return !operator==( lhs, rhs ); + } + + template ::value>::type> + friend bool operator != ( Approx const& lhs, T const& rhs ) { + return !operator==( rhs, lhs ); + } + + template ::value>::type> + friend bool operator <= ( T const& lhs, Approx const& rhs ) { + return static_cast(lhs) < rhs.m_value || lhs == rhs; + } + + template ::value>::type> + friend bool operator <= ( Approx const& lhs, T const& rhs ) { + return lhs.m_value < static_cast(rhs) || lhs == rhs; + } + + template ::value>::type> + friend bool operator >= ( T const& lhs, Approx const& rhs ) { + return static_cast(lhs) > rhs.m_value || lhs == rhs; + } + + template ::value>::type> + friend bool operator >= ( Approx const& lhs, T const& rhs ) { + return lhs.m_value > static_cast(rhs) || lhs == rhs; + } + + template ::value>::type> + Approx& epsilon( T const& newEpsilon ) { + double epsilonAsDouble = static_cast(newEpsilon); + setEpsilon(epsilonAsDouble); + return *this; + } + + template ::value>::type> + Approx& margin( T const& newMargin ) { + double marginAsDouble = static_cast(newMargin); + setMargin(marginAsDouble); + return *this; + } + + template ::value>::type> + Approx& scale( T const& newScale ) { + m_scale = static_cast(newScale); + return *this; + } + + std::string toString() const; + + private: + double m_epsilon; + double m_margin; + double m_scale; + double m_value; + }; +} // end namespace Detail + +namespace literals { + Detail::Approx operator "" _a(long double val); + Detail::Approx operator "" _a(unsigned long long val); +} // end namespace literals + +template<> +struct StringMaker { + static std::string convert(Catch::Detail::Approx const& value); +}; + +} // end namespace Catch + +// end catch_approx.h +// start catch_string_manip.h + +#include +#include + +namespace Catch { + + bool startsWith( std::string const& s, std::string const& prefix ); + bool startsWith( std::string const& s, char prefix ); + bool endsWith( std::string const& s, std::string const& suffix ); + bool endsWith( std::string const& s, char suffix ); + bool contains( std::string const& s, std::string const& infix ); + void toLowerInPlace( std::string& s ); + std::string toLower( std::string const& s ); + std::string trim( std::string const& str ); + bool replaceInPlace( std::string& str, std::string const& replaceThis, std::string const& withThis ); + + struct pluralise { + pluralise( std::size_t count, std::string const& label ); + + friend std::ostream& operator << ( std::ostream& os, pluralise const& pluraliser ); + + std::size_t m_count; + std::string m_label; + }; +} + +// end catch_string_manip.h +#ifndef CATCH_CONFIG_DISABLE_MATCHERS +// start catch_capture_matchers.h + +// start catch_matchers.h + +#include +#include + +namespace Catch { +namespace Matchers { + namespace Impl { + + template struct MatchAllOf; + template struct MatchAnyOf; + template struct MatchNotOf; + + class MatcherUntypedBase { + public: + MatcherUntypedBase() = default; + MatcherUntypedBase ( MatcherUntypedBase const& ) = default; + MatcherUntypedBase& operator = ( MatcherUntypedBase const& ) = delete; + std::string toString() const; + + protected: + virtual ~MatcherUntypedBase(); + virtual std::string describe() const = 0; + mutable std::string m_cachedToString; + }; + +#ifdef __clang__ +# pragma clang diagnostic push +# pragma clang diagnostic ignored "-Wnon-virtual-dtor" +#endif + + template + struct MatcherMethod { + virtual bool match( ObjectT const& arg ) const = 0; + }; + +#ifdef __clang__ +# pragma clang diagnostic pop +#endif + + template + struct MatcherBase : MatcherUntypedBase, MatcherMethod { + + MatchAllOf operator && ( MatcherBase const& other ) const; + MatchAnyOf operator || ( MatcherBase const& other ) const; + MatchNotOf operator ! () const; + }; + + template + struct MatchAllOf : MatcherBase { + bool match( ArgT const& arg ) const override { + for( auto matcher : m_matchers ) { + if (!matcher->match(arg)) + return false; + } + return true; + } + std::string describe() const override { + std::string description; + description.reserve( 4 + m_matchers.size()*32 ); + description += "( "; + bool first = true; + for( auto matcher : m_matchers ) { + if( first ) + first = false; + else + description += " and "; + description += matcher->toString(); + } + description += " )"; + return description; + } + + MatchAllOf& operator && ( MatcherBase const& other ) { + m_matchers.push_back( &other ); + return *this; + } + + std::vector const*> m_matchers; + }; + template + struct MatchAnyOf : MatcherBase { + + bool match( ArgT const& arg ) const override { + for( auto matcher : m_matchers ) { + if (matcher->match(arg)) + return true; + } + return false; + } + std::string describe() const override { + std::string description; + description.reserve( 4 + m_matchers.size()*32 ); + description += "( "; + bool first = true; + for( auto matcher : m_matchers ) { + if( first ) + first = false; + else + description += " or "; + description += matcher->toString(); + } + description += " )"; + return description; + } + + MatchAnyOf& operator || ( MatcherBase const& other ) { + m_matchers.push_back( &other ); + return *this; + } + + std::vector const*> m_matchers; + }; + + template + struct MatchNotOf : MatcherBase { + + MatchNotOf( MatcherBase const& underlyingMatcher ) : m_underlyingMatcher( underlyingMatcher ) {} + + bool match( ArgT const& arg ) const override { + return !m_underlyingMatcher.match( arg ); + } + + std::string describe() const override { + return "not " + m_underlyingMatcher.toString(); + } + MatcherBase const& m_underlyingMatcher; + }; + + template + MatchAllOf MatcherBase::operator && ( MatcherBase const& other ) const { + return MatchAllOf() && *this && other; + } + template + MatchAnyOf MatcherBase::operator || ( MatcherBase const& other ) const { + return MatchAnyOf() || *this || other; + } + template + MatchNotOf MatcherBase::operator ! () const { + return MatchNotOf( *this ); + } + + } // namespace Impl + +} // namespace Matchers + +using namespace Matchers; +using Matchers::Impl::MatcherBase; + +} // namespace Catch + +// end catch_matchers.h +// start catch_matchers_floating.h + +#include +#include + +namespace Catch { +namespace Matchers { + + namespace Floating { + + enum class FloatingPointKind : uint8_t; + + struct WithinAbsMatcher : MatcherBase { + WithinAbsMatcher(double target, double margin); + bool match(double const& matchee) const override; + std::string describe() const override; + private: + double m_target; + double m_margin; + }; + + struct WithinUlpsMatcher : MatcherBase { + WithinUlpsMatcher(double target, int ulps, FloatingPointKind baseType); + bool match(double const& matchee) const override; + std::string describe() const override; + private: + double m_target; + int m_ulps; + FloatingPointKind m_type; + }; + + } // namespace Floating + + // The following functions create the actual matcher objects. + // This allows the types to be inferred + Floating::WithinUlpsMatcher WithinULP(double target, int maxUlpDiff); + Floating::WithinUlpsMatcher WithinULP(float target, int maxUlpDiff); + Floating::WithinAbsMatcher WithinAbs(double target, double margin); + +} // namespace Matchers +} // namespace Catch + +// end catch_matchers_floating.h +// start catch_matchers_generic.hpp + +#include +#include + +namespace Catch { +namespace Matchers { +namespace Generic { + +namespace Detail { + std::string finalizeDescription(const std::string& desc); +} + +template +class PredicateMatcher : public MatcherBase { + std::function m_predicate; + std::string m_description; +public: + + PredicateMatcher(std::function const& elem, std::string const& descr) + :m_predicate(std::move(elem)), + m_description(Detail::finalizeDescription(descr)) + {} + + bool match( T const& item ) const override { + return m_predicate(item); + } + + std::string describe() const override { + return m_description; + } +}; + +} // namespace Generic + + // The following functions create the actual matcher objects. + // The user has to explicitly specify type to the function, because + // infering std::function is hard (but possible) and + // requires a lot of TMP. + template + Generic::PredicateMatcher Predicate(std::function const& predicate, std::string const& description = "") { + return Generic::PredicateMatcher(predicate, description); + } + +} // namespace Matchers +} // namespace Catch + +// end catch_matchers_generic.hpp +// start catch_matchers_string.h + +#include + +namespace Catch { +namespace Matchers { + + namespace StdString { + + struct CasedString + { + CasedString( std::string const& str, CaseSensitive::Choice caseSensitivity ); + std::string adjustString( std::string const& str ) const; + std::string caseSensitivitySuffix() const; + + CaseSensitive::Choice m_caseSensitivity; + std::string m_str; + }; + + struct StringMatcherBase : MatcherBase { + StringMatcherBase( std::string const& operation, CasedString const& comparator ); + std::string describe() const override; + + CasedString m_comparator; + std::string m_operation; + }; + + struct EqualsMatcher : StringMatcherBase { + EqualsMatcher( CasedString const& comparator ); + bool match( std::string const& source ) const override; + }; + struct ContainsMatcher : StringMatcherBase { + ContainsMatcher( CasedString const& comparator ); + bool match( std::string const& source ) const override; + }; + struct StartsWithMatcher : StringMatcherBase { + StartsWithMatcher( CasedString const& comparator ); + bool match( std::string const& source ) const override; + }; + struct EndsWithMatcher : StringMatcherBase { + EndsWithMatcher( CasedString const& comparator ); + bool match( std::string const& source ) const override; + }; + + struct RegexMatcher : MatcherBase { + RegexMatcher( std::string regex, CaseSensitive::Choice caseSensitivity ); + bool match( std::string const& matchee ) const override; + std::string describe() const override; + + private: + std::string m_regex; + CaseSensitive::Choice m_caseSensitivity; + }; + + } // namespace StdString + + // The following functions create the actual matcher objects. + // This allows the types to be inferred + + StdString::EqualsMatcher Equals( std::string const& str, CaseSensitive::Choice caseSensitivity = CaseSensitive::Yes ); + StdString::ContainsMatcher Contains( std::string const& str, CaseSensitive::Choice caseSensitivity = CaseSensitive::Yes ); + StdString::EndsWithMatcher EndsWith( std::string const& str, CaseSensitive::Choice caseSensitivity = CaseSensitive::Yes ); + StdString::StartsWithMatcher StartsWith( std::string const& str, CaseSensitive::Choice caseSensitivity = CaseSensitive::Yes ); + StdString::RegexMatcher Matches( std::string const& regex, CaseSensitive::Choice caseSensitivity = CaseSensitive::Yes ); + +} // namespace Matchers +} // namespace Catch + +// end catch_matchers_string.h +// start catch_matchers_vector.h + +#include + +namespace Catch { +namespace Matchers { + + namespace Vector { + namespace Detail { + template + size_t count(InputIterator first, InputIterator last, T const& item) { + size_t cnt = 0; + for (; first != last; ++first) { + if (*first == item) { + ++cnt; + } + } + return cnt; + } + template + bool contains(InputIterator first, InputIterator last, T const& item) { + for (; first != last; ++first) { + if (*first == item) { + return true; + } + } + return false; + } + } + + template + struct ContainsElementMatcher : MatcherBase> { + + ContainsElementMatcher(T const &comparator) : m_comparator( comparator) {} + + bool match(std::vector const &v) const override { + for (auto const& el : v) { + if (el == m_comparator) { + return true; + } + } + return false; + } + + std::string describe() const override { + return "Contains: " + ::Catch::Detail::stringify( m_comparator ); + } + + T const& m_comparator; + }; + + template + struct ContainsMatcher : MatcherBase> { + + ContainsMatcher(std::vector const &comparator) : m_comparator( comparator ) {} + + bool match(std::vector const &v) const override { + // !TBD: see note in EqualsMatcher + if (m_comparator.size() > v.size()) + return false; + for (auto const& comparator : m_comparator) { + auto present = false; + for (const auto& el : v) { + if (el == comparator) { + present = true; + break; + } + } + if (!present) { + return false; + } + } + return true; + } + std::string describe() const override { + return "Contains: " + ::Catch::Detail::stringify( m_comparator ); + } + + std::vector const& m_comparator; + }; + + template + struct EqualsMatcher : MatcherBase> { + + EqualsMatcher(std::vector const &comparator) : m_comparator( comparator ) {} + + bool match(std::vector const &v) const override { + // !TBD: This currently works if all elements can be compared using != + // - a more general approach would be via a compare template that defaults + // to using !=. but could be specialised for, e.g. std::vector etc + // - then just call that directly + if (m_comparator.size() != v.size()) + return false; + for (std::size_t i = 0; i < v.size(); ++i) + if (m_comparator[i] != v[i]) + return false; + return true; + } + std::string describe() const override { + return "Equals: " + ::Catch::Detail::stringify( m_comparator ); + } + std::vector const& m_comparator; + }; + + template + struct UnorderedEqualsMatcher : MatcherBase> { + UnorderedEqualsMatcher(std::vector const& target) : m_target(target) {} + bool match(std::vector const& vec) const override { + // Note: This is a reimplementation of std::is_permutation, + // because I don't want to include inside the common path + if (m_target.size() != vec.size()) { + return false; + } + auto lfirst = m_target.begin(), llast = m_target.end(); + auto rfirst = vec.begin(), rlast = vec.end(); + // Cut common prefix to optimize checking of permuted parts + while (lfirst != llast && *lfirst == *rfirst) { + ++lfirst; ++rfirst; + } + if (lfirst == llast) { + return true; + } + + for (auto mid = lfirst; mid != llast; ++mid) { + // Skip already counted items + if (Detail::contains(lfirst, mid, *mid)) { + continue; + } + size_t num_vec = Detail::count(rfirst, rlast, *mid); + if (num_vec == 0 || Detail::count(lfirst, llast, *mid) != num_vec) { + return false; + } + } + + return true; + } + + std::string describe() const override { + return "UnorderedEquals: " + ::Catch::Detail::stringify(m_target); + } + private: + std::vector const& m_target; + }; + + } // namespace Vector + + // The following functions create the actual matcher objects. + // This allows the types to be inferred + + template + Vector::ContainsMatcher Contains( std::vector const& comparator ) { + return Vector::ContainsMatcher( comparator ); + } + + template + Vector::ContainsElementMatcher VectorContains( T const& comparator ) { + return Vector::ContainsElementMatcher( comparator ); + } + + template + Vector::EqualsMatcher Equals( std::vector const& comparator ) { + return Vector::EqualsMatcher( comparator ); + } + + template + Vector::UnorderedEqualsMatcher UnorderedEquals(std::vector const& target) { + return Vector::UnorderedEqualsMatcher(target); + } + +} // namespace Matchers +} // namespace Catch + +// end catch_matchers_vector.h +namespace Catch { + + template + class MatchExpr : public ITransientExpression { + ArgT const& m_arg; + MatcherT m_matcher; + StringRef m_matcherString; + public: + MatchExpr( ArgT const& arg, MatcherT const& matcher, StringRef const& matcherString ) + : ITransientExpression{ true, matcher.match( arg ) }, + m_arg( arg ), + m_matcher( matcher ), + m_matcherString( matcherString ) + {} + + void streamReconstructedExpression( std::ostream &os ) const override { + auto matcherAsString = m_matcher.toString(); + os << Catch::Detail::stringify( m_arg ) << ' '; + if( matcherAsString == Detail::unprintableString ) + os << m_matcherString; + else + os << matcherAsString; + } + }; + + using StringMatcher = Matchers::Impl::MatcherBase; + + void handleExceptionMatchExpr( AssertionHandler& handler, StringMatcher const& matcher, StringRef const& matcherString ); + + template + auto makeMatchExpr( ArgT const& arg, MatcherT const& matcher, StringRef const& matcherString ) -> MatchExpr { + return MatchExpr( arg, matcher, matcherString ); + } + +} // namespace Catch + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CHECK_THAT( macroName, matcher, resultDisposition, arg ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, CATCH_INTERNAL_STRINGIFY(arg) ", " CATCH_INTERNAL_STRINGIFY(matcher), resultDisposition ); \ + INTERNAL_CATCH_TRY { \ + catchAssertionHandler.handleExpr( Catch::makeMatchExpr( arg, matcher, #matcher##_catch_sr ) ); \ + } INTERNAL_CATCH_CATCH( catchAssertionHandler ) \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( false ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_THROWS_MATCHES( macroName, exceptionType, resultDisposition, matcher, ... ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, CATCH_INTERNAL_STRINGIFY(__VA_ARGS__) ", " CATCH_INTERNAL_STRINGIFY(exceptionType) ", " CATCH_INTERNAL_STRINGIFY(matcher), resultDisposition ); \ + if( catchAssertionHandler.allowThrows() ) \ + try { \ + static_cast(__VA_ARGS__ ); \ + catchAssertionHandler.handleUnexpectedExceptionNotThrown(); \ + } \ + catch( exceptionType const& ex ) { \ + catchAssertionHandler.handleExpr( Catch::makeMatchExpr( ex, matcher, #matcher##_catch_sr ) ); \ + } \ + catch( ... ) { \ + catchAssertionHandler.handleUnexpectedInflightException(); \ + } \ + else \ + catchAssertionHandler.handleThrowingCallSkipped(); \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( false ) + +// end catch_capture_matchers.h +#endif +// start catch_generators.hpp + +// start catch_interfaces_generatortracker.h + + +#include + +namespace Catch { + + namespace Generators { + class GeneratorUntypedBase { + public: + GeneratorUntypedBase() = default; + virtual ~GeneratorUntypedBase(); + // Attempts to move the generator to the next element + // + // Returns true iff the move succeeded (and a valid element + // can be retrieved). + virtual bool next() = 0; + }; + using GeneratorBasePtr = std::unique_ptr; + + } // namespace Generators + + struct IGeneratorTracker { + virtual ~IGeneratorTracker(); + virtual auto hasGenerator() const -> bool = 0; + virtual auto getGenerator() const -> Generators::GeneratorBasePtr const& = 0; + virtual void setGenerator( Generators::GeneratorBasePtr&& generator ) = 0; + }; + +} // namespace Catch + +// end catch_interfaces_generatortracker.h +// start catch_enforce.h + +#include + +namespace Catch { +#if !defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) + template + [[noreturn]] + void throw_exception(Ex const& e) { + throw e; + } +#else // ^^ Exceptions are enabled // Exceptions are disabled vv + [[noreturn]] + void throw_exception(std::exception const& e); +#endif +} // namespace Catch; + +#define CATCH_PREPARE_EXCEPTION( type, msg ) \ + type( ( Catch::ReusableStringStream() << msg ).str() ) +#define CATCH_INTERNAL_ERROR( msg ) \ + Catch::throw_exception(CATCH_PREPARE_EXCEPTION( std::logic_error, CATCH_INTERNAL_LINEINFO << ": Internal Catch error: " << msg)) +#define CATCH_ERROR( msg ) \ + Catch::throw_exception(CATCH_PREPARE_EXCEPTION( std::domain_error, msg )) +#define CATCH_RUNTIME_ERROR( msg ) \ + Catch::throw_exception(CATCH_PREPARE_EXCEPTION( std::runtime_error, msg )) +#define CATCH_ENFORCE( condition, msg ) \ + do{ if( !(condition) ) CATCH_ERROR( msg ); } while(false) + +// end catch_enforce.h +#include +#include +#include + +#include +#include + +namespace Catch { + +class GeneratorException : public std::exception { + const char* const m_msg = ""; + +public: + GeneratorException(const char* msg): + m_msg(msg) + {} + + const char* what() const noexcept override final; +}; + +namespace Generators { + + // !TBD move this into its own location? + namespace pf{ + template + std::unique_ptr make_unique( Args&&... args ) { + return std::unique_ptr(new T(std::forward(args)...)); + } + } + + template + struct IGenerator : GeneratorUntypedBase { + virtual ~IGenerator() = default; + + // Returns the current element of the generator + // + // \Precondition The generator is either freshly constructed, + // or the last call to `next()` returned true + virtual T const& get() const = 0; + using type = T; + }; + + template + class SingleValueGenerator final : public IGenerator { + T m_value; + public: + SingleValueGenerator(T const& value) : m_value( value ) {} + SingleValueGenerator(T&& value) : m_value(std::move(value)) {} + + T const& get() const override { + return m_value; + } + bool next() override { + return false; + } + }; + + template + class FixedValuesGenerator final : public IGenerator { + std::vector m_values; + size_t m_idx = 0; + public: + FixedValuesGenerator( std::initializer_list values ) : m_values( values ) {} + + T const& get() const override { + return m_values[m_idx]; + } + bool next() override { + ++m_idx; + return m_idx < m_values.size(); + } + }; + + template + class GeneratorWrapper final { + std::unique_ptr> m_generator; + public: + GeneratorWrapper(std::unique_ptr> generator): + m_generator(std::move(generator)) + {} + T const& get() const { + return m_generator->get(); + } + bool next() { + return m_generator->next(); + } + }; + + template + GeneratorWrapper value(T&& value) { + return GeneratorWrapper(pf::make_unique>(std::forward(value))); + } + template + GeneratorWrapper values(std::initializer_list values) { + return GeneratorWrapper(pf::make_unique>(values)); + } + + template + class Generators : public IGenerator { + std::vector> m_generators; + size_t m_current = 0; + + void populate(GeneratorWrapper&& generator) { + m_generators.emplace_back(std::move(generator)); + } + void populate(T&& val) { + m_generators.emplace_back(value(std::move(val))); + } + template + void populate(U&& val) { + populate(T(std::move(val))); + } + template + void populate(U&& valueOrGenerator, Gs... moreGenerators) { + populate(std::forward(valueOrGenerator)); + populate(std::forward(moreGenerators)...); + } + + public: + template + Generators(Gs... moreGenerators) { + m_generators.reserve(sizeof...(Gs)); + populate(std::forward(moreGenerators)...); + } + + T const& get() const override { + return m_generators[m_current].get(); + } + + bool next() override { + if (m_current >= m_generators.size()) { + return false; + } + const bool current_status = m_generators[m_current].next(); + if (!current_status) { + ++m_current; + } + return m_current < m_generators.size(); + } + }; + + template + GeneratorWrapper> table( std::initializer_list::type...>> tuples ) { + return values>( tuples ); + } + + // Tag type to signal that a generator sequence should convert arguments to a specific type + template + struct as {}; + + template + auto makeGenerators( GeneratorWrapper&& generator, Gs... moreGenerators ) -> Generators { + return Generators(std::move(generator), std::forward(moreGenerators)...); + } + template + auto makeGenerators( GeneratorWrapper&& generator ) -> Generators { + return Generators(std::move(generator)); + } + template + auto makeGenerators( T&& val, Gs... moreGenerators ) -> Generators { + return makeGenerators( value( std::forward( val ) ), std::forward( moreGenerators )... ); + } + template + auto makeGenerators( as, U&& val, Gs... moreGenerators ) -> Generators { + return makeGenerators( value( T( std::forward( val ) ) ), std::forward( moreGenerators )... ); + } + + auto acquireGeneratorTracker( SourceLineInfo const& lineInfo ) -> IGeneratorTracker&; + + template + // Note: The type after -> is weird, because VS2015 cannot parse + // the expression used in the typedef inside, when it is in + // return type. Yeah. + auto generate( SourceLineInfo const& lineInfo, L const& generatorExpression ) -> decltype(std::declval().get()) { + using UnderlyingType = typename decltype(generatorExpression())::type; + + IGeneratorTracker& tracker = acquireGeneratorTracker( lineInfo ); + if (!tracker.hasGenerator()) { + tracker.setGenerator(pf::make_unique>(generatorExpression())); + } + + auto const& generator = static_cast const&>( *tracker.getGenerator() ); + return generator.get(); + } + +} // namespace Generators +} // namespace Catch + +#define GENERATE( ... ) \ + Catch::Generators::generate( CATCH_INTERNAL_LINEINFO, []{ using namespace Catch::Generators; return makeGenerators( __VA_ARGS__ ); } ) + +// end catch_generators.hpp +// start catch_generators_generic.hpp + +namespace Catch { +namespace Generators { + + template + class TakeGenerator : public IGenerator { + GeneratorWrapper m_generator; + size_t m_returned = 0; + size_t m_target; + public: + TakeGenerator(size_t target, GeneratorWrapper&& generator): + m_generator(std::move(generator)), + m_target(target) + { + assert(target != 0 && "Empty generators are not allowed"); + } + T const& get() const override { + return m_generator.get(); + } + bool next() override { + ++m_returned; + if (m_returned >= m_target) { + return false; + } + + const auto success = m_generator.next(); + // If the underlying generator does not contain enough values + // then we cut short as well + if (!success) { + m_returned = m_target; + } + return success; + } + }; + + template + GeneratorWrapper take(size_t target, GeneratorWrapper&& generator) { + return GeneratorWrapper(pf::make_unique>(target, std::move(generator))); + } + + template + class FilterGenerator : public IGenerator { + GeneratorWrapper m_generator; + Predicate m_predicate; + public: + template + FilterGenerator(P&& pred, GeneratorWrapper&& generator): + m_generator(std::move(generator)), + m_predicate(std::forward

(pred)) + { + if (!m_predicate(m_generator.get())) { + // It might happen that there are no values that pass the + // filter. In that case we throw an exception. + auto has_initial_value = next(); + if (!has_initial_value) { + Catch::throw_exception(GeneratorException("No valid value found in filtered generator")); + } + } + } + + T const& get() const override { + return m_generator.get(); + } + + bool next() override { + bool success = m_generator.next(); + if (!success) { + return false; + } + while (!m_predicate(m_generator.get()) && (success = m_generator.next()) == true); + return success; + } + }; + + template + GeneratorWrapper filter(Predicate&& pred, GeneratorWrapper&& generator) { + return GeneratorWrapper(std::unique_ptr>(pf::make_unique>(std::forward(pred), std::move(generator)))); + } + + template + class RepeatGenerator : public IGenerator { + GeneratorWrapper m_generator; + mutable std::vector m_returned; + size_t m_target_repeats; + size_t m_current_repeat = 0; + size_t m_repeat_index = 0; + public: + RepeatGenerator(size_t repeats, GeneratorWrapper&& generator): + m_generator(std::move(generator)), + m_target_repeats(repeats) + { + assert(m_target_repeats > 0 && "Repeat generator must repeat at least once"); + } + + T const& get() const override { + if (m_current_repeat == 0) { + m_returned.push_back(m_generator.get()); + return m_returned.back(); + } + return m_returned[m_repeat_index]; + } + + bool next() override { + // There are 2 basic cases: + // 1) We are still reading the generator + // 2) We are reading our own cache + + // In the first case, we need to poke the underlying generator. + // If it happily moves, we are left in that state, otherwise it is time to start reading from our cache + if (m_current_repeat == 0) { + const auto success = m_generator.next(); + if (!success) { + ++m_current_repeat; + } + return m_current_repeat < m_target_repeats; + } + + // In the second case, we need to move indices forward and check that we haven't run up against the end + ++m_repeat_index; + if (m_repeat_index == m_returned.size()) { + m_repeat_index = 0; + ++m_current_repeat; + } + return m_current_repeat < m_target_repeats; + } + }; + + template + GeneratorWrapper repeat(size_t repeats, GeneratorWrapper&& generator) { + return GeneratorWrapper(pf::make_unique>(repeats, std::move(generator))); + } + + template + class MapGenerator : public IGenerator { + // TBD: provide static assert for mapping function, for friendly error message + GeneratorWrapper m_generator; + Func m_function; + // To avoid returning dangling reference, we have to save the values + T m_cache; + public: + template + MapGenerator(F2&& function, GeneratorWrapper&& generator) : + m_generator(std::move(generator)), + m_function(std::forward(function)), + m_cache(m_function(m_generator.get())) + {} + + T const& get() const override { + return m_cache; + } + bool next() override { + const auto success = m_generator.next(); + if (success) { + m_cache = m_function(m_generator.get()); + } + return success; + } + }; + + template + GeneratorWrapper map(Func&& function, GeneratorWrapper&& generator) { + return GeneratorWrapper( + pf::make_unique>(std::forward(function), std::move(generator)) + ); + } + template + GeneratorWrapper map(Func&& function, GeneratorWrapper&& generator) { + return GeneratorWrapper( + pf::make_unique>(std::forward(function), std::move(generator)) + ); + } + + template + class ChunkGenerator final : public IGenerator> { + std::vector m_chunk; + size_t m_chunk_size; + GeneratorWrapper m_generator; + bool m_used_up = false; + public: + ChunkGenerator(size_t size, GeneratorWrapper generator) : + m_chunk_size(size), m_generator(std::move(generator)) + { + m_chunk.reserve(m_chunk_size); + m_chunk.push_back(m_generator.get()); + for (size_t i = 1; i < m_chunk_size; ++i) { + if (!m_generator.next()) { + Catch::throw_exception(GeneratorException("Not enough values to initialize the first chunk")); + } + m_chunk.push_back(m_generator.get()); + } + } + std::vector const& get() const override { + return m_chunk; + } + bool next() override { + m_chunk.clear(); + for (size_t idx = 0; idx < m_chunk_size; ++idx) { + if (!m_generator.next()) { + return false; + } + m_chunk.push_back(m_generator.get()); + } + return true; + } + }; + + template + GeneratorWrapper> chunk(size_t size, GeneratorWrapper&& generator) { + return GeneratorWrapper>( + pf::make_unique>(size, std::move(generator)) + ); + } + +} // namespace Generators +} // namespace Catch + +// end catch_generators_generic.hpp +// start catch_generators_specific.hpp + +// start catch_context.h + +#include + +namespace Catch { + + struct IResultCapture; + struct IRunner; + struct IConfig; + struct IMutableContext; + + using IConfigPtr = std::shared_ptr; + + struct IContext + { + virtual ~IContext(); + + virtual IResultCapture* getResultCapture() = 0; + virtual IRunner* getRunner() = 0; + virtual IConfigPtr const& getConfig() const = 0; + }; + + struct IMutableContext : IContext + { + virtual ~IMutableContext(); + virtual void setResultCapture( IResultCapture* resultCapture ) = 0; + virtual void setRunner( IRunner* runner ) = 0; + virtual void setConfig( IConfigPtr const& config ) = 0; + + private: + static IMutableContext *currentContext; + friend IMutableContext& getCurrentMutableContext(); + friend void cleanUpContext(); + static void createContext(); + }; + + inline IMutableContext& getCurrentMutableContext() + { + if( !IMutableContext::currentContext ) + IMutableContext::createContext(); + return *IMutableContext::currentContext; + } + + inline IContext& getCurrentContext() + { + return getCurrentMutableContext(); + } + + void cleanUpContext(); +} + +// end catch_context.h +// start catch_interfaces_config.h + +#include +#include +#include +#include + +namespace Catch { + + enum class Verbosity { + Quiet = 0, + Normal, + High + }; + + struct WarnAbout { enum What { + Nothing = 0x00, + NoAssertions = 0x01, + NoTests = 0x02 + }; }; + + struct ShowDurations { enum OrNot { + DefaultForReporter, + Always, + Never + }; }; + struct RunTests { enum InWhatOrder { + InDeclarationOrder, + InLexicographicalOrder, + InRandomOrder + }; }; + struct UseColour { enum YesOrNo { + Auto, + Yes, + No + }; }; + struct WaitForKeypress { enum When { + Never, + BeforeStart = 1, + BeforeExit = 2, + BeforeStartAndExit = BeforeStart | BeforeExit + }; }; + + class TestSpec; + + struct IConfig : NonCopyable { + + virtual ~IConfig(); + + virtual bool allowThrows() const = 0; + virtual std::ostream& stream() const = 0; + virtual std::string name() const = 0; + virtual bool includeSuccessfulResults() const = 0; + virtual bool shouldDebugBreak() const = 0; + virtual bool warnAboutMissingAssertions() const = 0; + virtual bool warnAboutNoTests() const = 0; + virtual int abortAfter() const = 0; + virtual bool showInvisibles() const = 0; + virtual ShowDurations::OrNot showDurations() const = 0; + virtual TestSpec const& testSpec() const = 0; + virtual bool hasTestFilters() const = 0; + virtual RunTests::InWhatOrder runOrder() const = 0; + virtual unsigned int rngSeed() const = 0; + virtual int benchmarkResolutionMultiple() const = 0; + virtual UseColour::YesOrNo useColour() const = 0; + virtual std::vector const& getSectionsToRun() const = 0; + virtual Verbosity verbosity() const = 0; + }; + + using IConfigPtr = std::shared_ptr; +} + +// end catch_interfaces_config.h +#include + +namespace Catch { +namespace Generators { + +template +class RandomFloatingGenerator final : public IGenerator { + // FIXME: What is the right seed? + std::minstd_rand m_rand; + std::uniform_real_distribution m_dist; + Float m_current_number; +public: + + RandomFloatingGenerator(Float a, Float b): + m_rand(getCurrentContext().getConfig()->rngSeed()), + m_dist(a, b) { + static_cast(next()); + } + + Float const& get() const override { + return m_current_number; + } + bool next() override { + m_current_number = m_dist(m_rand); + return true; + } +}; + +template +class RandomIntegerGenerator final : public IGenerator { + std::minstd_rand m_rand; + std::uniform_int_distribution m_dist; + Integer m_current_number; +public: + + RandomIntegerGenerator(Integer a, Integer b): + m_rand(getCurrentContext().getConfig()->rngSeed()), + m_dist(a, b) { + static_cast(next()); + } + + Integer const& get() const override { + return m_current_number; + } + bool next() override { + m_current_number = m_dist(m_rand); + return true; + } +}; + +// TODO: Ideally this would be also constrained against the various char types, +// but I don't expect users to run into that in practice. +template +typename std::enable_if::value && !std::is_same::value, +GeneratorWrapper>::type +random(T a, T b) { + return GeneratorWrapper( + pf::make_unique>(a, b) + ); +} + +template +typename std::enable_if::value, +GeneratorWrapper>::type +random(T a, T b) { + return GeneratorWrapper( + pf::make_unique>(a, b) + ); +} + +template +class RangeGenerator final : public IGenerator { + T m_current; + T m_end; + T m_step; + bool m_positive; + +public: + RangeGenerator(T const& start, T const& end, T const& step): + m_current(start), + m_end(end), + m_step(step), + m_positive(m_step > T(0)) + { + assert(m_current != m_end && "Range start and end cannot be equal"); + assert(m_step != T(0) && "Step size cannot be zero"); + assert(((m_positive && m_current <= m_end) || (!m_positive && m_current >= m_end)) && "Step moves away from end"); + } + + RangeGenerator(T const& start, T const& end): + RangeGenerator(start, end, (start < end) ? T(1) : T(-1)) + {} + + T const& get() const override { + return m_current; + } + + bool next() override { + m_current += m_step; + return (m_positive) ? (m_current < m_end) : (m_current > m_end); + } +}; + +template +GeneratorWrapper range(T const& start, T const& end, T const& step) { + static_assert(std::is_integral::value && !std::is_same::value, "Type must be an integer"); + return GeneratorWrapper(pf::make_unique>(start, end, step)); +} + +template +GeneratorWrapper range(T const& start, T const& end) { + static_assert(std::is_integral::value && !std::is_same::value, "Type must be an integer"); + return GeneratorWrapper(pf::make_unique>(start, end)); +} + +} // namespace Generators +} // namespace Catch + +// end catch_generators_specific.hpp + +// These files are included here so the single_include script doesn't put them +// in the conditionally compiled sections +// start catch_test_case_info.h + +#include +#include +#include + +#ifdef __clang__ +#pragma clang diagnostic push +#pragma clang diagnostic ignored "-Wpadded" +#endif + +namespace Catch { + + struct ITestInvoker; + + struct TestCaseInfo { + enum SpecialProperties{ + None = 0, + IsHidden = 1 << 1, + ShouldFail = 1 << 2, + MayFail = 1 << 3, + Throws = 1 << 4, + NonPortable = 1 << 5, + Benchmark = 1 << 6 + }; + + TestCaseInfo( std::string const& _name, + std::string const& _className, + std::string const& _description, + std::vector const& _tags, + SourceLineInfo const& _lineInfo ); + + friend void setTags( TestCaseInfo& testCaseInfo, std::vector tags ); + + bool isHidden() const; + bool throws() const; + bool okToFail() const; + bool expectedToFail() const; + + std::string tagsAsString() const; + + std::string name; + std::string className; + std::string description; + std::vector tags; + std::vector lcaseTags; + SourceLineInfo lineInfo; + SpecialProperties properties; + }; + + class TestCase : public TestCaseInfo { + public: + + TestCase( ITestInvoker* testCase, TestCaseInfo&& info ); + + TestCase withName( std::string const& _newName ) const; + + void invoke() const; + + TestCaseInfo const& getTestCaseInfo() const; + + bool operator == ( TestCase const& other ) const; + bool operator < ( TestCase const& other ) const; + + private: + std::shared_ptr test; + }; + + TestCase makeTestCase( ITestInvoker* testCase, + std::string const& className, + NameAndTags const& nameAndTags, + SourceLineInfo const& lineInfo ); +} + +#ifdef __clang__ +#pragma clang diagnostic pop +#endif + +// end catch_test_case_info.h +// start catch_interfaces_runner.h + +namespace Catch { + + struct IRunner { + virtual ~IRunner(); + virtual bool aborting() const = 0; + }; +} + +// end catch_interfaces_runner.h + +#ifdef __OBJC__ +// start catch_objc.hpp + +#import + +#include + +// NB. Any general catch headers included here must be included +// in catch.hpp first to make sure they are included by the single +// header for non obj-usage + +/////////////////////////////////////////////////////////////////////////////// +// This protocol is really only here for (self) documenting purposes, since +// all its methods are optional. +@protocol OcFixture + +@optional + +-(void) setUp; +-(void) tearDown; + +@end + +namespace Catch { + + class OcMethod : public ITestInvoker { + + public: + OcMethod( Class cls, SEL sel ) : m_cls( cls ), m_sel( sel ) {} + + virtual void invoke() const { + id obj = [[m_cls alloc] init]; + + performOptionalSelector( obj, @selector(setUp) ); + performOptionalSelector( obj, m_sel ); + performOptionalSelector( obj, @selector(tearDown) ); + + arcSafeRelease( obj ); + } + private: + virtual ~OcMethod() {} + + Class m_cls; + SEL m_sel; + }; + + namespace Detail{ + + inline std::string getAnnotation( Class cls, + std::string const& annotationName, + std::string const& testCaseName ) { + NSString* selStr = [[NSString alloc] initWithFormat:@"Catch_%s_%s", annotationName.c_str(), testCaseName.c_str()]; + SEL sel = NSSelectorFromString( selStr ); + arcSafeRelease( selStr ); + id value = performOptionalSelector( cls, sel ); + if( value ) + return [(NSString*)value UTF8String]; + return ""; + } + } + + inline std::size_t registerTestMethods() { + std::size_t noTestMethods = 0; + int noClasses = objc_getClassList( nullptr, 0 ); + + Class* classes = (CATCH_UNSAFE_UNRETAINED Class *)malloc( sizeof(Class) * noClasses); + objc_getClassList( classes, noClasses ); + + for( int c = 0; c < noClasses; c++ ) { + Class cls = classes[c]; + { + u_int count; + Method* methods = class_copyMethodList( cls, &count ); + for( u_int m = 0; m < count ; m++ ) { + SEL selector = method_getName(methods[m]); + std::string methodName = sel_getName(selector); + if( startsWith( methodName, "Catch_TestCase_" ) ) { + std::string testCaseName = methodName.substr( 15 ); + std::string name = Detail::getAnnotation( cls, "Name", testCaseName ); + std::string desc = Detail::getAnnotation( cls, "Description", testCaseName ); + const char* className = class_getName( cls ); + + getMutableRegistryHub().registerTest( makeTestCase( new OcMethod( cls, selector ), className, NameAndTags( name.c_str(), desc.c_str() ), SourceLineInfo("",0) ) ); + noTestMethods++; + } + } + free(methods); + } + } + return noTestMethods; + } + +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) + + namespace Matchers { + namespace Impl { + namespace NSStringMatchers { + + struct StringHolder : MatcherBase{ + StringHolder( NSString* substr ) : m_substr( [substr copy] ){} + StringHolder( StringHolder const& other ) : m_substr( [other.m_substr copy] ){} + StringHolder() { + arcSafeRelease( m_substr ); + } + + bool match( NSString* arg ) const override { + return false; + } + + NSString* CATCH_ARC_STRONG m_substr; + }; + + struct Equals : StringHolder { + Equals( NSString* substr ) : StringHolder( substr ){} + + bool match( NSString* str ) const override { + return (str != nil || m_substr == nil ) && + [str isEqualToString:m_substr]; + } + + std::string describe() const override { + return "equals string: " + Catch::Detail::stringify( m_substr ); + } + }; + + struct Contains : StringHolder { + Contains( NSString* substr ) : StringHolder( substr ){} + + bool match( NSString* str ) const { + return (str != nil || m_substr == nil ) && + [str rangeOfString:m_substr].location != NSNotFound; + } + + std::string describe() const override { + return "contains string: " + Catch::Detail::stringify( m_substr ); + } + }; + + struct StartsWith : StringHolder { + StartsWith( NSString* substr ) : StringHolder( substr ){} + + bool match( NSString* str ) const override { + return (str != nil || m_substr == nil ) && + [str rangeOfString:m_substr].location == 0; + } + + std::string describe() const override { + return "starts with: " + Catch::Detail::stringify( m_substr ); + } + }; + struct EndsWith : StringHolder { + EndsWith( NSString* substr ) : StringHolder( substr ){} + + bool match( NSString* str ) const override { + return (str != nil || m_substr == nil ) && + [str rangeOfString:m_substr].location == [str length] - [m_substr length]; + } + + std::string describe() const override { + return "ends with: " + Catch::Detail::stringify( m_substr ); + } + }; + + } // namespace NSStringMatchers + } // namespace Impl + + inline Impl::NSStringMatchers::Equals + Equals( NSString* substr ){ return Impl::NSStringMatchers::Equals( substr ); } + + inline Impl::NSStringMatchers::Contains + Contains( NSString* substr ){ return Impl::NSStringMatchers::Contains( substr ); } + + inline Impl::NSStringMatchers::StartsWith + StartsWith( NSString* substr ){ return Impl::NSStringMatchers::StartsWith( substr ); } + + inline Impl::NSStringMatchers::EndsWith + EndsWith( NSString* substr ){ return Impl::NSStringMatchers::EndsWith( substr ); } + + } // namespace Matchers + + using namespace Matchers; + +#endif // CATCH_CONFIG_DISABLE_MATCHERS + +} // namespace Catch + +/////////////////////////////////////////////////////////////////////////////// +#define OC_MAKE_UNIQUE_NAME( root, uniqueSuffix ) root##uniqueSuffix +#define OC_TEST_CASE2( name, desc, uniqueSuffix ) \ ++(NSString*) OC_MAKE_UNIQUE_NAME( Catch_Name_test_, uniqueSuffix ) \ +{ \ +return @ name; \ +} \ ++(NSString*) OC_MAKE_UNIQUE_NAME( Catch_Description_test_, uniqueSuffix ) \ +{ \ +return @ desc; \ +} \ +-(void) OC_MAKE_UNIQUE_NAME( Catch_TestCase_test_, uniqueSuffix ) + +#define OC_TEST_CASE( name, desc ) OC_TEST_CASE2( name, desc, __LINE__ ) + +// end catch_objc.hpp +#endif + +#ifdef CATCH_CONFIG_EXTERNAL_INTERFACES +// start catch_external_interfaces.h + +// start catch_reporter_bases.hpp + +// start catch_interfaces_reporter.h + +// start catch_config.hpp + +// start catch_test_spec_parser.h + +#ifdef __clang__ +#pragma clang diagnostic push +#pragma clang diagnostic ignored "-Wpadded" +#endif + +// start catch_test_spec.h + +#ifdef __clang__ +#pragma clang diagnostic push +#pragma clang diagnostic ignored "-Wpadded" +#endif + +// start catch_wildcard_pattern.h + +namespace Catch +{ + class WildcardPattern { + enum WildcardPosition { + NoWildcard = 0, + WildcardAtStart = 1, + WildcardAtEnd = 2, + WildcardAtBothEnds = WildcardAtStart | WildcardAtEnd + }; + + public: + + WildcardPattern( std::string const& pattern, CaseSensitive::Choice caseSensitivity ); + virtual ~WildcardPattern() = default; + virtual bool matches( std::string const& str ) const; + + private: + std::string adjustCase( std::string const& str ) const; + CaseSensitive::Choice m_caseSensitivity; + WildcardPosition m_wildcard = NoWildcard; + std::string m_pattern; + }; +} + +// end catch_wildcard_pattern.h +#include +#include +#include + +namespace Catch { + + class TestSpec { + struct Pattern { + virtual ~Pattern(); + virtual bool matches( TestCaseInfo const& testCase ) const = 0; + }; + using PatternPtr = std::shared_ptr; + + class NamePattern : public Pattern { + public: + NamePattern( std::string const& name ); + virtual ~NamePattern(); + virtual bool matches( TestCaseInfo const& testCase ) const override; + private: + WildcardPattern m_wildcardPattern; + }; + + class TagPattern : public Pattern { + public: + TagPattern( std::string const& tag ); + virtual ~TagPattern(); + virtual bool matches( TestCaseInfo const& testCase ) const override; + private: + std::string m_tag; + }; + + class ExcludedPattern : public Pattern { + public: + ExcludedPattern( PatternPtr const& underlyingPattern ); + virtual ~ExcludedPattern(); + virtual bool matches( TestCaseInfo const& testCase ) const override; + private: + PatternPtr m_underlyingPattern; + }; + + struct Filter { + std::vector m_patterns; + + bool matches( TestCaseInfo const& testCase ) const; + }; + + public: + bool hasFilters() const; + bool matches( TestCaseInfo const& testCase ) const; + + private: + std::vector m_filters; + + friend class TestSpecParser; + }; +} + +#ifdef __clang__ +#pragma clang diagnostic pop +#endif + +// end catch_test_spec.h +// start catch_interfaces_tag_alias_registry.h + +#include + +namespace Catch { + + struct TagAlias; + + struct ITagAliasRegistry { + virtual ~ITagAliasRegistry(); + // Nullptr if not present + virtual TagAlias const* find( std::string const& alias ) const = 0; + virtual std::string expandAliases( std::string const& unexpandedTestSpec ) const = 0; + + static ITagAliasRegistry const& get(); + }; + +} // end namespace Catch + +// end catch_interfaces_tag_alias_registry.h +namespace Catch { + + class TestSpecParser { + enum Mode{ None, Name, QuotedName, Tag, EscapedName }; + Mode m_mode = None; + bool m_exclusion = false; + std::size_t m_start = std::string::npos, m_pos = 0; + std::string m_arg; + std::vector m_escapeChars; + TestSpec::Filter m_currentFilter; + TestSpec m_testSpec; + ITagAliasRegistry const* m_tagAliases = nullptr; + + public: + TestSpecParser( ITagAliasRegistry const& tagAliases ); + + TestSpecParser& parse( std::string const& arg ); + TestSpec testSpec(); + + private: + void visitChar( char c ); + void startNewMode( Mode mode, std::size_t start ); + void escape(); + std::string subString() const; + + template + void addPattern() { + std::string token = subString(); + for( std::size_t i = 0; i < m_escapeChars.size(); ++i ) + token = token.substr( 0, m_escapeChars[i]-m_start-i ) + token.substr( m_escapeChars[i]-m_start-i+1 ); + m_escapeChars.clear(); + if( startsWith( token, "exclude:" ) ) { + m_exclusion = true; + token = token.substr( 8 ); + } + if( !token.empty() ) { + TestSpec::PatternPtr pattern = std::make_shared( token ); + if( m_exclusion ) + pattern = std::make_shared( pattern ); + m_currentFilter.m_patterns.push_back( pattern ); + } + m_exclusion = false; + m_mode = None; + } + + void addFilter(); + }; + TestSpec parseTestSpec( std::string const& arg ); + +} // namespace Catch + +#ifdef __clang__ +#pragma clang diagnostic pop +#endif + +// end catch_test_spec_parser.h +// Libstdc++ doesn't like incomplete classes for unique_ptr + +#include +#include +#include + +#ifndef CATCH_CONFIG_CONSOLE_WIDTH +#define CATCH_CONFIG_CONSOLE_WIDTH 80 +#endif + +namespace Catch { + + struct IStream; + + struct ConfigData { + bool listTests = false; + bool listTags = false; + bool listReporters = false; + bool listTestNamesOnly = false; + + bool showSuccessfulTests = false; + bool shouldDebugBreak = false; + bool noThrow = false; + bool showHelp = false; + bool showInvisibles = false; + bool filenamesAsTags = false; + bool libIdentify = false; + + int abortAfter = -1; + unsigned int rngSeed = 0; + int benchmarkResolutionMultiple = 100; + + Verbosity verbosity = Verbosity::Normal; + WarnAbout::What warnings = WarnAbout::Nothing; + ShowDurations::OrNot showDurations = ShowDurations::DefaultForReporter; + RunTests::InWhatOrder runOrder = RunTests::InDeclarationOrder; + UseColour::YesOrNo useColour = UseColour::Auto; + WaitForKeypress::When waitForKeypress = WaitForKeypress::Never; + + std::string outputFilename; + std::string name; + std::string processName; +#ifndef CATCH_CONFIG_DEFAULT_REPORTER +#define CATCH_CONFIG_DEFAULT_REPORTER "console" +#endif + std::string reporterName = CATCH_CONFIG_DEFAULT_REPORTER; +#undef CATCH_CONFIG_DEFAULT_REPORTER + + std::vector testsOrTags; + std::vector sectionsToRun; + }; + + class Config : public IConfig { + public: + + Config() = default; + Config( ConfigData const& data ); + virtual ~Config() = default; + + std::string const& getFilename() const; + + bool listTests() const; + bool listTestNamesOnly() const; + bool listTags() const; + bool listReporters() const; + + std::string getProcessName() const; + std::string const& getReporterName() const; + + std::vector const& getTestsOrTags() const; + std::vector const& getSectionsToRun() const override; + + virtual TestSpec const& testSpec() const override; + bool hasTestFilters() const override; + + bool showHelp() const; + + // IConfig interface + bool allowThrows() const override; + std::ostream& stream() const override; + std::string name() const override; + bool includeSuccessfulResults() const override; + bool warnAboutMissingAssertions() const override; + bool warnAboutNoTests() const override; + ShowDurations::OrNot showDurations() const override; + RunTests::InWhatOrder runOrder() const override; + unsigned int rngSeed() const override; + int benchmarkResolutionMultiple() const override; + UseColour::YesOrNo useColour() const override; + bool shouldDebugBreak() const override; + int abortAfter() const override; + bool showInvisibles() const override; + Verbosity verbosity() const override; + + private: + + IStream const* openStream(); + ConfigData m_data; + + std::unique_ptr m_stream; + TestSpec m_testSpec; + bool m_hasTestFilters = false; + }; + +} // end namespace Catch + +// end catch_config.hpp +// start catch_assertionresult.h + +#include + +namespace Catch { + + struct AssertionResultData + { + AssertionResultData() = delete; + + AssertionResultData( ResultWas::OfType _resultType, LazyExpression const& _lazyExpression ); + + std::string message; + mutable std::string reconstructedExpression; + LazyExpression lazyExpression; + ResultWas::OfType resultType; + + std::string reconstructExpression() const; + }; + + class AssertionResult { + public: + AssertionResult() = delete; + AssertionResult( AssertionInfo const& info, AssertionResultData const& data ); + + bool isOk() const; + bool succeeded() const; + ResultWas::OfType getResultType() const; + bool hasExpression() const; + bool hasMessage() const; + std::string getExpression() const; + std::string getExpressionInMacro() const; + bool hasExpandedExpression() const; + std::string getExpandedExpression() const; + std::string getMessage() const; + SourceLineInfo getSourceInfo() const; + StringRef getTestMacroName() const; + + //protected: + AssertionInfo m_info; + AssertionResultData m_resultData; + }; + +} // end namespace Catch + +// end catch_assertionresult.h +// start catch_option.hpp + +namespace Catch { + + // An optional type + template + class Option { + public: + Option() : nullableValue( nullptr ) {} + Option( T const& _value ) + : nullableValue( new( storage ) T( _value ) ) + {} + Option( Option const& _other ) + : nullableValue( _other ? new( storage ) T( *_other ) : nullptr ) + {} + + ~Option() { + reset(); + } + + Option& operator= ( Option const& _other ) { + if( &_other != this ) { + reset(); + if( _other ) + nullableValue = new( storage ) T( *_other ); + } + return *this; + } + Option& operator = ( T const& _value ) { + reset(); + nullableValue = new( storage ) T( _value ); + return *this; + } + + void reset() { + if( nullableValue ) + nullableValue->~T(); + nullableValue = nullptr; + } + + T& operator*() { return *nullableValue; } + T const& operator*() const { return *nullableValue; } + T* operator->() { return nullableValue; } + const T* operator->() const { return nullableValue; } + + T valueOr( T const& defaultValue ) const { + return nullableValue ? *nullableValue : defaultValue; + } + + bool some() const { return nullableValue != nullptr; } + bool none() const { return nullableValue == nullptr; } + + bool operator !() const { return nullableValue == nullptr; } + explicit operator bool() const { + return some(); + } + + private: + T *nullableValue; + alignas(alignof(T)) char storage[sizeof(T)]; + }; + +} // end namespace Catch + +// end catch_option.hpp +#include +#include +#include +#include +#include + +namespace Catch { + + struct ReporterConfig { + explicit ReporterConfig( IConfigPtr const& _fullConfig ); + + ReporterConfig( IConfigPtr const& _fullConfig, std::ostream& _stream ); + + std::ostream& stream() const; + IConfigPtr fullConfig() const; + + private: + std::ostream* m_stream; + IConfigPtr m_fullConfig; + }; + + struct ReporterPreferences { + bool shouldRedirectStdOut = false; + bool shouldReportAllAssertions = false; + }; + + template + struct LazyStat : Option { + LazyStat& operator=( T const& _value ) { + Option::operator=( _value ); + used = false; + return *this; + } + void reset() { + Option::reset(); + used = false; + } + bool used = false; + }; + + struct TestRunInfo { + TestRunInfo( std::string const& _name ); + std::string name; + }; + struct GroupInfo { + GroupInfo( std::string const& _name, + std::size_t _groupIndex, + std::size_t _groupsCount ); + + std::string name; + std::size_t groupIndex; + std::size_t groupsCounts; + }; + + struct AssertionStats { + AssertionStats( AssertionResult const& _assertionResult, + std::vector const& _infoMessages, + Totals const& _totals ); + + AssertionStats( AssertionStats const& ) = default; + AssertionStats( AssertionStats && ) = default; + AssertionStats& operator = ( AssertionStats const& ) = delete; + AssertionStats& operator = ( AssertionStats && ) = delete; + virtual ~AssertionStats(); + + AssertionResult assertionResult; + std::vector infoMessages; + Totals totals; + }; + + struct SectionStats { + SectionStats( SectionInfo const& _sectionInfo, + Counts const& _assertions, + double _durationInSeconds, + bool _missingAssertions ); + SectionStats( SectionStats const& ) = default; + SectionStats( SectionStats && ) = default; + SectionStats& operator = ( SectionStats const& ) = default; + SectionStats& operator = ( SectionStats && ) = default; + virtual ~SectionStats(); + + SectionInfo sectionInfo; + Counts assertions; + double durationInSeconds; + bool missingAssertions; + }; + + struct TestCaseStats { + TestCaseStats( TestCaseInfo const& _testInfo, + Totals const& _totals, + std::string const& _stdOut, + std::string const& _stdErr, + bool _aborting ); + + TestCaseStats( TestCaseStats const& ) = default; + TestCaseStats( TestCaseStats && ) = default; + TestCaseStats& operator = ( TestCaseStats const& ) = default; + TestCaseStats& operator = ( TestCaseStats && ) = default; + virtual ~TestCaseStats(); + + TestCaseInfo testInfo; + Totals totals; + std::string stdOut; + std::string stdErr; + bool aborting; + }; + + struct TestGroupStats { + TestGroupStats( GroupInfo const& _groupInfo, + Totals const& _totals, + bool _aborting ); + TestGroupStats( GroupInfo const& _groupInfo ); + + TestGroupStats( TestGroupStats const& ) = default; + TestGroupStats( TestGroupStats && ) = default; + TestGroupStats& operator = ( TestGroupStats const& ) = default; + TestGroupStats& operator = ( TestGroupStats && ) = default; + virtual ~TestGroupStats(); + + GroupInfo groupInfo; + Totals totals; + bool aborting; + }; + + struct TestRunStats { + TestRunStats( TestRunInfo const& _runInfo, + Totals const& _totals, + bool _aborting ); + + TestRunStats( TestRunStats const& ) = default; + TestRunStats( TestRunStats && ) = default; + TestRunStats& operator = ( TestRunStats const& ) = default; + TestRunStats& operator = ( TestRunStats && ) = default; + virtual ~TestRunStats(); + + TestRunInfo runInfo; + Totals totals; + bool aborting; + }; + + struct BenchmarkInfo { + std::string name; + }; + struct BenchmarkStats { + BenchmarkInfo info; + std::size_t iterations; + uint64_t elapsedTimeInNanoseconds; + }; + + struct IStreamingReporter { + virtual ~IStreamingReporter() = default; + + // Implementing class must also provide the following static methods: + // static std::string getDescription(); + // static std::set getSupportedVerbosities() + + virtual ReporterPreferences getPreferences() const = 0; + + virtual void noMatchingTestCases( std::string const& spec ) = 0; + + virtual void testRunStarting( TestRunInfo const& testRunInfo ) = 0; + virtual void testGroupStarting( GroupInfo const& groupInfo ) = 0; + + virtual void testCaseStarting( TestCaseInfo const& testInfo ) = 0; + virtual void sectionStarting( SectionInfo const& sectionInfo ) = 0; + + // *** experimental *** + virtual void benchmarkStarting( BenchmarkInfo const& ) {} + + virtual void assertionStarting( AssertionInfo const& assertionInfo ) = 0; + + // The return value indicates if the messages buffer should be cleared: + virtual bool assertionEnded( AssertionStats const& assertionStats ) = 0; + + // *** experimental *** + virtual void benchmarkEnded( BenchmarkStats const& ) {} + + virtual void sectionEnded( SectionStats const& sectionStats ) = 0; + virtual void testCaseEnded( TestCaseStats const& testCaseStats ) = 0; + virtual void testGroupEnded( TestGroupStats const& testGroupStats ) = 0; + virtual void testRunEnded( TestRunStats const& testRunStats ) = 0; + + virtual void skipTest( TestCaseInfo const& testInfo ) = 0; + + // Default empty implementation provided + virtual void fatalErrorEncountered( StringRef name ); + + virtual bool isMulti() const; + }; + using IStreamingReporterPtr = std::unique_ptr; + + struct IReporterFactory { + virtual ~IReporterFactory(); + virtual IStreamingReporterPtr create( ReporterConfig const& config ) const = 0; + virtual std::string getDescription() const = 0; + }; + using IReporterFactoryPtr = std::shared_ptr; + + struct IReporterRegistry { + using FactoryMap = std::map; + using Listeners = std::vector; + + virtual ~IReporterRegistry(); + virtual IStreamingReporterPtr create( std::string const& name, IConfigPtr const& config ) const = 0; + virtual FactoryMap const& getFactories() const = 0; + virtual Listeners const& getListeners() const = 0; + }; + +} // end namespace Catch + +// end catch_interfaces_reporter.h +#include +#include +#include +#include +#include +#include +#include + +namespace Catch { + void prepareExpandedExpression(AssertionResult& result); + + // Returns double formatted as %.3f (format expected on output) + std::string getFormattedDuration( double duration ); + + template + struct StreamingReporterBase : IStreamingReporter { + + StreamingReporterBase( ReporterConfig const& _config ) + : m_config( _config.fullConfig() ), + stream( _config.stream() ) + { + m_reporterPrefs.shouldRedirectStdOut = false; + if( !DerivedT::getSupportedVerbosities().count( m_config->verbosity() ) ) + CATCH_ERROR( "Verbosity level not supported by this reporter" ); + } + + ReporterPreferences getPreferences() const override { + return m_reporterPrefs; + } + + static std::set getSupportedVerbosities() { + return { Verbosity::Normal }; + } + + ~StreamingReporterBase() override = default; + + void noMatchingTestCases(std::string const&) override {} + + void testRunStarting(TestRunInfo const& _testRunInfo) override { + currentTestRunInfo = _testRunInfo; + } + void testGroupStarting(GroupInfo const& _groupInfo) override { + currentGroupInfo = _groupInfo; + } + + void testCaseStarting(TestCaseInfo const& _testInfo) override { + currentTestCaseInfo = _testInfo; + } + void sectionStarting(SectionInfo const& _sectionInfo) override { + m_sectionStack.push_back(_sectionInfo); + } + + void sectionEnded(SectionStats const& /* _sectionStats */) override { + m_sectionStack.pop_back(); + } + void testCaseEnded(TestCaseStats const& /* _testCaseStats */) override { + currentTestCaseInfo.reset(); + } + void testGroupEnded(TestGroupStats const& /* _testGroupStats */) override { + currentGroupInfo.reset(); + } + void testRunEnded(TestRunStats const& /* _testRunStats */) override { + currentTestCaseInfo.reset(); + currentGroupInfo.reset(); + currentTestRunInfo.reset(); + } + + void skipTest(TestCaseInfo const&) override { + // Don't do anything with this by default. + // It can optionally be overridden in the derived class. + } + + IConfigPtr m_config; + std::ostream& stream; + + LazyStat currentTestRunInfo; + LazyStat currentGroupInfo; + LazyStat currentTestCaseInfo; + + std::vector m_sectionStack; + ReporterPreferences m_reporterPrefs; + }; + + template + struct CumulativeReporterBase : IStreamingReporter { + template + struct Node { + explicit Node( T const& _value ) : value( _value ) {} + virtual ~Node() {} + + using ChildNodes = std::vector>; + T value; + ChildNodes children; + }; + struct SectionNode { + explicit SectionNode(SectionStats const& _stats) : stats(_stats) {} + virtual ~SectionNode() = default; + + bool operator == (SectionNode const& other) const { + return stats.sectionInfo.lineInfo == other.stats.sectionInfo.lineInfo; + } + bool operator == (std::shared_ptr const& other) const { + return operator==(*other); + } + + SectionStats stats; + using ChildSections = std::vector>; + using Assertions = std::vector; + ChildSections childSections; + Assertions assertions; + std::string stdOut; + std::string stdErr; + }; + + struct BySectionInfo { + BySectionInfo( SectionInfo const& other ) : m_other( other ) {} + BySectionInfo( BySectionInfo const& other ) : m_other( other.m_other ) {} + bool operator() (std::shared_ptr const& node) const { + return ((node->stats.sectionInfo.name == m_other.name) && + (node->stats.sectionInfo.lineInfo == m_other.lineInfo)); + } + void operator=(BySectionInfo const&) = delete; + + private: + SectionInfo const& m_other; + }; + + using TestCaseNode = Node; + using TestGroupNode = Node; + using TestRunNode = Node; + + CumulativeReporterBase( ReporterConfig const& _config ) + : m_config( _config.fullConfig() ), + stream( _config.stream() ) + { + m_reporterPrefs.shouldRedirectStdOut = false; + if( !DerivedT::getSupportedVerbosities().count( m_config->verbosity() ) ) + CATCH_ERROR( "Verbosity level not supported by this reporter" ); + } + ~CumulativeReporterBase() override = default; + + ReporterPreferences getPreferences() const override { + return m_reporterPrefs; + } + + static std::set getSupportedVerbosities() { + return { Verbosity::Normal }; + } + + void testRunStarting( TestRunInfo const& ) override {} + void testGroupStarting( GroupInfo const& ) override {} + + void testCaseStarting( TestCaseInfo const& ) override {} + + void sectionStarting( SectionInfo const& sectionInfo ) override { + SectionStats incompleteStats( sectionInfo, Counts(), 0, false ); + std::shared_ptr node; + if( m_sectionStack.empty() ) { + if( !m_rootSection ) + m_rootSection = std::make_shared( incompleteStats ); + node = m_rootSection; + } + else { + SectionNode& parentNode = *m_sectionStack.back(); + auto it = + std::find_if( parentNode.childSections.begin(), + parentNode.childSections.end(), + BySectionInfo( sectionInfo ) ); + if( it == parentNode.childSections.end() ) { + node = std::make_shared( incompleteStats ); + parentNode.childSections.push_back( node ); + } + else + node = *it; + } + m_sectionStack.push_back( node ); + m_deepestSection = std::move(node); + } + + void assertionStarting(AssertionInfo const&) override {} + + bool assertionEnded(AssertionStats const& assertionStats) override { + assert(!m_sectionStack.empty()); + // AssertionResult holds a pointer to a temporary DecomposedExpression, + // which getExpandedExpression() calls to build the expression string. + // Our section stack copy of the assertionResult will likely outlive the + // temporary, so it must be expanded or discarded now to avoid calling + // a destroyed object later. + prepareExpandedExpression(const_cast( assertionStats.assertionResult ) ); + SectionNode& sectionNode = *m_sectionStack.back(); + sectionNode.assertions.push_back(assertionStats); + return true; + } + void sectionEnded(SectionStats const& sectionStats) override { + assert(!m_sectionStack.empty()); + SectionNode& node = *m_sectionStack.back(); + node.stats = sectionStats; + m_sectionStack.pop_back(); + } + void testCaseEnded(TestCaseStats const& testCaseStats) override { + auto node = std::make_shared(testCaseStats); + assert(m_sectionStack.size() == 0); + node->children.push_back(m_rootSection); + m_testCases.push_back(node); + m_rootSection.reset(); + + assert(m_deepestSection); + m_deepestSection->stdOut = testCaseStats.stdOut; + m_deepestSection->stdErr = testCaseStats.stdErr; + } + void testGroupEnded(TestGroupStats const& testGroupStats) override { + auto node = std::make_shared(testGroupStats); + node->children.swap(m_testCases); + m_testGroups.push_back(node); + } + void testRunEnded(TestRunStats const& testRunStats) override { + auto node = std::make_shared(testRunStats); + node->children.swap(m_testGroups); + m_testRuns.push_back(node); + testRunEndedCumulative(); + } + virtual void testRunEndedCumulative() = 0; + + void skipTest(TestCaseInfo const&) override {} + + IConfigPtr m_config; + std::ostream& stream; + std::vector m_assertions; + std::vector>> m_sections; + std::vector> m_testCases; + std::vector> m_testGroups; + + std::vector> m_testRuns; + + std::shared_ptr m_rootSection; + std::shared_ptr m_deepestSection; + std::vector> m_sectionStack; + ReporterPreferences m_reporterPrefs; + }; + + template + char const* getLineOfChars() { + static char line[CATCH_CONFIG_CONSOLE_WIDTH] = {0}; + if( !*line ) { + std::memset( line, C, CATCH_CONFIG_CONSOLE_WIDTH-1 ); + line[CATCH_CONFIG_CONSOLE_WIDTH-1] = 0; + } + return line; + } + + struct TestEventListenerBase : StreamingReporterBase { + TestEventListenerBase( ReporterConfig const& _config ); + + static std::set getSupportedVerbosities(); + + void assertionStarting(AssertionInfo const&) override; + bool assertionEnded(AssertionStats const&) override; + }; + +} // end namespace Catch + +// end catch_reporter_bases.hpp +// start catch_console_colour.h + +namespace Catch { + + struct Colour { + enum Code { + None = 0, + + White, + Red, + Green, + Blue, + Cyan, + Yellow, + Grey, + + Bright = 0x10, + + BrightRed = Bright | Red, + BrightGreen = Bright | Green, + LightGrey = Bright | Grey, + BrightWhite = Bright | White, + BrightYellow = Bright | Yellow, + + // By intention + FileName = LightGrey, + Warning = BrightYellow, + ResultError = BrightRed, + ResultSuccess = BrightGreen, + ResultExpectedFailure = Warning, + + Error = BrightRed, + Success = Green, + + OriginalExpression = Cyan, + ReconstructedExpression = BrightYellow, + + SecondaryText = LightGrey, + Headers = White + }; + + // Use constructed object for RAII guard + Colour( Code _colourCode ); + Colour( Colour&& other ) noexcept; + Colour& operator=( Colour&& other ) noexcept; + ~Colour(); + + // Use static method for one-shot changes + static void use( Code _colourCode ); + + private: + bool m_moved = false; + }; + + std::ostream& operator << ( std::ostream& os, Colour const& ); + +} // end namespace Catch + +// end catch_console_colour.h +// start catch_reporter_registrars.hpp + + +namespace Catch { + + template + class ReporterRegistrar { + + class ReporterFactory : public IReporterFactory { + + virtual IStreamingReporterPtr create( ReporterConfig const& config ) const override { + return std::unique_ptr( new T( config ) ); + } + + virtual std::string getDescription() const override { + return T::getDescription(); + } + }; + + public: + + explicit ReporterRegistrar( std::string const& name ) { + getMutableRegistryHub().registerReporter( name, std::make_shared() ); + } + }; + + template + class ListenerRegistrar { + + class ListenerFactory : public IReporterFactory { + + virtual IStreamingReporterPtr create( ReporterConfig const& config ) const override { + return std::unique_ptr( new T( config ) ); + } + virtual std::string getDescription() const override { + return std::string(); + } + }; + + public: + + ListenerRegistrar() { + getMutableRegistryHub().registerListener( std::make_shared() ); + } + }; +} + +#if !defined(CATCH_CONFIG_DISABLE) + +#define CATCH_REGISTER_REPORTER( name, reporterType ) \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ Catch::ReporterRegistrar catch_internal_RegistrarFor##reporterType( name ); } \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS + +#define CATCH_REGISTER_LISTENER( listenerType ) \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ Catch::ListenerRegistrar catch_internal_RegistrarFor##listenerType; } \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS +#else // CATCH_CONFIG_DISABLE + +#define CATCH_REGISTER_REPORTER(name, reporterType) +#define CATCH_REGISTER_LISTENER(listenerType) + +#endif // CATCH_CONFIG_DISABLE + +// end catch_reporter_registrars.hpp +// Allow users to base their work off existing reporters +// start catch_reporter_compact.h + +namespace Catch { + + struct CompactReporter : StreamingReporterBase { + + using StreamingReporterBase::StreamingReporterBase; + + ~CompactReporter() override; + + static std::string getDescription(); + + ReporterPreferences getPreferences() const override; + + void noMatchingTestCases(std::string const& spec) override; + + void assertionStarting(AssertionInfo const&) override; + + bool assertionEnded(AssertionStats const& _assertionStats) override; + + void sectionEnded(SectionStats const& _sectionStats) override; + + void testRunEnded(TestRunStats const& _testRunStats) override; + + }; + +} // end namespace Catch + +// end catch_reporter_compact.h +// start catch_reporter_console.h + +#if defined(_MSC_VER) +#pragma warning(push) +#pragma warning(disable:4061) // Not all labels are EXPLICITLY handled in switch + // Note that 4062 (not all labels are handled + // and default is missing) is enabled +#endif + +namespace Catch { + // Fwd decls + struct SummaryColumn; + class TablePrinter; + + struct ConsoleReporter : StreamingReporterBase { + std::unique_ptr m_tablePrinter; + + ConsoleReporter(ReporterConfig const& config); + ~ConsoleReporter() override; + static std::string getDescription(); + + void noMatchingTestCases(std::string const& spec) override; + + void assertionStarting(AssertionInfo const&) override; + + bool assertionEnded(AssertionStats const& _assertionStats) override; + + void sectionStarting(SectionInfo const& _sectionInfo) override; + void sectionEnded(SectionStats const& _sectionStats) override; + + void benchmarkStarting(BenchmarkInfo const& info) override; + void benchmarkEnded(BenchmarkStats const& stats) override; + + void testCaseEnded(TestCaseStats const& _testCaseStats) override; + void testGroupEnded(TestGroupStats const& _testGroupStats) override; + void testRunEnded(TestRunStats const& _testRunStats) override; + + private: + + void lazyPrint(); + + void lazyPrintWithoutClosingBenchmarkTable(); + void lazyPrintRunInfo(); + void lazyPrintGroupInfo(); + void printTestCaseAndSectionHeader(); + + void printClosedHeader(std::string const& _name); + void printOpenHeader(std::string const& _name); + + // if string has a : in first line will set indent to follow it on + // subsequent lines + void printHeaderString(std::string const& _string, std::size_t indent = 0); + + void printTotals(Totals const& totals); + void printSummaryRow(std::string const& label, std::vector const& cols, std::size_t row); + + void printTotalsDivider(Totals const& totals); + void printSummaryDivider(); + + private: + bool m_headerPrinted = false; + }; + +} // end namespace Catch + +#if defined(_MSC_VER) +#pragma warning(pop) +#endif + +// end catch_reporter_console.h +// start catch_reporter_junit.h + +// start catch_xmlwriter.h + +#include + +namespace Catch { + + class XmlEncode { + public: + enum ForWhat { ForTextNodes, ForAttributes }; + + XmlEncode( std::string const& str, ForWhat forWhat = ForTextNodes ); + + void encodeTo( std::ostream& os ) const; + + friend std::ostream& operator << ( std::ostream& os, XmlEncode const& xmlEncode ); + + private: + std::string m_str; + ForWhat m_forWhat; + }; + + class XmlWriter { + public: + + class ScopedElement { + public: + ScopedElement( XmlWriter* writer ); + + ScopedElement( ScopedElement&& other ) noexcept; + ScopedElement& operator=( ScopedElement&& other ) noexcept; + + ~ScopedElement(); + + ScopedElement& writeText( std::string const& text, bool indent = true ); + + template + ScopedElement& writeAttribute( std::string const& name, T const& attribute ) { + m_writer->writeAttribute( name, attribute ); + return *this; + } + + private: + mutable XmlWriter* m_writer = nullptr; + }; + + XmlWriter( std::ostream& os = Catch::cout() ); + ~XmlWriter(); + + XmlWriter( XmlWriter const& ) = delete; + XmlWriter& operator=( XmlWriter const& ) = delete; + + XmlWriter& startElement( std::string const& name ); + + ScopedElement scopedElement( std::string const& name ); + + XmlWriter& endElement(); + + XmlWriter& writeAttribute( std::string const& name, std::string const& attribute ); + + XmlWriter& writeAttribute( std::string const& name, bool attribute ); + + template + XmlWriter& writeAttribute( std::string const& name, T const& attribute ) { + ReusableStringStream rss; + rss << attribute; + return writeAttribute( name, rss.str() ); + } + + XmlWriter& writeText( std::string const& text, bool indent = true ); + + XmlWriter& writeComment( std::string const& text ); + + void writeStylesheetRef( std::string const& url ); + + XmlWriter& writeBlankLine(); + + void ensureTagClosed(); + + private: + + void writeDeclaration(); + + void newlineIfNecessary(); + + bool m_tagIsOpen = false; + bool m_needsNewline = false; + std::vector m_tags; + std::string m_indent; + std::ostream& m_os; + }; + +} + +// end catch_xmlwriter.h +namespace Catch { + + class JunitReporter : public CumulativeReporterBase { + public: + JunitReporter(ReporterConfig const& _config); + + ~JunitReporter() override; + + static std::string getDescription(); + + void noMatchingTestCases(std::string const& /*spec*/) override; + + void testRunStarting(TestRunInfo const& runInfo) override; + + void testGroupStarting(GroupInfo const& groupInfo) override; + + void testCaseStarting(TestCaseInfo const& testCaseInfo) override; + bool assertionEnded(AssertionStats const& assertionStats) override; + + void testCaseEnded(TestCaseStats const& testCaseStats) override; + + void testGroupEnded(TestGroupStats const& testGroupStats) override; + + void testRunEndedCumulative() override; + + void writeGroup(TestGroupNode const& groupNode, double suiteTime); + + void writeTestCase(TestCaseNode const& testCaseNode); + + void writeSection(std::string const& className, + std::string const& rootName, + SectionNode const& sectionNode); + + void writeAssertions(SectionNode const& sectionNode); + void writeAssertion(AssertionStats const& stats); + + XmlWriter xml; + Timer suiteTimer; + std::string stdOutForSuite; + std::string stdErrForSuite; + unsigned int unexpectedExceptions = 0; + bool m_okToFail = false; + }; + +} // end namespace Catch + +// end catch_reporter_junit.h +// start catch_reporter_xml.h + +namespace Catch { + class XmlReporter : public StreamingReporterBase { + public: + XmlReporter(ReporterConfig const& _config); + + ~XmlReporter() override; + + static std::string getDescription(); + + virtual std::string getStylesheetRef() const; + + void writeSourceInfo(SourceLineInfo const& sourceInfo); + + public: // StreamingReporterBase + + void noMatchingTestCases(std::string const& s) override; + + void testRunStarting(TestRunInfo const& testInfo) override; + + void testGroupStarting(GroupInfo const& groupInfo) override; + + void testCaseStarting(TestCaseInfo const& testInfo) override; + + void sectionStarting(SectionInfo const& sectionInfo) override; + + void assertionStarting(AssertionInfo const&) override; + + bool assertionEnded(AssertionStats const& assertionStats) override; + + void sectionEnded(SectionStats const& sectionStats) override; + + void testCaseEnded(TestCaseStats const& testCaseStats) override; + + void testGroupEnded(TestGroupStats const& testGroupStats) override; + + void testRunEnded(TestRunStats const& testRunStats) override; + + private: + Timer m_testCaseTimer; + XmlWriter m_xml; + int m_sectionDepth = 0; + }; + +} // end namespace Catch + +// end catch_reporter_xml.h + +// end catch_external_interfaces.h +#endif + +#endif // ! CATCH_CONFIG_IMPL_ONLY + +#ifdef CATCH_IMPL +// start catch_impl.hpp + +#ifdef __clang__ +#pragma clang diagnostic push +#pragma clang diagnostic ignored "-Wweak-vtables" +#endif + +// Keep these here for external reporters +// start catch_test_case_tracker.h + +#include +#include +#include + +namespace Catch { +namespace TestCaseTracking { + + struct NameAndLocation { + std::string name; + SourceLineInfo location; + + NameAndLocation( std::string const& _name, SourceLineInfo const& _location ); + }; + + struct ITracker; + + using ITrackerPtr = std::shared_ptr; + + struct ITracker { + virtual ~ITracker(); + + // static queries + virtual NameAndLocation const& nameAndLocation() const = 0; + + // dynamic queries + virtual bool isComplete() const = 0; // Successfully completed or failed + virtual bool isSuccessfullyCompleted() const = 0; + virtual bool isOpen() const = 0; // Started but not complete + virtual bool hasChildren() const = 0; + + virtual ITracker& parent() = 0; + + // actions + virtual void close() = 0; // Successfully complete + virtual void fail() = 0; + virtual void markAsNeedingAnotherRun() = 0; + + virtual void addChild( ITrackerPtr const& child ) = 0; + virtual ITrackerPtr findChild( NameAndLocation const& nameAndLocation ) = 0; + virtual void openChild() = 0; + + // Debug/ checking + virtual bool isSectionTracker() const = 0; + virtual bool isGeneratorTracker() const = 0; + }; + + class TrackerContext { + + enum RunState { + NotStarted, + Executing, + CompletedCycle + }; + + ITrackerPtr m_rootTracker; + ITracker* m_currentTracker = nullptr; + RunState m_runState = NotStarted; + + public: + + static TrackerContext& instance(); + + ITracker& startRun(); + void endRun(); + + void startCycle(); + void completeCycle(); + + bool completedCycle() const; + ITracker& currentTracker(); + void setCurrentTracker( ITracker* tracker ); + }; + + class TrackerBase : public ITracker { + protected: + enum CycleState { + NotStarted, + Executing, + ExecutingChildren, + NeedsAnotherRun, + CompletedSuccessfully, + Failed + }; + + using Children = std::vector; + NameAndLocation m_nameAndLocation; + TrackerContext& m_ctx; + ITracker* m_parent; + Children m_children; + CycleState m_runState = NotStarted; + + public: + TrackerBase( NameAndLocation const& nameAndLocation, TrackerContext& ctx, ITracker* parent ); + + NameAndLocation const& nameAndLocation() const override; + bool isComplete() const override; + bool isSuccessfullyCompleted() const override; + bool isOpen() const override; + bool hasChildren() const override; + + void addChild( ITrackerPtr const& child ) override; + + ITrackerPtr findChild( NameAndLocation const& nameAndLocation ) override; + ITracker& parent() override; + + void openChild() override; + + bool isSectionTracker() const override; + bool isGeneratorTracker() const override; + + void open(); + + void close() override; + void fail() override; + void markAsNeedingAnotherRun() override; + + private: + void moveToParent(); + void moveToThis(); + }; + + class SectionTracker : public TrackerBase { + std::vector m_filters; + public: + SectionTracker( NameAndLocation const& nameAndLocation, TrackerContext& ctx, ITracker* parent ); + + bool isSectionTracker() const override; + + bool isComplete() const override; + + static SectionTracker& acquire( TrackerContext& ctx, NameAndLocation const& nameAndLocation ); + + void tryOpen(); + + void addInitialFilters( std::vector const& filters ); + void addNextFilters( std::vector const& filters ); + }; + +} // namespace TestCaseTracking + +using TestCaseTracking::ITracker; +using TestCaseTracking::TrackerContext; +using TestCaseTracking::SectionTracker; + +} // namespace Catch + +// end catch_test_case_tracker.h + +// start catch_leak_detector.h + +namespace Catch { + + struct LeakDetector { + LeakDetector(); + ~LeakDetector(); + }; + +} +// end catch_leak_detector.h +// Cpp files will be included in the single-header file here +// start catch_approx.cpp + +#include +#include + +namespace { + +// Performs equivalent check of std::fabs(lhs - rhs) <= margin +// But without the subtraction to allow for INFINITY in comparison +bool marginComparison(double lhs, double rhs, double margin) { + return (lhs + margin >= rhs) && (rhs + margin >= lhs); +} + +} + +namespace Catch { +namespace Detail { + + Approx::Approx ( double value ) + : m_epsilon( std::numeric_limits::epsilon()*100 ), + m_margin( 0.0 ), + m_scale( 0.0 ), + m_value( value ) + {} + + Approx Approx::custom() { + return Approx( 0 ); + } + + Approx Approx::operator-() const { + auto temp(*this); + temp.m_value = -temp.m_value; + return temp; + } + + std::string Approx::toString() const { + ReusableStringStream rss; + rss << "Approx( " << ::Catch::Detail::stringify( m_value ) << " )"; + return rss.str(); + } + + bool Approx::equalityComparisonImpl(const double other) const { + // First try with fixed margin, then compute margin based on epsilon, scale and Approx's value + // Thanks to Richard Harris for his help refining the scaled margin value + return marginComparison(m_value, other, m_margin) || marginComparison(m_value, other, m_epsilon * (m_scale + std::fabs(m_value))); + } + + void Approx::setMargin(double margin) { + CATCH_ENFORCE(margin >= 0, + "Invalid Approx::margin: " << margin << '.' + << " Approx::Margin has to be non-negative."); + m_margin = margin; + } + + void Approx::setEpsilon(double epsilon) { + CATCH_ENFORCE(epsilon >= 0 && epsilon <= 1.0, + "Invalid Approx::epsilon: " << epsilon << '.' + << " Approx::epsilon has to be in [0, 1]"); + m_epsilon = epsilon; + } + +} // end namespace Detail + +namespace literals { + Detail::Approx operator "" _a(long double val) { + return Detail::Approx(val); + } + Detail::Approx operator "" _a(unsigned long long val) { + return Detail::Approx(val); + } +} // end namespace literals + +std::string StringMaker::convert(Catch::Detail::Approx const& value) { + return value.toString(); +} + +} // end namespace Catch +// end catch_approx.cpp +// start catch_assertionhandler.cpp + +// start catch_debugger.h + +namespace Catch { + bool isDebuggerActive(); +} + +#ifdef CATCH_PLATFORM_MAC + + #define CATCH_TRAP() __asm__("int $3\n" : : ) /* NOLINT */ + +#elif defined(CATCH_PLATFORM_LINUX) + // If we can use inline assembler, do it because this allows us to break + // directly at the location of the failing check instead of breaking inside + // raise() called from it, i.e. one stack frame below. + #if defined(__GNUC__) && (defined(__i386) || defined(__x86_64)) + #define CATCH_TRAP() asm volatile ("int $3") /* NOLINT */ + #else // Fall back to the generic way. + #include + + #define CATCH_TRAP() raise(SIGTRAP) + #endif +#elif defined(_MSC_VER) + #define CATCH_TRAP() __debugbreak() +#elif defined(__MINGW32__) + extern "C" __declspec(dllimport) void __stdcall DebugBreak(); + #define CATCH_TRAP() DebugBreak() +#endif + +#ifdef CATCH_TRAP + #define CATCH_BREAK_INTO_DEBUGGER() []{ if( Catch::isDebuggerActive() ) { CATCH_TRAP(); } }() +#else + #define CATCH_BREAK_INTO_DEBUGGER() []{}() +#endif + +// end catch_debugger.h +// start catch_run_context.h + +// start catch_fatal_condition.h + +// start catch_windows_h_proxy.h + + +#if defined(CATCH_PLATFORM_WINDOWS) + +#if !defined(NOMINMAX) && !defined(CATCH_CONFIG_NO_NOMINMAX) +# define CATCH_DEFINED_NOMINMAX +# define NOMINMAX +#endif +#if !defined(WIN32_LEAN_AND_MEAN) && !defined(CATCH_CONFIG_NO_WIN32_LEAN_AND_MEAN) +# define CATCH_DEFINED_WIN32_LEAN_AND_MEAN +# define WIN32_LEAN_AND_MEAN +#endif + +#ifdef __AFXDLL +#include +#else +#include +#endif + +#ifdef CATCH_DEFINED_NOMINMAX +# undef NOMINMAX +#endif +#ifdef CATCH_DEFINED_WIN32_LEAN_AND_MEAN +# undef WIN32_LEAN_AND_MEAN +#endif + +#endif // defined(CATCH_PLATFORM_WINDOWS) + +// end catch_windows_h_proxy.h +#if defined( CATCH_CONFIG_WINDOWS_SEH ) + +namespace Catch { + + struct FatalConditionHandler { + + static LONG CALLBACK handleVectoredException(PEXCEPTION_POINTERS ExceptionInfo); + FatalConditionHandler(); + static void reset(); + ~FatalConditionHandler(); + + private: + static bool isSet; + static ULONG guaranteeSize; + static PVOID exceptionHandlerHandle; + }; + +} // namespace Catch + +#elif defined ( CATCH_CONFIG_POSIX_SIGNALS ) + +#include + +namespace Catch { + + struct FatalConditionHandler { + + static bool isSet; + static struct sigaction oldSigActions[]; + static stack_t oldSigStack; + static char altStackMem[]; + + static void handleSignal( int sig ); + + FatalConditionHandler(); + ~FatalConditionHandler(); + static void reset(); + }; + +} // namespace Catch + +#else + +namespace Catch { + struct FatalConditionHandler { + void reset(); + }; +} + +#endif + +// end catch_fatal_condition.h +#include + +namespace Catch { + + struct IMutableContext; + + /////////////////////////////////////////////////////////////////////////// + + class RunContext : public IResultCapture, public IRunner { + + public: + RunContext( RunContext const& ) = delete; + RunContext& operator =( RunContext const& ) = delete; + + explicit RunContext( IConfigPtr const& _config, IStreamingReporterPtr&& reporter ); + + ~RunContext() override; + + void testGroupStarting( std::string const& testSpec, std::size_t groupIndex, std::size_t groupsCount ); + void testGroupEnded( std::string const& testSpec, Totals const& totals, std::size_t groupIndex, std::size_t groupsCount ); + + Totals runTest(TestCase const& testCase); + + IConfigPtr config() const; + IStreamingReporter& reporter() const; + + public: // IResultCapture + + // Assertion handlers + void handleExpr + ( AssertionInfo const& info, + ITransientExpression const& expr, + AssertionReaction& reaction ) override; + void handleMessage + ( AssertionInfo const& info, + ResultWas::OfType resultType, + StringRef const& message, + AssertionReaction& reaction ) override; + void handleUnexpectedExceptionNotThrown + ( AssertionInfo const& info, + AssertionReaction& reaction ) override; + void handleUnexpectedInflightException + ( AssertionInfo const& info, + std::string const& message, + AssertionReaction& reaction ) override; + void handleIncomplete + ( AssertionInfo const& info ) override; + void handleNonExpr + ( AssertionInfo const &info, + ResultWas::OfType resultType, + AssertionReaction &reaction ) override; + + bool sectionStarted( SectionInfo const& sectionInfo, Counts& assertions ) override; + + void sectionEnded( SectionEndInfo const& endInfo ) override; + void sectionEndedEarly( SectionEndInfo const& endInfo ) override; + + auto acquireGeneratorTracker( SourceLineInfo const& lineInfo ) -> IGeneratorTracker& override; + + void benchmarkStarting( BenchmarkInfo const& info ) override; + void benchmarkEnded( BenchmarkStats const& stats ) override; + + void pushScopedMessage( MessageInfo const& message ) override; + void popScopedMessage( MessageInfo const& message ) override; + + void emplaceUnscopedMessage( MessageBuilder const& builder ) override; + + std::string getCurrentTestName() const override; + + const AssertionResult* getLastResult() const override; + + void exceptionEarlyReported() override; + + void handleFatalErrorCondition( StringRef message ) override; + + bool lastAssertionPassed() override; + + void assertionPassed() override; + + public: + // !TBD We need to do this another way! + bool aborting() const final; + + private: + + void runCurrentTest( std::string& redirectedCout, std::string& redirectedCerr ); + void invokeActiveTestCase(); + + void resetAssertionInfo(); + bool testForMissingAssertions( Counts& assertions ); + + void assertionEnded( AssertionResult const& result ); + void reportExpr + ( AssertionInfo const &info, + ResultWas::OfType resultType, + ITransientExpression const *expr, + bool negated ); + + void populateReaction( AssertionReaction& reaction ); + + private: + + void handleUnfinishedSections(); + + TestRunInfo m_runInfo; + IMutableContext& m_context; + TestCase const* m_activeTestCase = nullptr; + ITracker* m_testCaseTracker = nullptr; + Option m_lastResult; + + IConfigPtr m_config; + Totals m_totals; + IStreamingReporterPtr m_reporter; + std::vector m_messages; + std::vector m_messageScopes; /* Keeps owners of so-called unscoped messages. */ + AssertionInfo m_lastAssertionInfo; + std::vector m_unfinishedSections; + std::vector m_activeSections; + TrackerContext m_trackerContext; + bool m_lastAssertionPassed = false; + bool m_shouldReportUnexpected = true; + bool m_includeSuccessfulResults; + }; + +} // end namespace Catch + +// end catch_run_context.h +namespace Catch { + + namespace { + auto operator <<( std::ostream& os, ITransientExpression const& expr ) -> std::ostream& { + expr.streamReconstructedExpression( os ); + return os; + } + } + + LazyExpression::LazyExpression( bool isNegated ) + : m_isNegated( isNegated ) + {} + + LazyExpression::LazyExpression( LazyExpression const& other ) : m_isNegated( other.m_isNegated ) {} + + LazyExpression::operator bool() const { + return m_transientExpression != nullptr; + } + + auto operator << ( std::ostream& os, LazyExpression const& lazyExpr ) -> std::ostream& { + if( lazyExpr.m_isNegated ) + os << "!"; + + if( lazyExpr ) { + if( lazyExpr.m_isNegated && lazyExpr.m_transientExpression->isBinaryExpression() ) + os << "(" << *lazyExpr.m_transientExpression << ")"; + else + os << *lazyExpr.m_transientExpression; + } + else { + os << "{** error - unchecked empty expression requested **}"; + } + return os; + } + + AssertionHandler::AssertionHandler + ( StringRef const& macroName, + SourceLineInfo const& lineInfo, + StringRef capturedExpression, + ResultDisposition::Flags resultDisposition ) + : m_assertionInfo{ macroName, lineInfo, capturedExpression, resultDisposition }, + m_resultCapture( getResultCapture() ) + {} + + void AssertionHandler::handleExpr( ITransientExpression const& expr ) { + m_resultCapture.handleExpr( m_assertionInfo, expr, m_reaction ); + } + void AssertionHandler::handleMessage(ResultWas::OfType resultType, StringRef const& message) { + m_resultCapture.handleMessage( m_assertionInfo, resultType, message, m_reaction ); + } + + auto AssertionHandler::allowThrows() const -> bool { + return getCurrentContext().getConfig()->allowThrows(); + } + + void AssertionHandler::complete() { + setCompleted(); + if( m_reaction.shouldDebugBreak ) { + + // If you find your debugger stopping you here then go one level up on the + // call-stack for the code that caused it (typically a failed assertion) + + // (To go back to the test and change execution, jump over the throw, next) + CATCH_BREAK_INTO_DEBUGGER(); + } + if (m_reaction.shouldThrow) { +#if !defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) + throw Catch::TestFailureException(); +#else + CATCH_ERROR( "Test failure requires aborting test!" ); +#endif + } + } + void AssertionHandler::setCompleted() { + m_completed = true; + } + + void AssertionHandler::handleUnexpectedInflightException() { + m_resultCapture.handleUnexpectedInflightException( m_assertionInfo, Catch::translateActiveException(), m_reaction ); + } + + void AssertionHandler::handleExceptionThrownAsExpected() { + m_resultCapture.handleNonExpr(m_assertionInfo, ResultWas::Ok, m_reaction); + } + void AssertionHandler::handleExceptionNotThrownAsExpected() { + m_resultCapture.handleNonExpr(m_assertionInfo, ResultWas::Ok, m_reaction); + } + + void AssertionHandler::handleUnexpectedExceptionNotThrown() { + m_resultCapture.handleUnexpectedExceptionNotThrown( m_assertionInfo, m_reaction ); + } + + void AssertionHandler::handleThrowingCallSkipped() { + m_resultCapture.handleNonExpr(m_assertionInfo, ResultWas::Ok, m_reaction); + } + + // This is the overload that takes a string and infers the Equals matcher from it + // The more general overload, that takes any string matcher, is in catch_capture_matchers.cpp + void handleExceptionMatchExpr( AssertionHandler& handler, std::string const& str, StringRef const& matcherString ) { + handleExceptionMatchExpr( handler, Matchers::Equals( str ), matcherString ); + } + +} // namespace Catch +// end catch_assertionhandler.cpp +// start catch_assertionresult.cpp + +namespace Catch { + AssertionResultData::AssertionResultData(ResultWas::OfType _resultType, LazyExpression const & _lazyExpression): + lazyExpression(_lazyExpression), + resultType(_resultType) {} + + std::string AssertionResultData::reconstructExpression() const { + + if( reconstructedExpression.empty() ) { + if( lazyExpression ) { + ReusableStringStream rss; + rss << lazyExpression; + reconstructedExpression = rss.str(); + } + } + return reconstructedExpression; + } + + AssertionResult::AssertionResult( AssertionInfo const& info, AssertionResultData const& data ) + : m_info( info ), + m_resultData( data ) + {} + + // Result was a success + bool AssertionResult::succeeded() const { + return Catch::isOk( m_resultData.resultType ); + } + + // Result was a success, or failure is suppressed + bool AssertionResult::isOk() const { + return Catch::isOk( m_resultData.resultType ) || shouldSuppressFailure( m_info.resultDisposition ); + } + + ResultWas::OfType AssertionResult::getResultType() const { + return m_resultData.resultType; + } + + bool AssertionResult::hasExpression() const { + return m_info.capturedExpression[0] != 0; + } + + bool AssertionResult::hasMessage() const { + return !m_resultData.message.empty(); + } + + std::string AssertionResult::getExpression() const { + if( isFalseTest( m_info.resultDisposition ) ) + return "!(" + m_info.capturedExpression + ")"; + else + return m_info.capturedExpression; + } + + std::string AssertionResult::getExpressionInMacro() const { + std::string expr; + if( m_info.macroName[0] == 0 ) + expr = m_info.capturedExpression; + else { + expr.reserve( m_info.macroName.size() + m_info.capturedExpression.size() + 4 ); + expr += m_info.macroName; + expr += "( "; + expr += m_info.capturedExpression; + expr += " )"; + } + return expr; + } + + bool AssertionResult::hasExpandedExpression() const { + return hasExpression() && getExpandedExpression() != getExpression(); + } + + std::string AssertionResult::getExpandedExpression() const { + std::string expr = m_resultData.reconstructExpression(); + return expr.empty() + ? getExpression() + : expr; + } + + std::string AssertionResult::getMessage() const { + return m_resultData.message; + } + SourceLineInfo AssertionResult::getSourceInfo() const { + return m_info.lineInfo; + } + + StringRef AssertionResult::getTestMacroName() const { + return m_info.macroName; + } + +} // end namespace Catch +// end catch_assertionresult.cpp +// start catch_benchmark.cpp + +namespace Catch { + + auto BenchmarkLooper::getResolution() -> uint64_t { + return getEstimatedClockResolution() * getCurrentContext().getConfig()->benchmarkResolutionMultiple(); + } + + void BenchmarkLooper::reportStart() { + getResultCapture().benchmarkStarting( { m_name } ); + } + auto BenchmarkLooper::needsMoreIterations() -> bool { + auto elapsed = m_timer.getElapsedNanoseconds(); + + // Exponentially increasing iterations until we're confident in our timer resolution + if( elapsed < m_resolution ) { + m_iterationsToRun *= 10; + return true; + } + + getResultCapture().benchmarkEnded( { { m_name }, m_count, elapsed } ); + return false; + } + +} // end namespace Catch +// end catch_benchmark.cpp +// start catch_capture_matchers.cpp + +namespace Catch { + + using StringMatcher = Matchers::Impl::MatcherBase; + + // This is the general overload that takes a any string matcher + // There is another overload, in catch_assertionhandler.h/.cpp, that only takes a string and infers + // the Equals matcher (so the header does not mention matchers) + void handleExceptionMatchExpr( AssertionHandler& handler, StringMatcher const& matcher, StringRef const& matcherString ) { + std::string exceptionMessage = Catch::translateActiveException(); + MatchExpr expr( exceptionMessage, matcher, matcherString ); + handler.handleExpr( expr ); + } + +} // namespace Catch +// end catch_capture_matchers.cpp +// start catch_commandline.cpp + +// start catch_commandline.h + +// start catch_clara.h + +// Use Catch's value for console width (store Clara's off to the side, if present) +#ifdef CLARA_CONFIG_CONSOLE_WIDTH +#define CATCH_TEMP_CLARA_CONFIG_CONSOLE_WIDTH CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH +#undef CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH +#endif +#define CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH CATCH_CONFIG_CONSOLE_WIDTH-1 + +#ifdef __clang__ +#pragma clang diagnostic push +#pragma clang diagnostic ignored "-Wweak-vtables" +#pragma clang diagnostic ignored "-Wexit-time-destructors" +#pragma clang diagnostic ignored "-Wshadow" +#endif + +// start clara.hpp +// Copyright 2017 Two Blue Cubes Ltd. All rights reserved. +// +// Distributed under the Boost Software License, Version 1.0. (See accompanying +// file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt) +// +// See https://github.com/philsquared/Clara for more details + +// Clara v1.1.5 + + +#ifndef CATCH_CLARA_CONFIG_CONSOLE_WIDTH +#define CATCH_CLARA_CONFIG_CONSOLE_WIDTH 80 +#endif + +#ifndef CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH +#define CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH CATCH_CLARA_CONFIG_CONSOLE_WIDTH +#endif + +#ifndef CLARA_CONFIG_OPTIONAL_TYPE +#ifdef __has_include +#if __has_include() && __cplusplus >= 201703L +#include +#define CLARA_CONFIG_OPTIONAL_TYPE std::optional +#endif +#endif +#endif + +// ----------- #included from clara_textflow.hpp ----------- + +// TextFlowCpp +// +// A single-header library for wrapping and laying out basic text, by Phil Nash +// +// Distributed under the Boost Software License, Version 1.0. (See accompanying +// file LICENSE.txt or copy at http://www.boost.org/LICENSE_1_0.txt) +// +// This project is hosted at https://github.com/philsquared/textflowcpp + + +#include +#include +#include +#include + +#ifndef CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH +#define CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH 80 +#endif + +namespace Catch { +namespace clara { +namespace TextFlow { + +inline auto isWhitespace(char c) -> bool { + static std::string chars = " \t\n\r"; + return chars.find(c) != std::string::npos; +} +inline auto isBreakableBefore(char c) -> bool { + static std::string chars = "[({<|"; + return chars.find(c) != std::string::npos; +} +inline auto isBreakableAfter(char c) -> bool { + static std::string chars = "])}>.,:;*+-=&/\\"; + return chars.find(c) != std::string::npos; +} + +class Columns; + +class Column { + std::vector m_strings; + size_t m_width = CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH; + size_t m_indent = 0; + size_t m_initialIndent = std::string::npos; + +public: + class iterator { + friend Column; + + Column const& m_column; + size_t m_stringIndex = 0; + size_t m_pos = 0; + + size_t m_len = 0; + size_t m_end = 0; + bool m_suffix = false; + + iterator(Column const& column, size_t stringIndex) + : m_column(column), + m_stringIndex(stringIndex) {} + + auto line() const -> std::string const& { return m_column.m_strings[m_stringIndex]; } + + auto isBoundary(size_t at) const -> bool { + assert(at > 0); + assert(at <= line().size()); + + return at == line().size() || + (isWhitespace(line()[at]) && !isWhitespace(line()[at - 1])) || + isBreakableBefore(line()[at]) || + isBreakableAfter(line()[at - 1]); + } + + void calcLength() { + assert(m_stringIndex < m_column.m_strings.size()); + + m_suffix = false; + auto width = m_column.m_width - indent(); + m_end = m_pos; + while (m_end < line().size() && line()[m_end] != '\n') + ++m_end; + + if (m_end < m_pos + width) { + m_len = m_end - m_pos; + } else { + size_t len = width; + while (len > 0 && !isBoundary(m_pos + len)) + --len; + while (len > 0 && isWhitespace(line()[m_pos + len - 1])) + --len; + + if (len > 0) { + m_len = len; + } else { + m_suffix = true; + m_len = width - 1; + } + } + } + + auto indent() const -> size_t { + auto initial = m_pos == 0 && m_stringIndex == 0 ? m_column.m_initialIndent : std::string::npos; + return initial == std::string::npos ? m_column.m_indent : initial; + } + + auto addIndentAndSuffix(std::string const &plain) const -> std::string { + return std::string(indent(), ' ') + (m_suffix ? plain + "-" : plain); + } + + public: + using difference_type = std::ptrdiff_t; + using value_type = std::string; + using pointer = value_type * ; + using reference = value_type & ; + using iterator_category = std::forward_iterator_tag; + + explicit iterator(Column const& column) : m_column(column) { + assert(m_column.m_width > m_column.m_indent); + assert(m_column.m_initialIndent == std::string::npos || m_column.m_width > m_column.m_initialIndent); + calcLength(); + if (m_len == 0) + m_stringIndex++; // Empty string + } + + auto operator *() const -> std::string { + assert(m_stringIndex < m_column.m_strings.size()); + assert(m_pos <= m_end); + return addIndentAndSuffix(line().substr(m_pos, m_len)); + } + + auto operator ++() -> iterator& { + m_pos += m_len; + if (m_pos < line().size() && line()[m_pos] == '\n') + m_pos += 1; + else + while (m_pos < line().size() && isWhitespace(line()[m_pos])) + ++m_pos; + + if (m_pos == line().size()) { + m_pos = 0; + ++m_stringIndex; + } + if (m_stringIndex < m_column.m_strings.size()) + calcLength(); + return *this; + } + auto operator ++(int) -> iterator { + iterator prev(*this); + operator++(); + return prev; + } + + auto operator ==(iterator const& other) const -> bool { + return + m_pos == other.m_pos && + m_stringIndex == other.m_stringIndex && + &m_column == &other.m_column; + } + auto operator !=(iterator const& other) const -> bool { + return !operator==(other); + } + }; + using const_iterator = iterator; + + explicit Column(std::string const& text) { m_strings.push_back(text); } + + auto width(size_t newWidth) -> Column& { + assert(newWidth > 0); + m_width = newWidth; + return *this; + } + auto indent(size_t newIndent) -> Column& { + m_indent = newIndent; + return *this; + } + auto initialIndent(size_t newIndent) -> Column& { + m_initialIndent = newIndent; + return *this; + } + + auto width() const -> size_t { return m_width; } + auto begin() const -> iterator { return iterator(*this); } + auto end() const -> iterator { return { *this, m_strings.size() }; } + + inline friend std::ostream& operator << (std::ostream& os, Column const& col) { + bool first = true; + for (auto line : col) { + if (first) + first = false; + else + os << "\n"; + os << line; + } + return os; + } + + auto operator + (Column const& other)->Columns; + + auto toString() const -> std::string { + std::ostringstream oss; + oss << *this; + return oss.str(); + } +}; + +class Spacer : public Column { + +public: + explicit Spacer(size_t spaceWidth) : Column("") { + width(spaceWidth); + } +}; + +class Columns { + std::vector m_columns; + +public: + + class iterator { + friend Columns; + struct EndTag {}; + + std::vector const& m_columns; + std::vector m_iterators; + size_t m_activeIterators; + + iterator(Columns const& columns, EndTag) + : m_columns(columns.m_columns), + m_activeIterators(0) { + m_iterators.reserve(m_columns.size()); + + for (auto const& col : m_columns) + m_iterators.push_back(col.end()); + } + + public: + using difference_type = std::ptrdiff_t; + using value_type = std::string; + using pointer = value_type * ; + using reference = value_type & ; + using iterator_category = std::forward_iterator_tag; + + explicit iterator(Columns const& columns) + : m_columns(columns.m_columns), + m_activeIterators(m_columns.size()) { + m_iterators.reserve(m_columns.size()); + + for (auto const& col : m_columns) + m_iterators.push_back(col.begin()); + } + + auto operator ==(iterator const& other) const -> bool { + return m_iterators == other.m_iterators; + } + auto operator !=(iterator const& other) const -> bool { + return m_iterators != other.m_iterators; + } + auto operator *() const -> std::string { + std::string row, padding; + + for (size_t i = 0; i < m_columns.size(); ++i) { + auto width = m_columns[i].width(); + if (m_iterators[i] != m_columns[i].end()) { + std::string col = *m_iterators[i]; + row += padding + col; + if (col.size() < width) + padding = std::string(width - col.size(), ' '); + else + padding = ""; + } else { + padding += std::string(width, ' '); + } + } + return row; + } + auto operator ++() -> iterator& { + for (size_t i = 0; i < m_columns.size(); ++i) { + if (m_iterators[i] != m_columns[i].end()) + ++m_iterators[i]; + } + return *this; + } + auto operator ++(int) -> iterator { + iterator prev(*this); + operator++(); + return prev; + } + }; + using const_iterator = iterator; + + auto begin() const -> iterator { return iterator(*this); } + auto end() const -> iterator { return { *this, iterator::EndTag() }; } + + auto operator += (Column const& col) -> Columns& { + m_columns.push_back(col); + return *this; + } + auto operator + (Column const& col) -> Columns { + Columns combined = *this; + combined += col; + return combined; + } + + inline friend std::ostream& operator << (std::ostream& os, Columns const& cols) { + + bool first = true; + for (auto line : cols) { + if (first) + first = false; + else + os << "\n"; + os << line; + } + return os; + } + + auto toString() const -> std::string { + std::ostringstream oss; + oss << *this; + return oss.str(); + } +}; + +inline auto Column::operator + (Column const& other) -> Columns { + Columns cols; + cols += *this; + cols += other; + return cols; +} +} + +} +} + +// ----------- end of #include from clara_textflow.hpp ----------- +// ........... back in clara.hpp + +#include +#include +#include +#include +#include + +#if !defined(CATCH_PLATFORM_WINDOWS) && ( defined(WIN32) || defined(__WIN32__) || defined(_WIN32) || defined(_MSC_VER) ) +#define CATCH_PLATFORM_WINDOWS +#endif + +namespace Catch { namespace clara { +namespace detail { + + // Traits for extracting arg and return type of lambdas (for single argument lambdas) + template + struct UnaryLambdaTraits : UnaryLambdaTraits {}; + + template + struct UnaryLambdaTraits { + static const bool isValid = false; + }; + + template + struct UnaryLambdaTraits { + static const bool isValid = true; + using ArgType = typename std::remove_const::type>::type; + using ReturnType = ReturnT; + }; + + class TokenStream; + + // Transport for raw args (copied from main args, or supplied via init list for testing) + class Args { + friend TokenStream; + std::string m_exeName; + std::vector m_args; + + public: + Args( int argc, char const* const* argv ) + : m_exeName(argv[0]), + m_args(argv + 1, argv + argc) {} + + Args( std::initializer_list args ) + : m_exeName( *args.begin() ), + m_args( args.begin()+1, args.end() ) + {} + + auto exeName() const -> std::string { + return m_exeName; + } + }; + + // Wraps a token coming from a token stream. These may not directly correspond to strings as a single string + // may encode an option + its argument if the : or = form is used + enum class TokenType { + Option, Argument + }; + struct Token { + TokenType type; + std::string token; + }; + + inline auto isOptPrefix( char c ) -> bool { + return c == '-' +#ifdef CATCH_PLATFORM_WINDOWS + || c == '/' +#endif + ; + } + + // Abstracts iterators into args as a stream of tokens, with option arguments uniformly handled + class TokenStream { + using Iterator = std::vector::const_iterator; + Iterator it; + Iterator itEnd; + std::vector m_tokenBuffer; + + void loadBuffer() { + m_tokenBuffer.resize( 0 ); + + // Skip any empty strings + while( it != itEnd && it->empty() ) + ++it; + + if( it != itEnd ) { + auto const &next = *it; + if( isOptPrefix( next[0] ) ) { + auto delimiterPos = next.find_first_of( " :=" ); + if( delimiterPos != std::string::npos ) { + m_tokenBuffer.push_back( { TokenType::Option, next.substr( 0, delimiterPos ) } ); + m_tokenBuffer.push_back( { TokenType::Argument, next.substr( delimiterPos + 1 ) } ); + } else { + if( next[1] != '-' && next.size() > 2 ) { + std::string opt = "- "; + for( size_t i = 1; i < next.size(); ++i ) { + opt[1] = next[i]; + m_tokenBuffer.push_back( { TokenType::Option, opt } ); + } + } else { + m_tokenBuffer.push_back( { TokenType::Option, next } ); + } + } + } else { + m_tokenBuffer.push_back( { TokenType::Argument, next } ); + } + } + } + + public: + explicit TokenStream( Args const &args ) : TokenStream( args.m_args.begin(), args.m_args.end() ) {} + + TokenStream( Iterator it, Iterator itEnd ) : it( it ), itEnd( itEnd ) { + loadBuffer(); + } + + explicit operator bool() const { + return !m_tokenBuffer.empty() || it != itEnd; + } + + auto count() const -> size_t { return m_tokenBuffer.size() + (itEnd - it); } + + auto operator*() const -> Token { + assert( !m_tokenBuffer.empty() ); + return m_tokenBuffer.front(); + } + + auto operator->() const -> Token const * { + assert( !m_tokenBuffer.empty() ); + return &m_tokenBuffer.front(); + } + + auto operator++() -> TokenStream & { + if( m_tokenBuffer.size() >= 2 ) { + m_tokenBuffer.erase( m_tokenBuffer.begin() ); + } else { + if( it != itEnd ) + ++it; + loadBuffer(); + } + return *this; + } + }; + + class ResultBase { + public: + enum Type { + Ok, LogicError, RuntimeError + }; + + protected: + ResultBase( Type type ) : m_type( type ) {} + virtual ~ResultBase() = default; + + virtual void enforceOk() const = 0; + + Type m_type; + }; + + template + class ResultValueBase : public ResultBase { + public: + auto value() const -> T const & { + enforceOk(); + return m_value; + } + + protected: + ResultValueBase( Type type ) : ResultBase( type ) {} + + ResultValueBase( ResultValueBase const &other ) : ResultBase( other ) { + if( m_type == ResultBase::Ok ) + new( &m_value ) T( other.m_value ); + } + + ResultValueBase( Type, T const &value ) : ResultBase( Ok ) { + new( &m_value ) T( value ); + } + + auto operator=( ResultValueBase const &other ) -> ResultValueBase & { + if( m_type == ResultBase::Ok ) + m_value.~T(); + ResultBase::operator=(other); + if( m_type == ResultBase::Ok ) + new( &m_value ) T( other.m_value ); + return *this; + } + + ~ResultValueBase() override { + if( m_type == Ok ) + m_value.~T(); + } + + union { + T m_value; + }; + }; + + template<> + class ResultValueBase : public ResultBase { + protected: + using ResultBase::ResultBase; + }; + + template + class BasicResult : public ResultValueBase { + public: + template + explicit BasicResult( BasicResult const &other ) + : ResultValueBase( other.type() ), + m_errorMessage( other.errorMessage() ) + { + assert( type() != ResultBase::Ok ); + } + + template + static auto ok( U const &value ) -> BasicResult { return { ResultBase::Ok, value }; } + static auto ok() -> BasicResult { return { ResultBase::Ok }; } + static auto logicError( std::string const &message ) -> BasicResult { return { ResultBase::LogicError, message }; } + static auto runtimeError( std::string const &message ) -> BasicResult { return { ResultBase::RuntimeError, message }; } + + explicit operator bool() const { return m_type == ResultBase::Ok; } + auto type() const -> ResultBase::Type { return m_type; } + auto errorMessage() const -> std::string { return m_errorMessage; } + + protected: + void enforceOk() const override { + + // Errors shouldn't reach this point, but if they do + // the actual error message will be in m_errorMessage + assert( m_type != ResultBase::LogicError ); + assert( m_type != ResultBase::RuntimeError ); + if( m_type != ResultBase::Ok ) + std::abort(); + } + + std::string m_errorMessage; // Only populated if resultType is an error + + BasicResult( ResultBase::Type type, std::string const &message ) + : ResultValueBase(type), + m_errorMessage(message) + { + assert( m_type != ResultBase::Ok ); + } + + using ResultValueBase::ResultValueBase; + using ResultBase::m_type; + }; + + enum class ParseResultType { + Matched, NoMatch, ShortCircuitAll, ShortCircuitSame + }; + + class ParseState { + public: + + ParseState( ParseResultType type, TokenStream const &remainingTokens ) + : m_type(type), + m_remainingTokens( remainingTokens ) + {} + + auto type() const -> ParseResultType { return m_type; } + auto remainingTokens() const -> TokenStream { return m_remainingTokens; } + + private: + ParseResultType m_type; + TokenStream m_remainingTokens; + }; + + using Result = BasicResult; + using ParserResult = BasicResult; + using InternalParseResult = BasicResult; + + struct HelpColumns { + std::string left; + std::string right; + }; + + template + inline auto convertInto( std::string const &source, T& target ) -> ParserResult { + std::stringstream ss; + ss << source; + ss >> target; + if( ss.fail() ) + return ParserResult::runtimeError( "Unable to convert '" + source + "' to destination type" ); + else + return ParserResult::ok( ParseResultType::Matched ); + } + inline auto convertInto( std::string const &source, std::string& target ) -> ParserResult { + target = source; + return ParserResult::ok( ParseResultType::Matched ); + } + inline auto convertInto( std::string const &source, bool &target ) -> ParserResult { + std::string srcLC = source; + std::transform( srcLC.begin(), srcLC.end(), srcLC.begin(), []( char c ) { return static_cast( std::tolower(c) ); } ); + if (srcLC == "y" || srcLC == "1" || srcLC == "true" || srcLC == "yes" || srcLC == "on") + target = true; + else if (srcLC == "n" || srcLC == "0" || srcLC == "false" || srcLC == "no" || srcLC == "off") + target = false; + else + return ParserResult::runtimeError( "Expected a boolean value but did not recognise: '" + source + "'" ); + return ParserResult::ok( ParseResultType::Matched ); + } +#ifdef CLARA_CONFIG_OPTIONAL_TYPE + template + inline auto convertInto( std::string const &source, CLARA_CONFIG_OPTIONAL_TYPE& target ) -> ParserResult { + T temp; + auto result = convertInto( source, temp ); + if( result ) + target = std::move(temp); + return result; + } +#endif // CLARA_CONFIG_OPTIONAL_TYPE + + struct NonCopyable { + NonCopyable() = default; + NonCopyable( NonCopyable const & ) = delete; + NonCopyable( NonCopyable && ) = delete; + NonCopyable &operator=( NonCopyable const & ) = delete; + NonCopyable &operator=( NonCopyable && ) = delete; + }; + + struct BoundRef : NonCopyable { + virtual ~BoundRef() = default; + virtual auto isContainer() const -> bool { return false; } + virtual auto isFlag() const -> bool { return false; } + }; + struct BoundValueRefBase : BoundRef { + virtual auto setValue( std::string const &arg ) -> ParserResult = 0; + }; + struct BoundFlagRefBase : BoundRef { + virtual auto setFlag( bool flag ) -> ParserResult = 0; + virtual auto isFlag() const -> bool { return true; } + }; + + template + struct BoundValueRef : BoundValueRefBase { + T &m_ref; + + explicit BoundValueRef( T &ref ) : m_ref( ref ) {} + + auto setValue( std::string const &arg ) -> ParserResult override { + return convertInto( arg, m_ref ); + } + }; + + template + struct BoundValueRef> : BoundValueRefBase { + std::vector &m_ref; + + explicit BoundValueRef( std::vector &ref ) : m_ref( ref ) {} + + auto isContainer() const -> bool override { return true; } + + auto setValue( std::string const &arg ) -> ParserResult override { + T temp; + auto result = convertInto( arg, temp ); + if( result ) + m_ref.push_back( temp ); + return result; + } + }; + + struct BoundFlagRef : BoundFlagRefBase { + bool &m_ref; + + explicit BoundFlagRef( bool &ref ) : m_ref( ref ) {} + + auto setFlag( bool flag ) -> ParserResult override { + m_ref = flag; + return ParserResult::ok( ParseResultType::Matched ); + } + }; + + template + struct LambdaInvoker { + static_assert( std::is_same::value, "Lambda must return void or clara::ParserResult" ); + + template + static auto invoke( L const &lambda, ArgType const &arg ) -> ParserResult { + return lambda( arg ); + } + }; + + template<> + struct LambdaInvoker { + template + static auto invoke( L const &lambda, ArgType const &arg ) -> ParserResult { + lambda( arg ); + return ParserResult::ok( ParseResultType::Matched ); + } + }; + + template + inline auto invokeLambda( L const &lambda, std::string const &arg ) -> ParserResult { + ArgType temp{}; + auto result = convertInto( arg, temp ); + return !result + ? result + : LambdaInvoker::ReturnType>::invoke( lambda, temp ); + } + + template + struct BoundLambda : BoundValueRefBase { + L m_lambda; + + static_assert( UnaryLambdaTraits::isValid, "Supplied lambda must take exactly one argument" ); + explicit BoundLambda( L const &lambda ) : m_lambda( lambda ) {} + + auto setValue( std::string const &arg ) -> ParserResult override { + return invokeLambda::ArgType>( m_lambda, arg ); + } + }; + + template + struct BoundFlagLambda : BoundFlagRefBase { + L m_lambda; + + static_assert( UnaryLambdaTraits::isValid, "Supplied lambda must take exactly one argument" ); + static_assert( std::is_same::ArgType, bool>::value, "flags must be boolean" ); + + explicit BoundFlagLambda( L const &lambda ) : m_lambda( lambda ) {} + + auto setFlag( bool flag ) -> ParserResult override { + return LambdaInvoker::ReturnType>::invoke( m_lambda, flag ); + } + }; + + enum class Optionality { Optional, Required }; + + struct Parser; + + class ParserBase { + public: + virtual ~ParserBase() = default; + virtual auto validate() const -> Result { return Result::ok(); } + virtual auto parse( std::string const& exeName, TokenStream const &tokens) const -> InternalParseResult = 0; + virtual auto cardinality() const -> size_t { return 1; } + + auto parse( Args const &args ) const -> InternalParseResult { + return parse( args.exeName(), TokenStream( args ) ); + } + }; + + template + class ComposableParserImpl : public ParserBase { + public: + template + auto operator|( T const &other ) const -> Parser; + + template + auto operator+( T const &other ) const -> Parser; + }; + + // Common code and state for Args and Opts + template + class ParserRefImpl : public ComposableParserImpl { + protected: + Optionality m_optionality = Optionality::Optional; + std::shared_ptr m_ref; + std::string m_hint; + std::string m_description; + + explicit ParserRefImpl( std::shared_ptr const &ref ) : m_ref( ref ) {} + + public: + template + ParserRefImpl( T &ref, std::string const &hint ) + : m_ref( std::make_shared>( ref ) ), + m_hint( hint ) + {} + + template + ParserRefImpl( LambdaT const &ref, std::string const &hint ) + : m_ref( std::make_shared>( ref ) ), + m_hint(hint) + {} + + auto operator()( std::string const &description ) -> DerivedT & { + m_description = description; + return static_cast( *this ); + } + + auto optional() -> DerivedT & { + m_optionality = Optionality::Optional; + return static_cast( *this ); + }; + + auto required() -> DerivedT & { + m_optionality = Optionality::Required; + return static_cast( *this ); + }; + + auto isOptional() const -> bool { + return m_optionality == Optionality::Optional; + } + + auto cardinality() const -> size_t override { + if( m_ref->isContainer() ) + return 0; + else + return 1; + } + + auto hint() const -> std::string { return m_hint; } + }; + + class ExeName : public ComposableParserImpl { + std::shared_ptr m_name; + std::shared_ptr m_ref; + + template + static auto makeRef(LambdaT const &lambda) -> std::shared_ptr { + return std::make_shared>( lambda) ; + } + + public: + ExeName() : m_name( std::make_shared( "" ) ) {} + + explicit ExeName( std::string &ref ) : ExeName() { + m_ref = std::make_shared>( ref ); + } + + template + explicit ExeName( LambdaT const& lambda ) : ExeName() { + m_ref = std::make_shared>( lambda ); + } + + // The exe name is not parsed out of the normal tokens, but is handled specially + auto parse( std::string const&, TokenStream const &tokens ) const -> InternalParseResult override { + return InternalParseResult::ok( ParseState( ParseResultType::NoMatch, tokens ) ); + } + + auto name() const -> std::string { return *m_name; } + auto set( std::string const& newName ) -> ParserResult { + + auto lastSlash = newName.find_last_of( "\\/" ); + auto filename = ( lastSlash == std::string::npos ) + ? newName + : newName.substr( lastSlash+1 ); + + *m_name = filename; + if( m_ref ) + return m_ref->setValue( filename ); + else + return ParserResult::ok( ParseResultType::Matched ); + } + }; + + class Arg : public ParserRefImpl { + public: + using ParserRefImpl::ParserRefImpl; + + auto parse( std::string const &, TokenStream const &tokens ) const -> InternalParseResult override { + auto validationResult = validate(); + if( !validationResult ) + return InternalParseResult( validationResult ); + + auto remainingTokens = tokens; + auto const &token = *remainingTokens; + if( token.type != TokenType::Argument ) + return InternalParseResult::ok( ParseState( ParseResultType::NoMatch, remainingTokens ) ); + + assert( !m_ref->isFlag() ); + auto valueRef = static_cast( m_ref.get() ); + + auto result = valueRef->setValue( remainingTokens->token ); + if( !result ) + return InternalParseResult( result ); + else + return InternalParseResult::ok( ParseState( ParseResultType::Matched, ++remainingTokens ) ); + } + }; + + inline auto normaliseOpt( std::string const &optName ) -> std::string { +#ifdef CATCH_PLATFORM_WINDOWS + if( optName[0] == '/' ) + return "-" + optName.substr( 1 ); + else +#endif + return optName; + } + + class Opt : public ParserRefImpl { + protected: + std::vector m_optNames; + + public: + template + explicit Opt( LambdaT const &ref ) : ParserRefImpl( std::make_shared>( ref ) ) {} + + explicit Opt( bool &ref ) : ParserRefImpl( std::make_shared( ref ) ) {} + + template + Opt( LambdaT const &ref, std::string const &hint ) : ParserRefImpl( ref, hint ) {} + + template + Opt( T &ref, std::string const &hint ) : ParserRefImpl( ref, hint ) {} + + auto operator[]( std::string const &optName ) -> Opt & { + m_optNames.push_back( optName ); + return *this; + } + + auto getHelpColumns() const -> std::vector { + std::ostringstream oss; + bool first = true; + for( auto const &opt : m_optNames ) { + if (first) + first = false; + else + oss << ", "; + oss << opt; + } + if( !m_hint.empty() ) + oss << " <" << m_hint << ">"; + return { { oss.str(), m_description } }; + } + + auto isMatch( std::string const &optToken ) const -> bool { + auto normalisedToken = normaliseOpt( optToken ); + for( auto const &name : m_optNames ) { + if( normaliseOpt( name ) == normalisedToken ) + return true; + } + return false; + } + + using ParserBase::parse; + + auto parse( std::string const&, TokenStream const &tokens ) const -> InternalParseResult override { + auto validationResult = validate(); + if( !validationResult ) + return InternalParseResult( validationResult ); + + auto remainingTokens = tokens; + if( remainingTokens && remainingTokens->type == TokenType::Option ) { + auto const &token = *remainingTokens; + if( isMatch(token.token ) ) { + if( m_ref->isFlag() ) { + auto flagRef = static_cast( m_ref.get() ); + auto result = flagRef->setFlag( true ); + if( !result ) + return InternalParseResult( result ); + if( result.value() == ParseResultType::ShortCircuitAll ) + return InternalParseResult::ok( ParseState( result.value(), remainingTokens ) ); + } else { + auto valueRef = static_cast( m_ref.get() ); + ++remainingTokens; + if( !remainingTokens ) + return InternalParseResult::runtimeError( "Expected argument following " + token.token ); + auto const &argToken = *remainingTokens; + if( argToken.type != TokenType::Argument ) + return InternalParseResult::runtimeError( "Expected argument following " + token.token ); + auto result = valueRef->setValue( argToken.token ); + if( !result ) + return InternalParseResult( result ); + if( result.value() == ParseResultType::ShortCircuitAll ) + return InternalParseResult::ok( ParseState( result.value(), remainingTokens ) ); + } + return InternalParseResult::ok( ParseState( ParseResultType::Matched, ++remainingTokens ) ); + } + } + return InternalParseResult::ok( ParseState( ParseResultType::NoMatch, remainingTokens ) ); + } + + auto validate() const -> Result override { + if( m_optNames.empty() ) + return Result::logicError( "No options supplied to Opt" ); + for( auto const &name : m_optNames ) { + if( name.empty() ) + return Result::logicError( "Option name cannot be empty" ); +#ifdef CATCH_PLATFORM_WINDOWS + if( name[0] != '-' && name[0] != '/' ) + return Result::logicError( "Option name must begin with '-' or '/'" ); +#else + if( name[0] != '-' ) + return Result::logicError( "Option name must begin with '-'" ); +#endif + } + return ParserRefImpl::validate(); + } + }; + + struct Help : Opt { + Help( bool &showHelpFlag ) + : Opt([&]( bool flag ) { + showHelpFlag = flag; + return ParserResult::ok( ParseResultType::ShortCircuitAll ); + }) + { + static_cast( *this ) + ("display usage information") + ["-?"]["-h"]["--help"] + .optional(); + } + }; + + struct Parser : ParserBase { + + mutable ExeName m_exeName; + std::vector m_options; + std::vector m_args; + + auto operator|=( ExeName const &exeName ) -> Parser & { + m_exeName = exeName; + return *this; + } + + auto operator|=( Arg const &arg ) -> Parser & { + m_args.push_back(arg); + return *this; + } + + auto operator|=( Opt const &opt ) -> Parser & { + m_options.push_back(opt); + return *this; + } + + auto operator|=( Parser const &other ) -> Parser & { + m_options.insert(m_options.end(), other.m_options.begin(), other.m_options.end()); + m_args.insert(m_args.end(), other.m_args.begin(), other.m_args.end()); + return *this; + } + + template + auto operator|( T const &other ) const -> Parser { + return Parser( *this ) |= other; + } + + // Forward deprecated interface with '+' instead of '|' + template + auto operator+=( T const &other ) -> Parser & { return operator|=( other ); } + template + auto operator+( T const &other ) const -> Parser { return operator|( other ); } + + auto getHelpColumns() const -> std::vector { + std::vector cols; + for (auto const &o : m_options) { + auto childCols = o.getHelpColumns(); + cols.insert( cols.end(), childCols.begin(), childCols.end() ); + } + return cols; + } + + void writeToStream( std::ostream &os ) const { + if (!m_exeName.name().empty()) { + os << "usage:\n" << " " << m_exeName.name() << " "; + bool required = true, first = true; + for( auto const &arg : m_args ) { + if (first) + first = false; + else + os << " "; + if( arg.isOptional() && required ) { + os << "["; + required = false; + } + os << "<" << arg.hint() << ">"; + if( arg.cardinality() == 0 ) + os << " ... "; + } + if( !required ) + os << "]"; + if( !m_options.empty() ) + os << " options"; + os << "\n\nwhere options are:" << std::endl; + } + + auto rows = getHelpColumns(); + size_t consoleWidth = CATCH_CLARA_CONFIG_CONSOLE_WIDTH; + size_t optWidth = 0; + for( auto const &cols : rows ) + optWidth = (std::max)(optWidth, cols.left.size() + 2); + + optWidth = (std::min)(optWidth, consoleWidth/2); + + for( auto const &cols : rows ) { + auto row = + TextFlow::Column( cols.left ).width( optWidth ).indent( 2 ) + + TextFlow::Spacer(4) + + TextFlow::Column( cols.right ).width( consoleWidth - 7 - optWidth ); + os << row << std::endl; + } + } + + friend auto operator<<( std::ostream &os, Parser const &parser ) -> std::ostream& { + parser.writeToStream( os ); + return os; + } + + auto validate() const -> Result override { + for( auto const &opt : m_options ) { + auto result = opt.validate(); + if( !result ) + return result; + } + for( auto const &arg : m_args ) { + auto result = arg.validate(); + if( !result ) + return result; + } + return Result::ok(); + } + + using ParserBase::parse; + + auto parse( std::string const& exeName, TokenStream const &tokens ) const -> InternalParseResult override { + + struct ParserInfo { + ParserBase const* parser = nullptr; + size_t count = 0; + }; + const size_t totalParsers = m_options.size() + m_args.size(); + assert( totalParsers < 512 ); + // ParserInfo parseInfos[totalParsers]; // <-- this is what we really want to do + ParserInfo parseInfos[512]; + + { + size_t i = 0; + for (auto const &opt : m_options) parseInfos[i++].parser = &opt; + for (auto const &arg : m_args) parseInfos[i++].parser = &arg; + } + + m_exeName.set( exeName ); + + auto result = InternalParseResult::ok( ParseState( ParseResultType::NoMatch, tokens ) ); + while( result.value().remainingTokens() ) { + bool tokenParsed = false; + + for( size_t i = 0; i < totalParsers; ++i ) { + auto& parseInfo = parseInfos[i]; + if( parseInfo.parser->cardinality() == 0 || parseInfo.count < parseInfo.parser->cardinality() ) { + result = parseInfo.parser->parse(exeName, result.value().remainingTokens()); + if (!result) + return result; + if (result.value().type() != ParseResultType::NoMatch) { + tokenParsed = true; + ++parseInfo.count; + break; + } + } + } + + if( result.value().type() == ParseResultType::ShortCircuitAll ) + return result; + if( !tokenParsed ) + return InternalParseResult::runtimeError( "Unrecognised token: " + result.value().remainingTokens()->token ); + } + // !TBD Check missing required options + return result; + } + }; + + template + template + auto ComposableParserImpl::operator|( T const &other ) const -> Parser { + return Parser() | static_cast( *this ) | other; + } +} // namespace detail + +// A Combined parser +using detail::Parser; + +// A parser for options +using detail::Opt; + +// A parser for arguments +using detail::Arg; + +// Wrapper for argc, argv from main() +using detail::Args; + +// Specifies the name of the executable +using detail::ExeName; + +// Convenience wrapper for option parser that specifies the help option +using detail::Help; + +// enum of result types from a parse +using detail::ParseResultType; + +// Result type for parser operation +using detail::ParserResult; + +}} // namespace Catch::clara + +// end clara.hpp +#ifdef __clang__ +#pragma clang diagnostic pop +#endif + +// Restore Clara's value for console width, if present +#ifdef CATCH_TEMP_CLARA_CONFIG_CONSOLE_WIDTH +#define CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH CATCH_TEMP_CLARA_CONFIG_CONSOLE_WIDTH +#undef CATCH_TEMP_CLARA_CONFIG_CONSOLE_WIDTH +#endif + +// end catch_clara.h +namespace Catch { + + clara::Parser makeCommandLineParser( ConfigData& config ); + +} // end namespace Catch + +// end catch_commandline.h +#include +#include + +namespace Catch { + + clara::Parser makeCommandLineParser( ConfigData& config ) { + + using namespace clara; + + auto const setWarning = [&]( std::string const& warning ) { + auto warningSet = [&]() { + if( warning == "NoAssertions" ) + return WarnAbout::NoAssertions; + + if ( warning == "NoTests" ) + return WarnAbout::NoTests; + + return WarnAbout::Nothing; + }(); + + if (warningSet == WarnAbout::Nothing) + return ParserResult::runtimeError( "Unrecognised warning: '" + warning + "'" ); + config.warnings = static_cast( config.warnings | warningSet ); + return ParserResult::ok( ParseResultType::Matched ); + }; + auto const loadTestNamesFromFile = [&]( std::string const& filename ) { + std::ifstream f( filename.c_str() ); + if( !f.is_open() ) + return ParserResult::runtimeError( "Unable to load input file: '" + filename + "'" ); + + std::string line; + while( std::getline( f, line ) ) { + line = trim(line); + if( !line.empty() && !startsWith( line, '#' ) ) { + if( !startsWith( line, '"' ) ) + line = '"' + line + '"'; + config.testsOrTags.push_back( line + ',' ); + } + } + return ParserResult::ok( ParseResultType::Matched ); + }; + auto const setTestOrder = [&]( std::string const& order ) { + if( startsWith( "declared", order ) ) + config.runOrder = RunTests::InDeclarationOrder; + else if( startsWith( "lexical", order ) ) + config.runOrder = RunTests::InLexicographicalOrder; + else if( startsWith( "random", order ) ) + config.runOrder = RunTests::InRandomOrder; + else + return clara::ParserResult::runtimeError( "Unrecognised ordering: '" + order + "'" ); + return ParserResult::ok( ParseResultType::Matched ); + }; + auto const setRngSeed = [&]( std::string const& seed ) { + if( seed != "time" ) + return clara::detail::convertInto( seed, config.rngSeed ); + config.rngSeed = static_cast( std::time(nullptr) ); + return ParserResult::ok( ParseResultType::Matched ); + }; + auto const setColourUsage = [&]( std::string const& useColour ) { + auto mode = toLower( useColour ); + + if( mode == "yes" ) + config.useColour = UseColour::Yes; + else if( mode == "no" ) + config.useColour = UseColour::No; + else if( mode == "auto" ) + config.useColour = UseColour::Auto; + else + return ParserResult::runtimeError( "colour mode must be one of: auto, yes or no. '" + useColour + "' not recognised" ); + return ParserResult::ok( ParseResultType::Matched ); + }; + auto const setWaitForKeypress = [&]( std::string const& keypress ) { + auto keypressLc = toLower( keypress ); + if( keypressLc == "start" ) + config.waitForKeypress = WaitForKeypress::BeforeStart; + else if( keypressLc == "exit" ) + config.waitForKeypress = WaitForKeypress::BeforeExit; + else if( keypressLc == "both" ) + config.waitForKeypress = WaitForKeypress::BeforeStartAndExit; + else + return ParserResult::runtimeError( "keypress argument must be one of: start, exit or both. '" + keypress + "' not recognised" ); + return ParserResult::ok( ParseResultType::Matched ); + }; + auto const setVerbosity = [&]( std::string const& verbosity ) { + auto lcVerbosity = toLower( verbosity ); + if( lcVerbosity == "quiet" ) + config.verbosity = Verbosity::Quiet; + else if( lcVerbosity == "normal" ) + config.verbosity = Verbosity::Normal; + else if( lcVerbosity == "high" ) + config.verbosity = Verbosity::High; + else + return ParserResult::runtimeError( "Unrecognised verbosity, '" + verbosity + "'" ); + return ParserResult::ok( ParseResultType::Matched ); + }; + auto const setReporter = [&]( std::string const& reporter ) { + IReporterRegistry::FactoryMap const& factories = getRegistryHub().getReporterRegistry().getFactories(); + + auto lcReporter = toLower( reporter ); + auto result = factories.find( lcReporter ); + + if( factories.end() != result ) + config.reporterName = lcReporter; + else + return ParserResult::runtimeError( "Unrecognized reporter, '" + reporter + "'. Check available with --list-reporters" ); + return ParserResult::ok( ParseResultType::Matched ); + }; + + auto cli + = ExeName( config.processName ) + | Help( config.showHelp ) + | Opt( config.listTests ) + ["-l"]["--list-tests"] + ( "list all/matching test cases" ) + | Opt( config.listTags ) + ["-t"]["--list-tags"] + ( "list all/matching tags" ) + | Opt( config.showSuccessfulTests ) + ["-s"]["--success"] + ( "include successful tests in output" ) + | Opt( config.shouldDebugBreak ) + ["-b"]["--break"] + ( "break into debugger on failure" ) + | Opt( config.noThrow ) + ["-e"]["--nothrow"] + ( "skip exception tests" ) + | Opt( config.showInvisibles ) + ["-i"]["--invisibles"] + ( "show invisibles (tabs, newlines)" ) + | Opt( config.outputFilename, "filename" ) + ["-o"]["--out"] + ( "output filename" ) + | Opt( setReporter, "name" ) + ["-r"]["--reporter"] + ( "reporter to use (defaults to console)" ) + | Opt( config.name, "name" ) + ["-n"]["--name"] + ( "suite name" ) + | Opt( [&]( bool ){ config.abortAfter = 1; } ) + ["-a"]["--abort"] + ( "abort at first failure" ) + | Opt( [&]( int x ){ config.abortAfter = x; }, "no. failures" ) + ["-x"]["--abortx"] + ( "abort after x failures" ) + | Opt( setWarning, "warning name" ) + ["-w"]["--warn"] + ( "enable warnings" ) + | Opt( [&]( bool flag ) { config.showDurations = flag ? ShowDurations::Always : ShowDurations::Never; }, "yes|no" ) + ["-d"]["--durations"] + ( "show test durations" ) + | Opt( loadTestNamesFromFile, "filename" ) + ["-f"]["--input-file"] + ( "load test names to run from a file" ) + | Opt( config.filenamesAsTags ) + ["-#"]["--filenames-as-tags"] + ( "adds a tag for the filename" ) + | Opt( config.sectionsToRun, "section name" ) + ["-c"]["--section"] + ( "specify section to run" ) + | Opt( setVerbosity, "quiet|normal|high" ) + ["-v"]["--verbosity"] + ( "set output verbosity" ) + | Opt( config.listTestNamesOnly ) + ["--list-test-names-only"] + ( "list all/matching test cases names only" ) + | Opt( config.listReporters ) + ["--list-reporters"] + ( "list all reporters" ) + | Opt( setTestOrder, "decl|lex|rand" ) + ["--order"] + ( "test case order (defaults to decl)" ) + | Opt( setRngSeed, "'time'|number" ) + ["--rng-seed"] + ( "set a specific seed for random numbers" ) + | Opt( setColourUsage, "yes|no" ) + ["--use-colour"] + ( "should output be colourised" ) + | Opt( config.libIdentify ) + ["--libidentify"] + ( "report name and version according to libidentify standard" ) + | Opt( setWaitForKeypress, "start|exit|both" ) + ["--wait-for-keypress"] + ( "waits for a keypress before exiting" ) + | Opt( config.benchmarkResolutionMultiple, "multiplier" ) + ["--benchmark-resolution-multiple"] + ( "multiple of clock resolution to run benchmarks" ) + + | Arg( config.testsOrTags, "test name|pattern|tags" ) + ( "which test or tests to use" ); + + return cli; + } + +} // end namespace Catch +// end catch_commandline.cpp +// start catch_common.cpp + +#include +#include + +namespace Catch { + + bool SourceLineInfo::empty() const noexcept { + return file[0] == '\0'; + } + bool SourceLineInfo::operator == ( SourceLineInfo const& other ) const noexcept { + return line == other.line && (file == other.file || std::strcmp(file, other.file) == 0); + } + bool SourceLineInfo::operator < ( SourceLineInfo const& other ) const noexcept { + // We can assume that the same file will usually have the same pointer. + // Thus, if the pointers are the same, there is no point in calling the strcmp + return line < other.line || ( line == other.line && file != other.file && (std::strcmp(file, other.file) < 0)); + } + + std::ostream& operator << ( std::ostream& os, SourceLineInfo const& info ) { +#ifndef __GNUG__ + os << info.file << '(' << info.line << ')'; +#else + os << info.file << ':' << info.line; +#endif + return os; + } + + std::string StreamEndStop::operator+() const { + return std::string(); + } + + NonCopyable::NonCopyable() = default; + NonCopyable::~NonCopyable() = default; + +} +// end catch_common.cpp +// start catch_config.cpp + +namespace Catch { + + Config::Config( ConfigData const& data ) + : m_data( data ), + m_stream( openStream() ) + { + TestSpecParser parser(ITagAliasRegistry::get()); + if (data.testsOrTags.empty()) { + parser.parse("~[.]"); // All not hidden tests + } + else { + m_hasTestFilters = true; + for( auto const& testOrTags : data.testsOrTags ) + parser.parse( testOrTags ); + } + m_testSpec = parser.testSpec(); + } + + std::string const& Config::getFilename() const { + return m_data.outputFilename ; + } + + bool Config::listTests() const { return m_data.listTests; } + bool Config::listTestNamesOnly() const { return m_data.listTestNamesOnly; } + bool Config::listTags() const { return m_data.listTags; } + bool Config::listReporters() const { return m_data.listReporters; } + + std::string Config::getProcessName() const { return m_data.processName; } + std::string const& Config::getReporterName() const { return m_data.reporterName; } + + std::vector const& Config::getTestsOrTags() const { return m_data.testsOrTags; } + std::vector const& Config::getSectionsToRun() const { return m_data.sectionsToRun; } + + TestSpec const& Config::testSpec() const { return m_testSpec; } + bool Config::hasTestFilters() const { return m_hasTestFilters; } + + bool Config::showHelp() const { return m_data.showHelp; } + + // IConfig interface + bool Config::allowThrows() const { return !m_data.noThrow; } + std::ostream& Config::stream() const { return m_stream->stream(); } + std::string Config::name() const { return m_data.name.empty() ? m_data.processName : m_data.name; } + bool Config::includeSuccessfulResults() const { return m_data.showSuccessfulTests; } + bool Config::warnAboutMissingAssertions() const { return !!(m_data.warnings & WarnAbout::NoAssertions); } + bool Config::warnAboutNoTests() const { return !!(m_data.warnings & WarnAbout::NoTests); } + ShowDurations::OrNot Config::showDurations() const { return m_data.showDurations; } + RunTests::InWhatOrder Config::runOrder() const { return m_data.runOrder; } + unsigned int Config::rngSeed() const { return m_data.rngSeed; } + int Config::benchmarkResolutionMultiple() const { return m_data.benchmarkResolutionMultiple; } + UseColour::YesOrNo Config::useColour() const { return m_data.useColour; } + bool Config::shouldDebugBreak() const { return m_data.shouldDebugBreak; } + int Config::abortAfter() const { return m_data.abortAfter; } + bool Config::showInvisibles() const { return m_data.showInvisibles; } + Verbosity Config::verbosity() const { return m_data.verbosity; } + + IStream const* Config::openStream() { + return Catch::makeStream(m_data.outputFilename); + } + +} // end namespace Catch +// end catch_config.cpp +// start catch_console_colour.cpp + +#if defined(__clang__) +# pragma clang diagnostic push +# pragma clang diagnostic ignored "-Wexit-time-destructors" +#endif + +// start catch_errno_guard.h + +namespace Catch { + + class ErrnoGuard { + public: + ErrnoGuard(); + ~ErrnoGuard(); + private: + int m_oldErrno; + }; + +} + +// end catch_errno_guard.h +#include + +namespace Catch { + namespace { + + struct IColourImpl { + virtual ~IColourImpl() = default; + virtual void use( Colour::Code _colourCode ) = 0; + }; + + struct NoColourImpl : IColourImpl { + void use( Colour::Code ) {} + + static IColourImpl* instance() { + static NoColourImpl s_instance; + return &s_instance; + } + }; + + } // anon namespace +} // namespace Catch + +#if !defined( CATCH_CONFIG_COLOUR_NONE ) && !defined( CATCH_CONFIG_COLOUR_WINDOWS ) && !defined( CATCH_CONFIG_COLOUR_ANSI ) +# ifdef CATCH_PLATFORM_WINDOWS +# define CATCH_CONFIG_COLOUR_WINDOWS +# else +# define CATCH_CONFIG_COLOUR_ANSI +# endif +#endif + +#if defined ( CATCH_CONFIG_COLOUR_WINDOWS ) ///////////////////////////////////////// + +namespace Catch { +namespace { + + class Win32ColourImpl : public IColourImpl { + public: + Win32ColourImpl() : stdoutHandle( GetStdHandle(STD_OUTPUT_HANDLE) ) + { + CONSOLE_SCREEN_BUFFER_INFO csbiInfo; + GetConsoleScreenBufferInfo( stdoutHandle, &csbiInfo ); + originalForegroundAttributes = csbiInfo.wAttributes & ~( BACKGROUND_GREEN | BACKGROUND_RED | BACKGROUND_BLUE | BACKGROUND_INTENSITY ); + originalBackgroundAttributes = csbiInfo.wAttributes & ~( FOREGROUND_GREEN | FOREGROUND_RED | FOREGROUND_BLUE | FOREGROUND_INTENSITY ); + } + + virtual void use( Colour::Code _colourCode ) override { + switch( _colourCode ) { + case Colour::None: return setTextAttribute( originalForegroundAttributes ); + case Colour::White: return setTextAttribute( FOREGROUND_GREEN | FOREGROUND_RED | FOREGROUND_BLUE ); + case Colour::Red: return setTextAttribute( FOREGROUND_RED ); + case Colour::Green: return setTextAttribute( FOREGROUND_GREEN ); + case Colour::Blue: return setTextAttribute( FOREGROUND_BLUE ); + case Colour::Cyan: return setTextAttribute( FOREGROUND_BLUE | FOREGROUND_GREEN ); + case Colour::Yellow: return setTextAttribute( FOREGROUND_RED | FOREGROUND_GREEN ); + case Colour::Grey: return setTextAttribute( 0 ); + + case Colour::LightGrey: return setTextAttribute( FOREGROUND_INTENSITY ); + case Colour::BrightRed: return setTextAttribute( FOREGROUND_INTENSITY | FOREGROUND_RED ); + case Colour::BrightGreen: return setTextAttribute( FOREGROUND_INTENSITY | FOREGROUND_GREEN ); + case Colour::BrightWhite: return setTextAttribute( FOREGROUND_INTENSITY | FOREGROUND_GREEN | FOREGROUND_RED | FOREGROUND_BLUE ); + case Colour::BrightYellow: return setTextAttribute( FOREGROUND_INTENSITY | FOREGROUND_RED | FOREGROUND_GREEN ); + + case Colour::Bright: CATCH_INTERNAL_ERROR( "not a colour" ); + + default: + CATCH_ERROR( "Unknown colour requested" ); + } + } + + private: + void setTextAttribute( WORD _textAttribute ) { + SetConsoleTextAttribute( stdoutHandle, _textAttribute | originalBackgroundAttributes ); + } + HANDLE stdoutHandle; + WORD originalForegroundAttributes; + WORD originalBackgroundAttributes; + }; + + IColourImpl* platformColourInstance() { + static Win32ColourImpl s_instance; + + IConfigPtr config = getCurrentContext().getConfig(); + UseColour::YesOrNo colourMode = config + ? config->useColour() + : UseColour::Auto; + if( colourMode == UseColour::Auto ) + colourMode = UseColour::Yes; + return colourMode == UseColour::Yes + ? &s_instance + : NoColourImpl::instance(); + } + +} // end anon namespace +} // end namespace Catch + +#elif defined( CATCH_CONFIG_COLOUR_ANSI ) ////////////////////////////////////// + +#include + +namespace Catch { +namespace { + + // use POSIX/ ANSI console terminal codes + // Thanks to Adam Strzelecki for original contribution + // (http://github.com/nanoant) + // https://github.com/philsquared/Catch/pull/131 + class PosixColourImpl : public IColourImpl { + public: + virtual void use( Colour::Code _colourCode ) override { + switch( _colourCode ) { + case Colour::None: + case Colour::White: return setColour( "[0m" ); + case Colour::Red: return setColour( "[0;31m" ); + case Colour::Green: return setColour( "[0;32m" ); + case Colour::Blue: return setColour( "[0;34m" ); + case Colour::Cyan: return setColour( "[0;36m" ); + case Colour::Yellow: return setColour( "[0;33m" ); + case Colour::Grey: return setColour( "[1;30m" ); + + case Colour::LightGrey: return setColour( "[0;37m" ); + case Colour::BrightRed: return setColour( "[1;31m" ); + case Colour::BrightGreen: return setColour( "[1;32m" ); + case Colour::BrightWhite: return setColour( "[1;37m" ); + case Colour::BrightYellow: return setColour( "[1;33m" ); + + case Colour::Bright: CATCH_INTERNAL_ERROR( "not a colour" ); + default: CATCH_INTERNAL_ERROR( "Unknown colour requested" ); + } + } + static IColourImpl* instance() { + static PosixColourImpl s_instance; + return &s_instance; + } + + private: + void setColour( const char* _escapeCode ) { + getCurrentContext().getConfig()->stream() + << '\033' << _escapeCode; + } + }; + + bool useColourOnPlatform() { + return +#ifdef CATCH_PLATFORM_MAC + !isDebuggerActive() && +#endif +#if !(defined(__DJGPP__) && defined(__STRICT_ANSI__)) + isatty(STDOUT_FILENO) +#else + false +#endif + ; + } + IColourImpl* platformColourInstance() { + ErrnoGuard guard; + IConfigPtr config = getCurrentContext().getConfig(); + UseColour::YesOrNo colourMode = config + ? config->useColour() + : UseColour::Auto; + if( colourMode == UseColour::Auto ) + colourMode = useColourOnPlatform() + ? UseColour::Yes + : UseColour::No; + return colourMode == UseColour::Yes + ? PosixColourImpl::instance() + : NoColourImpl::instance(); + } + +} // end anon namespace +} // end namespace Catch + +#else // not Windows or ANSI /////////////////////////////////////////////// + +namespace Catch { + + static IColourImpl* platformColourInstance() { return NoColourImpl::instance(); } + +} // end namespace Catch + +#endif // Windows/ ANSI/ None + +namespace Catch { + + Colour::Colour( Code _colourCode ) { use( _colourCode ); } + Colour::Colour( Colour&& rhs ) noexcept { + m_moved = rhs.m_moved; + rhs.m_moved = true; + } + Colour& Colour::operator=( Colour&& rhs ) noexcept { + m_moved = rhs.m_moved; + rhs.m_moved = true; + return *this; + } + + Colour::~Colour(){ if( !m_moved ) use( None ); } + + void Colour::use( Code _colourCode ) { + static IColourImpl* impl = platformColourInstance(); + impl->use( _colourCode ); + } + + std::ostream& operator << ( std::ostream& os, Colour const& ) { + return os; + } + +} // end namespace Catch + +#if defined(__clang__) +# pragma clang diagnostic pop +#endif + +// end catch_console_colour.cpp +// start catch_context.cpp + +namespace Catch { + + class Context : public IMutableContext, NonCopyable { + + public: // IContext + virtual IResultCapture* getResultCapture() override { + return m_resultCapture; + } + virtual IRunner* getRunner() override { + return m_runner; + } + + virtual IConfigPtr const& getConfig() const override { + return m_config; + } + + virtual ~Context() override; + + public: // IMutableContext + virtual void setResultCapture( IResultCapture* resultCapture ) override { + m_resultCapture = resultCapture; + } + virtual void setRunner( IRunner* runner ) override { + m_runner = runner; + } + virtual void setConfig( IConfigPtr const& config ) override { + m_config = config; + } + + friend IMutableContext& getCurrentMutableContext(); + + private: + IConfigPtr m_config; + IRunner* m_runner = nullptr; + IResultCapture* m_resultCapture = nullptr; + }; + + IMutableContext *IMutableContext::currentContext = nullptr; + + void IMutableContext::createContext() + { + currentContext = new Context(); + } + + void cleanUpContext() { + delete IMutableContext::currentContext; + IMutableContext::currentContext = nullptr; + } + IContext::~IContext() = default; + IMutableContext::~IMutableContext() = default; + Context::~Context() = default; +} +// end catch_context.cpp +// start catch_debug_console.cpp + +// start catch_debug_console.h + +#include + +namespace Catch { + void writeToDebugConsole( std::string const& text ); +} + +// end catch_debug_console.h +#ifdef CATCH_PLATFORM_WINDOWS + + namespace Catch { + void writeToDebugConsole( std::string const& text ) { + ::OutputDebugStringA( text.c_str() ); + } + } + +#else + + namespace Catch { + void writeToDebugConsole( std::string const& text ) { + // !TBD: Need a version for Mac/ XCode and other IDEs + Catch::cout() << text; + } + } + +#endif // Platform +// end catch_debug_console.cpp +// start catch_debugger.cpp + +#ifdef CATCH_PLATFORM_MAC + +# include +# include +# include +# include +# include +# include +# include + +namespace Catch { + + // The following function is taken directly from the following technical note: + // http://developer.apple.com/library/mac/#qa/qa2004/qa1361.html + + // Returns true if the current process is being debugged (either + // running under the debugger or has a debugger attached post facto). + bool isDebuggerActive(){ + + int mib[4]; + struct kinfo_proc info; + std::size_t size; + + // Initialize the flags so that, if sysctl fails for some bizarre + // reason, we get a predictable result. + + info.kp_proc.p_flag = 0; + + // Initialize mib, which tells sysctl the info we want, in this case + // we're looking for information about a specific process ID. + + mib[0] = CTL_KERN; + mib[1] = KERN_PROC; + mib[2] = KERN_PROC_PID; + mib[3] = getpid(); + + // Call sysctl. + + size = sizeof(info); + if( sysctl(mib, sizeof(mib) / sizeof(*mib), &info, &size, nullptr, 0) != 0 ) { + Catch::cerr() << "\n** Call to sysctl failed - unable to determine if debugger is active **\n" << std::endl; + return false; + } + + // We're being debugged if the P_TRACED flag is set. + + return ( (info.kp_proc.p_flag & P_TRACED) != 0 ); + } + } // namespace Catch + +#elif defined(CATCH_PLATFORM_LINUX) + #include + #include + + namespace Catch{ + // The standard POSIX way of detecting a debugger is to attempt to + // ptrace() the process, but this needs to be done from a child and not + // this process itself to still allow attaching to this process later + // if wanted, so is rather heavy. Under Linux we have the PID of the + // "debugger" (which doesn't need to be gdb, of course, it could also + // be strace, for example) in /proc/$PID/status, so just get it from + // there instead. + bool isDebuggerActive(){ + // Libstdc++ has a bug, where std::ifstream sets errno to 0 + // This way our users can properly assert over errno values + ErrnoGuard guard; + std::ifstream in("/proc/self/status"); + for( std::string line; std::getline(in, line); ) { + static const int PREFIX_LEN = 11; + if( line.compare(0, PREFIX_LEN, "TracerPid:\t") == 0 ) { + // We're traced if the PID is not 0 and no other PID starts + // with 0 digit, so it's enough to check for just a single + // character. + return line.length() > PREFIX_LEN && line[PREFIX_LEN] != '0'; + } + } + + return false; + } + } // namespace Catch +#elif defined(_MSC_VER) + extern "C" __declspec(dllimport) int __stdcall IsDebuggerPresent(); + namespace Catch { + bool isDebuggerActive() { + return IsDebuggerPresent() != 0; + } + } +#elif defined(__MINGW32__) + extern "C" __declspec(dllimport) int __stdcall IsDebuggerPresent(); + namespace Catch { + bool isDebuggerActive() { + return IsDebuggerPresent() != 0; + } + } +#else + namespace Catch { + bool isDebuggerActive() { return false; } + } +#endif // Platform +// end catch_debugger.cpp +// start catch_decomposer.cpp + +namespace Catch { + + ITransientExpression::~ITransientExpression() = default; + + void formatReconstructedExpression( std::ostream &os, std::string const& lhs, StringRef op, std::string const& rhs ) { + if( lhs.size() + rhs.size() < 40 && + lhs.find('\n') == std::string::npos && + rhs.find('\n') == std::string::npos ) + os << lhs << " " << op << " " << rhs; + else + os << lhs << "\n" << op << "\n" << rhs; + } +} +// end catch_decomposer.cpp +// start catch_enforce.cpp + +namespace Catch { +#if defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) && !defined(CATCH_CONFIG_DISABLE_EXCEPTIONS_CUSTOM_HANDLER) + [[noreturn]] + void throw_exception(std::exception const& e) { + Catch::cerr() << "Catch will terminate because it needed to throw an exception.\n" + << "The message was: " << e.what() << '\n'; + std::terminate(); + } +#endif +} // namespace Catch; +// end catch_enforce.cpp +// start catch_errno_guard.cpp + +#include + +namespace Catch { + ErrnoGuard::ErrnoGuard():m_oldErrno(errno){} + ErrnoGuard::~ErrnoGuard() { errno = m_oldErrno; } +} +// end catch_errno_guard.cpp +// start catch_exception_translator_registry.cpp + +// start catch_exception_translator_registry.h + +#include +#include +#include + +namespace Catch { + + class ExceptionTranslatorRegistry : public IExceptionTranslatorRegistry { + public: + ~ExceptionTranslatorRegistry(); + virtual void registerTranslator( const IExceptionTranslator* translator ); + virtual std::string translateActiveException() const override; + std::string tryTranslators() const; + + private: + std::vector> m_translators; + }; +} + +// end catch_exception_translator_registry.h +#ifdef __OBJC__ +#import "Foundation/Foundation.h" +#endif + +namespace Catch { + + ExceptionTranslatorRegistry::~ExceptionTranslatorRegistry() { + } + + void ExceptionTranslatorRegistry::registerTranslator( const IExceptionTranslator* translator ) { + m_translators.push_back( std::unique_ptr( translator ) ); + } + +#if !defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) + std::string ExceptionTranslatorRegistry::translateActiveException() const { + try { +#ifdef __OBJC__ + // In Objective-C try objective-c exceptions first + @try { + return tryTranslators(); + } + @catch (NSException *exception) { + return Catch::Detail::stringify( [exception description] ); + } +#else + // Compiling a mixed mode project with MSVC means that CLR + // exceptions will be caught in (...) as well. However, these + // do not fill-in std::current_exception and thus lead to crash + // when attempting rethrow. + // /EHa switch also causes structured exceptions to be caught + // here, but they fill-in current_exception properly, so + // at worst the output should be a little weird, instead of + // causing a crash. + if (std::current_exception() == nullptr) { + return "Non C++ exception. Possibly a CLR exception."; + } + return tryTranslators(); +#endif + } + catch( TestFailureException& ) { + std::rethrow_exception(std::current_exception()); + } + catch( std::exception& ex ) { + return ex.what(); + } + catch( std::string& msg ) { + return msg; + } + catch( const char* msg ) { + return msg; + } + catch(...) { + return "Unknown exception"; + } + } + + std::string ExceptionTranslatorRegistry::tryTranslators() const { + if (m_translators.empty()) { + std::rethrow_exception(std::current_exception()); + } else { + return m_translators[0]->translate(m_translators.begin() + 1, m_translators.end()); + } + } + +#else // ^^ Exceptions are enabled // Exceptions are disabled vv + std::string ExceptionTranslatorRegistry::translateActiveException() const { + CATCH_INTERNAL_ERROR("Attempted to translate active exception under CATCH_CONFIG_DISABLE_EXCEPTIONS!"); + } + + std::string ExceptionTranslatorRegistry::tryTranslators() const { + CATCH_INTERNAL_ERROR("Attempted to use exception translators under CATCH_CONFIG_DISABLE_EXCEPTIONS!"); + } +#endif + +} +// end catch_exception_translator_registry.cpp +// start catch_fatal_condition.cpp + +#if defined(__GNUC__) +# pragma GCC diagnostic push +# pragma GCC diagnostic ignored "-Wmissing-field-initializers" +#endif + +#if defined( CATCH_CONFIG_WINDOWS_SEH ) || defined( CATCH_CONFIG_POSIX_SIGNALS ) + +namespace { + // Report the error condition + void reportFatal( char const * const message ) { + Catch::getCurrentContext().getResultCapture()->handleFatalErrorCondition( message ); + } +} + +#endif // signals/SEH handling + +#if defined( CATCH_CONFIG_WINDOWS_SEH ) + +namespace Catch { + struct SignalDefs { DWORD id; const char* name; }; + + // There is no 1-1 mapping between signals and windows exceptions. + // Windows can easily distinguish between SO and SigSegV, + // but SigInt, SigTerm, etc are handled differently. + static SignalDefs signalDefs[] = { + { EXCEPTION_ILLEGAL_INSTRUCTION, "SIGILL - Illegal instruction signal" }, + { EXCEPTION_STACK_OVERFLOW, "SIGSEGV - Stack overflow" }, + { EXCEPTION_ACCESS_VIOLATION, "SIGSEGV - Segmentation violation signal" }, + { EXCEPTION_INT_DIVIDE_BY_ZERO, "Divide by zero error" }, + }; + + LONG CALLBACK FatalConditionHandler::handleVectoredException(PEXCEPTION_POINTERS ExceptionInfo) { + for (auto const& def : signalDefs) { + if (ExceptionInfo->ExceptionRecord->ExceptionCode == def.id) { + reportFatal(def.name); + } + } + // If its not an exception we care about, pass it along. + // This stops us from eating debugger breaks etc. + return EXCEPTION_CONTINUE_SEARCH; + } + + FatalConditionHandler::FatalConditionHandler() { + isSet = true; + // 32k seems enough for Catch to handle stack overflow, + // but the value was found experimentally, so there is no strong guarantee + guaranteeSize = 32 * 1024; + exceptionHandlerHandle = nullptr; + // Register as first handler in current chain + exceptionHandlerHandle = AddVectoredExceptionHandler(1, handleVectoredException); + // Pass in guarantee size to be filled + SetThreadStackGuarantee(&guaranteeSize); + } + + void FatalConditionHandler::reset() { + if (isSet) { + RemoveVectoredExceptionHandler(exceptionHandlerHandle); + SetThreadStackGuarantee(&guaranteeSize); + exceptionHandlerHandle = nullptr; + isSet = false; + } + } + + FatalConditionHandler::~FatalConditionHandler() { + reset(); + } + +bool FatalConditionHandler::isSet = false; +ULONG FatalConditionHandler::guaranteeSize = 0; +PVOID FatalConditionHandler::exceptionHandlerHandle = nullptr; + +} // namespace Catch + +#elif defined( CATCH_CONFIG_POSIX_SIGNALS ) + +namespace Catch { + + struct SignalDefs { + int id; + const char* name; + }; + + // 32kb for the alternate stack seems to be sufficient. However, this value + // is experimentally determined, so that's not guaranteed. + constexpr static std::size_t sigStackSize = 32768 >= MINSIGSTKSZ ? 32768 : MINSIGSTKSZ; + + static SignalDefs signalDefs[] = { + { SIGINT, "SIGINT - Terminal interrupt signal" }, + { SIGILL, "SIGILL - Illegal instruction signal" }, + { SIGFPE, "SIGFPE - Floating point error signal" }, + { SIGSEGV, "SIGSEGV - Segmentation violation signal" }, + { SIGTERM, "SIGTERM - Termination request signal" }, + { SIGABRT, "SIGABRT - Abort (abnormal termination) signal" } + }; + + void FatalConditionHandler::handleSignal( int sig ) { + char const * name = ""; + for (auto const& def : signalDefs) { + if (sig == def.id) { + name = def.name; + break; + } + } + reset(); + reportFatal(name); + raise( sig ); + } + + FatalConditionHandler::FatalConditionHandler() { + isSet = true; + stack_t sigStack; + sigStack.ss_sp = altStackMem; + sigStack.ss_size = sigStackSize; + sigStack.ss_flags = 0; + sigaltstack(&sigStack, &oldSigStack); + struct sigaction sa = { }; + + sa.sa_handler = handleSignal; + sa.sa_flags = SA_ONSTACK; + for (std::size_t i = 0; i < sizeof(signalDefs)/sizeof(SignalDefs); ++i) { + sigaction(signalDefs[i].id, &sa, &oldSigActions[i]); + } + } + + FatalConditionHandler::~FatalConditionHandler() { + reset(); + } + + void FatalConditionHandler::reset() { + if( isSet ) { + // Set signals back to previous values -- hopefully nobody overwrote them in the meantime + for( std::size_t i = 0; i < sizeof(signalDefs)/sizeof(SignalDefs); ++i ) { + sigaction(signalDefs[i].id, &oldSigActions[i], nullptr); + } + // Return the old stack + sigaltstack(&oldSigStack, nullptr); + isSet = false; + } + } + + bool FatalConditionHandler::isSet = false; + struct sigaction FatalConditionHandler::oldSigActions[sizeof(signalDefs)/sizeof(SignalDefs)] = {}; + stack_t FatalConditionHandler::oldSigStack = {}; + char FatalConditionHandler::altStackMem[sigStackSize] = {}; + +} // namespace Catch + +#else + +namespace Catch { + void FatalConditionHandler::reset() {} +} + +#endif // signals/SEH handling + +#if defined(__GNUC__) +# pragma GCC diagnostic pop +#endif +// end catch_fatal_condition.cpp +// start catch_generators.cpp + +// start catch_random_number_generator.h + +#include +#include + +namespace Catch { + + struct IConfig; + + std::mt19937& rng(); + void seedRng( IConfig const& config ); + unsigned int rngSeed(); + +} + +// end catch_random_number_generator.h +#include +#include + +namespace Catch { + +IGeneratorTracker::~IGeneratorTracker() {} + +const char* GeneratorException::what() const noexcept { + return m_msg; +} + +namespace Generators { + + GeneratorUntypedBase::~GeneratorUntypedBase() {} + + auto acquireGeneratorTracker( SourceLineInfo const& lineInfo ) -> IGeneratorTracker& { + return getResultCapture().acquireGeneratorTracker( lineInfo ); + } + +} // namespace Generators +} // namespace Catch +// end catch_generators.cpp +// start catch_interfaces_capture.cpp + +namespace Catch { + IResultCapture::~IResultCapture() = default; +} +// end catch_interfaces_capture.cpp +// start catch_interfaces_config.cpp + +namespace Catch { + IConfig::~IConfig() = default; +} +// end catch_interfaces_config.cpp +// start catch_interfaces_exception.cpp + +namespace Catch { + IExceptionTranslator::~IExceptionTranslator() = default; + IExceptionTranslatorRegistry::~IExceptionTranslatorRegistry() = default; +} +// end catch_interfaces_exception.cpp +// start catch_interfaces_registry_hub.cpp + +namespace Catch { + IRegistryHub::~IRegistryHub() = default; + IMutableRegistryHub::~IMutableRegistryHub() = default; +} +// end catch_interfaces_registry_hub.cpp +// start catch_interfaces_reporter.cpp + +// start catch_reporter_listening.h + +namespace Catch { + + class ListeningReporter : public IStreamingReporter { + using Reporters = std::vector; + Reporters m_listeners; + IStreamingReporterPtr m_reporter = nullptr; + ReporterPreferences m_preferences; + + public: + ListeningReporter(); + + void addListener( IStreamingReporterPtr&& listener ); + void addReporter( IStreamingReporterPtr&& reporter ); + + public: // IStreamingReporter + + ReporterPreferences getPreferences() const override; + + void noMatchingTestCases( std::string const& spec ) override; + + static std::set getSupportedVerbosities(); + + void benchmarkStarting( BenchmarkInfo const& benchmarkInfo ) override; + void benchmarkEnded( BenchmarkStats const& benchmarkStats ) override; + + void testRunStarting( TestRunInfo const& testRunInfo ) override; + void testGroupStarting( GroupInfo const& groupInfo ) override; + void testCaseStarting( TestCaseInfo const& testInfo ) override; + void sectionStarting( SectionInfo const& sectionInfo ) override; + void assertionStarting( AssertionInfo const& assertionInfo ) override; + + // The return value indicates if the messages buffer should be cleared: + bool assertionEnded( AssertionStats const& assertionStats ) override; + void sectionEnded( SectionStats const& sectionStats ) override; + void testCaseEnded( TestCaseStats const& testCaseStats ) override; + void testGroupEnded( TestGroupStats const& testGroupStats ) override; + void testRunEnded( TestRunStats const& testRunStats ) override; + + void skipTest( TestCaseInfo const& testInfo ) override; + bool isMulti() const override; + + }; + +} // end namespace Catch + +// end catch_reporter_listening.h +namespace Catch { + + ReporterConfig::ReporterConfig( IConfigPtr const& _fullConfig ) + : m_stream( &_fullConfig->stream() ), m_fullConfig( _fullConfig ) {} + + ReporterConfig::ReporterConfig( IConfigPtr const& _fullConfig, std::ostream& _stream ) + : m_stream( &_stream ), m_fullConfig( _fullConfig ) {} + + std::ostream& ReporterConfig::stream() const { return *m_stream; } + IConfigPtr ReporterConfig::fullConfig() const { return m_fullConfig; } + + TestRunInfo::TestRunInfo( std::string const& _name ) : name( _name ) {} + + GroupInfo::GroupInfo( std::string const& _name, + std::size_t _groupIndex, + std::size_t _groupsCount ) + : name( _name ), + groupIndex( _groupIndex ), + groupsCounts( _groupsCount ) + {} + + AssertionStats::AssertionStats( AssertionResult const& _assertionResult, + std::vector const& _infoMessages, + Totals const& _totals ) + : assertionResult( _assertionResult ), + infoMessages( _infoMessages ), + totals( _totals ) + { + assertionResult.m_resultData.lazyExpression.m_transientExpression = _assertionResult.m_resultData.lazyExpression.m_transientExpression; + + if( assertionResult.hasMessage() ) { + // Copy message into messages list. + // !TBD This should have been done earlier, somewhere + MessageBuilder builder( assertionResult.getTestMacroName(), assertionResult.getSourceInfo(), assertionResult.getResultType() ); + builder << assertionResult.getMessage(); + builder.m_info.message = builder.m_stream.str(); + + infoMessages.push_back( builder.m_info ); + } + } + + AssertionStats::~AssertionStats() = default; + + SectionStats::SectionStats( SectionInfo const& _sectionInfo, + Counts const& _assertions, + double _durationInSeconds, + bool _missingAssertions ) + : sectionInfo( _sectionInfo ), + assertions( _assertions ), + durationInSeconds( _durationInSeconds ), + missingAssertions( _missingAssertions ) + {} + + SectionStats::~SectionStats() = default; + + TestCaseStats::TestCaseStats( TestCaseInfo const& _testInfo, + Totals const& _totals, + std::string const& _stdOut, + std::string const& _stdErr, + bool _aborting ) + : testInfo( _testInfo ), + totals( _totals ), + stdOut( _stdOut ), + stdErr( _stdErr ), + aborting( _aborting ) + {} + + TestCaseStats::~TestCaseStats() = default; + + TestGroupStats::TestGroupStats( GroupInfo const& _groupInfo, + Totals const& _totals, + bool _aborting ) + : groupInfo( _groupInfo ), + totals( _totals ), + aborting( _aborting ) + {} + + TestGroupStats::TestGroupStats( GroupInfo const& _groupInfo ) + : groupInfo( _groupInfo ), + aborting( false ) + {} + + TestGroupStats::~TestGroupStats() = default; + + TestRunStats::TestRunStats( TestRunInfo const& _runInfo, + Totals const& _totals, + bool _aborting ) + : runInfo( _runInfo ), + totals( _totals ), + aborting( _aborting ) + {} + + TestRunStats::~TestRunStats() = default; + + void IStreamingReporter::fatalErrorEncountered( StringRef ) {} + bool IStreamingReporter::isMulti() const { return false; } + + IReporterFactory::~IReporterFactory() = default; + IReporterRegistry::~IReporterRegistry() = default; + +} // end namespace Catch +// end catch_interfaces_reporter.cpp +// start catch_interfaces_runner.cpp + +namespace Catch { + IRunner::~IRunner() = default; +} +// end catch_interfaces_runner.cpp +// start catch_interfaces_testcase.cpp + +namespace Catch { + ITestInvoker::~ITestInvoker() = default; + ITestCaseRegistry::~ITestCaseRegistry() = default; +} +// end catch_interfaces_testcase.cpp +// start catch_leak_detector.cpp + +#ifdef CATCH_CONFIG_WINDOWS_CRTDBG +#include + +namespace Catch { + + LeakDetector::LeakDetector() { + int flag = _CrtSetDbgFlag(_CRTDBG_REPORT_FLAG); + flag |= _CRTDBG_LEAK_CHECK_DF; + flag |= _CRTDBG_ALLOC_MEM_DF; + _CrtSetDbgFlag(flag); + _CrtSetReportMode(_CRT_WARN, _CRTDBG_MODE_FILE | _CRTDBG_MODE_DEBUG); + _CrtSetReportFile(_CRT_WARN, _CRTDBG_FILE_STDERR); + // Change this to leaking allocation's number to break there + _CrtSetBreakAlloc(-1); + } +} + +#else + + Catch::LeakDetector::LeakDetector() {} + +#endif + +Catch::LeakDetector::~LeakDetector() { + Catch::cleanUp(); +} +// end catch_leak_detector.cpp +// start catch_list.cpp + +// start catch_list.h + +#include + +namespace Catch { + + std::size_t listTests( Config const& config ); + + std::size_t listTestsNamesOnly( Config const& config ); + + struct TagInfo { + void add( std::string const& spelling ); + std::string all() const; + + std::set spellings; + std::size_t count = 0; + }; + + std::size_t listTags( Config const& config ); + + std::size_t listReporters(); + + Option list( std::shared_ptr const& config ); + +} // end namespace Catch + +// end catch_list.h +// start catch_text.h + +namespace Catch { + using namespace clara::TextFlow; +} + +// end catch_text.h +#include +#include +#include + +namespace Catch { + + std::size_t listTests( Config const& config ) { + TestSpec testSpec = config.testSpec(); + if( config.hasTestFilters() ) + Catch::cout() << "Matching test cases:\n"; + else { + Catch::cout() << "All available test cases:\n"; + } + + auto matchedTestCases = filterTests( getAllTestCasesSorted( config ), testSpec, config ); + for( auto const& testCaseInfo : matchedTestCases ) { + Colour::Code colour = testCaseInfo.isHidden() + ? Colour::SecondaryText + : Colour::None; + Colour colourGuard( colour ); + + Catch::cout() << Column( testCaseInfo.name ).initialIndent( 2 ).indent( 4 ) << "\n"; + if( config.verbosity() >= Verbosity::High ) { + Catch::cout() << Column( Catch::Detail::stringify( testCaseInfo.lineInfo ) ).indent(4) << std::endl; + std::string description = testCaseInfo.description; + if( description.empty() ) + description = "(NO DESCRIPTION)"; + Catch::cout() << Column( description ).indent(4) << std::endl; + } + if( !testCaseInfo.tags.empty() ) + Catch::cout() << Column( testCaseInfo.tagsAsString() ).indent( 6 ) << "\n"; + } + + if( !config.hasTestFilters() ) + Catch::cout() << pluralise( matchedTestCases.size(), "test case" ) << '\n' << std::endl; + else + Catch::cout() << pluralise( matchedTestCases.size(), "matching test case" ) << '\n' << std::endl; + return matchedTestCases.size(); + } + + std::size_t listTestsNamesOnly( Config const& config ) { + TestSpec testSpec = config.testSpec(); + std::size_t matchedTests = 0; + std::vector matchedTestCases = filterTests( getAllTestCasesSorted( config ), testSpec, config ); + for( auto const& testCaseInfo : matchedTestCases ) { + matchedTests++; + if( startsWith( testCaseInfo.name, '#' ) ) + Catch::cout() << '"' << testCaseInfo.name << '"'; + else + Catch::cout() << testCaseInfo.name; + if ( config.verbosity() >= Verbosity::High ) + Catch::cout() << "\t@" << testCaseInfo.lineInfo; + Catch::cout() << std::endl; + } + return matchedTests; + } + + void TagInfo::add( std::string const& spelling ) { + ++count; + spellings.insert( spelling ); + } + + std::string TagInfo::all() const { + std::string out; + for( auto const& spelling : spellings ) + out += "[" + spelling + "]"; + return out; + } + + std::size_t listTags( Config const& config ) { + TestSpec testSpec = config.testSpec(); + if( config.hasTestFilters() ) + Catch::cout() << "Tags for matching test cases:\n"; + else { + Catch::cout() << "All available tags:\n"; + } + + std::map tagCounts; + + std::vector matchedTestCases = filterTests( getAllTestCasesSorted( config ), testSpec, config ); + for( auto const& testCase : matchedTestCases ) { + for( auto const& tagName : testCase.getTestCaseInfo().tags ) { + std::string lcaseTagName = toLower( tagName ); + auto countIt = tagCounts.find( lcaseTagName ); + if( countIt == tagCounts.end() ) + countIt = tagCounts.insert( std::make_pair( lcaseTagName, TagInfo() ) ).first; + countIt->second.add( tagName ); + } + } + + for( auto const& tagCount : tagCounts ) { + ReusableStringStream rss; + rss << " " << std::setw(2) << tagCount.second.count << " "; + auto str = rss.str(); + auto wrapper = Column( tagCount.second.all() ) + .initialIndent( 0 ) + .indent( str.size() ) + .width( CATCH_CONFIG_CONSOLE_WIDTH-10 ); + Catch::cout() << str << wrapper << '\n'; + } + Catch::cout() << pluralise( tagCounts.size(), "tag" ) << '\n' << std::endl; + return tagCounts.size(); + } + + std::size_t listReporters() { + Catch::cout() << "Available reporters:\n"; + IReporterRegistry::FactoryMap const& factories = getRegistryHub().getReporterRegistry().getFactories(); + std::size_t maxNameLen = 0; + for( auto const& factoryKvp : factories ) + maxNameLen = (std::max)( maxNameLen, factoryKvp.first.size() ); + + for( auto const& factoryKvp : factories ) { + Catch::cout() + << Column( factoryKvp.first + ":" ) + .indent(2) + .width( 5+maxNameLen ) + + Column( factoryKvp.second->getDescription() ) + .initialIndent(0) + .indent(2) + .width( CATCH_CONFIG_CONSOLE_WIDTH - maxNameLen-8 ) + << "\n"; + } + Catch::cout() << std::endl; + return factories.size(); + } + + Option list( std::shared_ptr const& config ) { + Option listedCount; + getCurrentMutableContext().setConfig( config ); + if( config->listTests() ) + listedCount = listedCount.valueOr(0) + listTests( *config ); + if( config->listTestNamesOnly() ) + listedCount = listedCount.valueOr(0) + listTestsNamesOnly( *config ); + if( config->listTags() ) + listedCount = listedCount.valueOr(0) + listTags( *config ); + if( config->listReporters() ) + listedCount = listedCount.valueOr(0) + listReporters(); + return listedCount; + } + +} // end namespace Catch +// end catch_list.cpp +// start catch_matchers.cpp + +namespace Catch { +namespace Matchers { + namespace Impl { + + std::string MatcherUntypedBase::toString() const { + if( m_cachedToString.empty() ) + m_cachedToString = describe(); + return m_cachedToString; + } + + MatcherUntypedBase::~MatcherUntypedBase() = default; + + } // namespace Impl +} // namespace Matchers + +using namespace Matchers; +using Matchers::Impl::MatcherBase; + +} // namespace Catch +// end catch_matchers.cpp +// start catch_matchers_floating.cpp + +// start catch_polyfills.hpp + +namespace Catch { + bool isnan(float f); + bool isnan(double d); +} + +// end catch_polyfills.hpp +// start catch_to_string.hpp + +#include + +namespace Catch { + template + std::string to_string(T const& t) { +#if defined(CATCH_CONFIG_CPP11_TO_STRING) + return std::to_string(t); +#else + ReusableStringStream rss; + rss << t; + return rss.str(); +#endif + } +} // end namespace Catch + +// end catch_to_string.hpp +#include +#include +#include + +namespace Catch { +namespace Matchers { +namespace Floating { +enum class FloatingPointKind : uint8_t { + Float, + Double +}; +} +} +} + +namespace { + +template +struct Converter; + +template <> +struct Converter { + static_assert(sizeof(float) == sizeof(int32_t), "Important ULP matcher assumption violated"); + Converter(float f) { + std::memcpy(&i, &f, sizeof(f)); + } + int32_t i; +}; + +template <> +struct Converter { + static_assert(sizeof(double) == sizeof(int64_t), "Important ULP matcher assumption violated"); + Converter(double d) { + std::memcpy(&i, &d, sizeof(d)); + } + int64_t i; +}; + +template +auto convert(T t) -> Converter { + return Converter(t); +} + +template +bool almostEqualUlps(FP lhs, FP rhs, int maxUlpDiff) { + // Comparison with NaN should always be false. + // This way we can rule it out before getting into the ugly details + if (Catch::isnan(lhs) || Catch::isnan(rhs)) { + return false; + } + + auto lc = convert(lhs); + auto rc = convert(rhs); + + if ((lc.i < 0) != (rc.i < 0)) { + // Potentially we can have +0 and -0 + return lhs == rhs; + } + + auto ulpDiff = std::abs(lc.i - rc.i); + return ulpDiff <= maxUlpDiff; +} + +} + +namespace Catch { +namespace Matchers { +namespace Floating { + WithinAbsMatcher::WithinAbsMatcher(double target, double margin) + :m_target{ target }, m_margin{ margin } { + CATCH_ENFORCE(margin >= 0, "Invalid margin: " << margin << '.' + << " Margin has to be non-negative."); + } + + // Performs equivalent check of std::fabs(lhs - rhs) <= margin + // But without the subtraction to allow for INFINITY in comparison + bool WithinAbsMatcher::match(double const& matchee) const { + return (matchee + m_margin >= m_target) && (m_target + m_margin >= matchee); + } + + std::string WithinAbsMatcher::describe() const { + return "is within " + ::Catch::Detail::stringify(m_margin) + " of " + ::Catch::Detail::stringify(m_target); + } + + WithinUlpsMatcher::WithinUlpsMatcher(double target, int ulps, FloatingPointKind baseType) + :m_target{ target }, m_ulps{ ulps }, m_type{ baseType } { + CATCH_ENFORCE(ulps >= 0, "Invalid ULP setting: " << ulps << '.' + << " ULPs have to be non-negative."); + } + +#if defined(__clang__) +#pragma clang diagnostic push +// Clang <3.5 reports on the default branch in the switch below +#pragma clang diagnostic ignored "-Wunreachable-code" +#endif + + bool WithinUlpsMatcher::match(double const& matchee) const { + switch (m_type) { + case FloatingPointKind::Float: + return almostEqualUlps(static_cast(matchee), static_cast(m_target), m_ulps); + case FloatingPointKind::Double: + return almostEqualUlps(matchee, m_target, m_ulps); + default: + CATCH_INTERNAL_ERROR( "Unknown FloatingPointKind value" ); + } + } + +#if defined(__clang__) +#pragma clang diagnostic pop +#endif + + std::string WithinUlpsMatcher::describe() const { + return "is within " + Catch::to_string(m_ulps) + " ULPs of " + ::Catch::Detail::stringify(m_target) + ((m_type == FloatingPointKind::Float)? "f" : ""); + } + +}// namespace Floating + +Floating::WithinUlpsMatcher WithinULP(double target, int maxUlpDiff) { + return Floating::WithinUlpsMatcher(target, maxUlpDiff, Floating::FloatingPointKind::Double); +} + +Floating::WithinUlpsMatcher WithinULP(float target, int maxUlpDiff) { + return Floating::WithinUlpsMatcher(target, maxUlpDiff, Floating::FloatingPointKind::Float); +} + +Floating::WithinAbsMatcher WithinAbs(double target, double margin) { + return Floating::WithinAbsMatcher(target, margin); +} + +} // namespace Matchers +} // namespace Catch + +// end catch_matchers_floating.cpp +// start catch_matchers_generic.cpp + +std::string Catch::Matchers::Generic::Detail::finalizeDescription(const std::string& desc) { + if (desc.empty()) { + return "matches undescribed predicate"; + } else { + return "matches predicate: \"" + desc + '"'; + } +} +// end catch_matchers_generic.cpp +// start catch_matchers_string.cpp + +#include + +namespace Catch { +namespace Matchers { + + namespace StdString { + + CasedString::CasedString( std::string const& str, CaseSensitive::Choice caseSensitivity ) + : m_caseSensitivity( caseSensitivity ), + m_str( adjustString( str ) ) + {} + std::string CasedString::adjustString( std::string const& str ) const { + return m_caseSensitivity == CaseSensitive::No + ? toLower( str ) + : str; + } + std::string CasedString::caseSensitivitySuffix() const { + return m_caseSensitivity == CaseSensitive::No + ? " (case insensitive)" + : std::string(); + } + + StringMatcherBase::StringMatcherBase( std::string const& operation, CasedString const& comparator ) + : m_comparator( comparator ), + m_operation( operation ) { + } + + std::string StringMatcherBase::describe() const { + std::string description; + description.reserve(5 + m_operation.size() + m_comparator.m_str.size() + + m_comparator.caseSensitivitySuffix().size()); + description += m_operation; + description += ": \""; + description += m_comparator.m_str; + description += "\""; + description += m_comparator.caseSensitivitySuffix(); + return description; + } + + EqualsMatcher::EqualsMatcher( CasedString const& comparator ) : StringMatcherBase( "equals", comparator ) {} + + bool EqualsMatcher::match( std::string const& source ) const { + return m_comparator.adjustString( source ) == m_comparator.m_str; + } + + ContainsMatcher::ContainsMatcher( CasedString const& comparator ) : StringMatcherBase( "contains", comparator ) {} + + bool ContainsMatcher::match( std::string const& source ) const { + return contains( m_comparator.adjustString( source ), m_comparator.m_str ); + } + + StartsWithMatcher::StartsWithMatcher( CasedString const& comparator ) : StringMatcherBase( "starts with", comparator ) {} + + bool StartsWithMatcher::match( std::string const& source ) const { + return startsWith( m_comparator.adjustString( source ), m_comparator.m_str ); + } + + EndsWithMatcher::EndsWithMatcher( CasedString const& comparator ) : StringMatcherBase( "ends with", comparator ) {} + + bool EndsWithMatcher::match( std::string const& source ) const { + return endsWith( m_comparator.adjustString( source ), m_comparator.m_str ); + } + + RegexMatcher::RegexMatcher(std::string regex, CaseSensitive::Choice caseSensitivity): m_regex(std::move(regex)), m_caseSensitivity(caseSensitivity) {} + + bool RegexMatcher::match(std::string const& matchee) const { + auto flags = std::regex::ECMAScript; // ECMAScript is the default syntax option anyway + if (m_caseSensitivity == CaseSensitive::Choice::No) { + flags |= std::regex::icase; + } + auto reg = std::regex(m_regex, flags); + return std::regex_match(matchee, reg); + } + + std::string RegexMatcher::describe() const { + return "matches " + ::Catch::Detail::stringify(m_regex) + ((m_caseSensitivity == CaseSensitive::Choice::Yes)? " case sensitively" : " case insensitively"); + } + + } // namespace StdString + + StdString::EqualsMatcher Equals( std::string const& str, CaseSensitive::Choice caseSensitivity ) { + return StdString::EqualsMatcher( StdString::CasedString( str, caseSensitivity) ); + } + StdString::ContainsMatcher Contains( std::string const& str, CaseSensitive::Choice caseSensitivity ) { + return StdString::ContainsMatcher( StdString::CasedString( str, caseSensitivity) ); + } + StdString::EndsWithMatcher EndsWith( std::string const& str, CaseSensitive::Choice caseSensitivity ) { + return StdString::EndsWithMatcher( StdString::CasedString( str, caseSensitivity) ); + } + StdString::StartsWithMatcher StartsWith( std::string const& str, CaseSensitive::Choice caseSensitivity ) { + return StdString::StartsWithMatcher( StdString::CasedString( str, caseSensitivity) ); + } + + StdString::RegexMatcher Matches(std::string const& regex, CaseSensitive::Choice caseSensitivity) { + return StdString::RegexMatcher(regex, caseSensitivity); + } + +} // namespace Matchers +} // namespace Catch +// end catch_matchers_string.cpp +// start catch_message.cpp + +// start catch_uncaught_exceptions.h + +namespace Catch { + bool uncaught_exceptions(); +} // end namespace Catch + +// end catch_uncaught_exceptions.h +#include +#include + +namespace Catch { + + MessageInfo::MessageInfo( StringRef const& _macroName, + SourceLineInfo const& _lineInfo, + ResultWas::OfType _type ) + : macroName( _macroName ), + lineInfo( _lineInfo ), + type( _type ), + sequence( ++globalCount ) + {} + + bool MessageInfo::operator==( MessageInfo const& other ) const { + return sequence == other.sequence; + } + + bool MessageInfo::operator<( MessageInfo const& other ) const { + return sequence < other.sequence; + } + + // This may need protecting if threading support is added + unsigned int MessageInfo::globalCount = 0; + + //////////////////////////////////////////////////////////////////////////// + + Catch::MessageBuilder::MessageBuilder( StringRef const& macroName, + SourceLineInfo const& lineInfo, + ResultWas::OfType type ) + :m_info(macroName, lineInfo, type) {} + + //////////////////////////////////////////////////////////////////////////// + + ScopedMessage::ScopedMessage( MessageBuilder const& builder ) + : m_info( builder.m_info ), m_moved() + { + m_info.message = builder.m_stream.str(); + getResultCapture().pushScopedMessage( m_info ); + } + + ScopedMessage::ScopedMessage( ScopedMessage&& old ) + : m_info( old.m_info ), m_moved() + { + old.m_moved = true; + } + + ScopedMessage::~ScopedMessage() { + if ( !uncaught_exceptions() && !m_moved ){ + getResultCapture().popScopedMessage(m_info); + } + } + + Capturer::Capturer( StringRef macroName, SourceLineInfo const& lineInfo, ResultWas::OfType resultType, StringRef names ) { + auto trimmed = [&] (size_t start, size_t end) { + while (names[start] == ',' || isspace(names[start])) { + ++start; + } + while (names[end] == ',' || isspace(names[end])) { + --end; + } + return names.substr(start, end - start + 1); + }; + + size_t start = 0; + std::stack openings; + for (size_t pos = 0; pos < names.size(); ++pos) { + char c = names[pos]; + switch (c) { + case '[': + case '{': + case '(': + // It is basically impossible to disambiguate between + // comparison and start of template args in this context +// case '<': + openings.push(c); + break; + case ']': + case '}': + case ')': +// case '>': + openings.pop(); + break; + case ',': + if (start != pos && openings.size() == 0) { + m_messages.emplace_back(macroName, lineInfo, resultType); + m_messages.back().message = trimmed(start, pos); + m_messages.back().message += " := "; + start = pos; + } + } + } + assert(openings.size() == 0 && "Mismatched openings"); + m_messages.emplace_back(macroName, lineInfo, resultType); + m_messages.back().message = trimmed(start, names.size() - 1); + m_messages.back().message += " := "; + } + Capturer::~Capturer() { + if ( !uncaught_exceptions() ){ + assert( m_captured == m_messages.size() ); + for( size_t i = 0; i < m_captured; ++i ) + m_resultCapture.popScopedMessage( m_messages[i] ); + } + } + + void Capturer::captureValue( size_t index, std::string const& value ) { + assert( index < m_messages.size() ); + m_messages[index].message += value; + m_resultCapture.pushScopedMessage( m_messages[index] ); + m_captured++; + } + +} // end namespace Catch +// end catch_message.cpp +// start catch_output_redirect.cpp + +// start catch_output_redirect.h +#ifndef TWOBLUECUBES_CATCH_OUTPUT_REDIRECT_H +#define TWOBLUECUBES_CATCH_OUTPUT_REDIRECT_H + +#include +#include +#include + +namespace Catch { + + class RedirectedStream { + std::ostream& m_originalStream; + std::ostream& m_redirectionStream; + std::streambuf* m_prevBuf; + + public: + RedirectedStream( std::ostream& originalStream, std::ostream& redirectionStream ); + ~RedirectedStream(); + }; + + class RedirectedStdOut { + ReusableStringStream m_rss; + RedirectedStream m_cout; + public: + RedirectedStdOut(); + auto str() const -> std::string; + }; + + // StdErr has two constituent streams in C++, std::cerr and std::clog + // This means that we need to redirect 2 streams into 1 to keep proper + // order of writes + class RedirectedStdErr { + ReusableStringStream m_rss; + RedirectedStream m_cerr; + RedirectedStream m_clog; + public: + RedirectedStdErr(); + auto str() const -> std::string; + }; + + class RedirectedStreams { + public: + RedirectedStreams(RedirectedStreams const&) = delete; + RedirectedStreams& operator=(RedirectedStreams const&) = delete; + RedirectedStreams(RedirectedStreams&&) = delete; + RedirectedStreams& operator=(RedirectedStreams&&) = delete; + + RedirectedStreams(std::string& redirectedCout, std::string& redirectedCerr); + ~RedirectedStreams(); + private: + std::string& m_redirectedCout; + std::string& m_redirectedCerr; + RedirectedStdOut m_redirectedStdOut; + RedirectedStdErr m_redirectedStdErr; + }; + +#if defined(CATCH_CONFIG_NEW_CAPTURE) + + // Windows's implementation of std::tmpfile is terrible (it tries + // to create a file inside system folder, thus requiring elevated + // privileges for the binary), so we have to use tmpnam(_s) and + // create the file ourselves there. + class TempFile { + public: + TempFile(TempFile const&) = delete; + TempFile& operator=(TempFile const&) = delete; + TempFile(TempFile&&) = delete; + TempFile& operator=(TempFile&&) = delete; + + TempFile(); + ~TempFile(); + + std::FILE* getFile(); + std::string getContents(); + + private: + std::FILE* m_file = nullptr; + #if defined(_MSC_VER) + char m_buffer[L_tmpnam] = { 0 }; + #endif + }; + + class OutputRedirect { + public: + OutputRedirect(OutputRedirect const&) = delete; + OutputRedirect& operator=(OutputRedirect const&) = delete; + OutputRedirect(OutputRedirect&&) = delete; + OutputRedirect& operator=(OutputRedirect&&) = delete; + + OutputRedirect(std::string& stdout_dest, std::string& stderr_dest); + ~OutputRedirect(); + + private: + int m_originalStdout = -1; + int m_originalStderr = -1; + TempFile m_stdoutFile; + TempFile m_stderrFile; + std::string& m_stdoutDest; + std::string& m_stderrDest; + }; + +#endif + +} // end namespace Catch + +#endif // TWOBLUECUBES_CATCH_OUTPUT_REDIRECT_H +// end catch_output_redirect.h +#include +#include +#include +#include +#include + +#if defined(CATCH_CONFIG_NEW_CAPTURE) + #if defined(_MSC_VER) + #include //_dup and _dup2 + #define dup _dup + #define dup2 _dup2 + #define fileno _fileno + #else + #include // dup and dup2 + #endif +#endif + +namespace Catch { + + RedirectedStream::RedirectedStream( std::ostream& originalStream, std::ostream& redirectionStream ) + : m_originalStream( originalStream ), + m_redirectionStream( redirectionStream ), + m_prevBuf( m_originalStream.rdbuf() ) + { + m_originalStream.rdbuf( m_redirectionStream.rdbuf() ); + } + + RedirectedStream::~RedirectedStream() { + m_originalStream.rdbuf( m_prevBuf ); + } + + RedirectedStdOut::RedirectedStdOut() : m_cout( Catch::cout(), m_rss.get() ) {} + auto RedirectedStdOut::str() const -> std::string { return m_rss.str(); } + + RedirectedStdErr::RedirectedStdErr() + : m_cerr( Catch::cerr(), m_rss.get() ), + m_clog( Catch::clog(), m_rss.get() ) + {} + auto RedirectedStdErr::str() const -> std::string { return m_rss.str(); } + + RedirectedStreams::RedirectedStreams(std::string& redirectedCout, std::string& redirectedCerr) + : m_redirectedCout(redirectedCout), + m_redirectedCerr(redirectedCerr) + {} + + RedirectedStreams::~RedirectedStreams() { + m_redirectedCout += m_redirectedStdOut.str(); + m_redirectedCerr += m_redirectedStdErr.str(); + } + +#if defined(CATCH_CONFIG_NEW_CAPTURE) + +#if defined(_MSC_VER) + TempFile::TempFile() { + if (tmpnam_s(m_buffer)) { + CATCH_RUNTIME_ERROR("Could not get a temp filename"); + } + if (fopen_s(&m_file, m_buffer, "w")) { + char buffer[100]; + if (strerror_s(buffer, errno)) { + CATCH_RUNTIME_ERROR("Could not translate errno to a string"); + } + CATCH_RUNTIME_ERROR("Coul dnot open the temp file: '" << m_buffer << "' because: " << buffer); + } + } +#else + TempFile::TempFile() { + m_file = std::tmpfile(); + if (!m_file) { + CATCH_RUNTIME_ERROR("Could not create a temp file."); + } + } + +#endif + + TempFile::~TempFile() { + // TBD: What to do about errors here? + std::fclose(m_file); + // We manually create the file on Windows only, on Linux + // it will be autodeleted +#if defined(_MSC_VER) + std::remove(m_buffer); +#endif + } + + FILE* TempFile::getFile() { + return m_file; + } + + std::string TempFile::getContents() { + std::stringstream sstr; + char buffer[100] = {}; + std::rewind(m_file); + while (std::fgets(buffer, sizeof(buffer), m_file)) { + sstr << buffer; + } + return sstr.str(); + } + + OutputRedirect::OutputRedirect(std::string& stdout_dest, std::string& stderr_dest) : + m_originalStdout(dup(1)), + m_originalStderr(dup(2)), + m_stdoutDest(stdout_dest), + m_stderrDest(stderr_dest) { + dup2(fileno(m_stdoutFile.getFile()), 1); + dup2(fileno(m_stderrFile.getFile()), 2); + } + + OutputRedirect::~OutputRedirect() { + Catch::cout() << std::flush; + fflush(stdout); + // Since we support overriding these streams, we flush cerr + // even though std::cerr is unbuffered + Catch::cerr() << std::flush; + Catch::clog() << std::flush; + fflush(stderr); + + dup2(m_originalStdout, 1); + dup2(m_originalStderr, 2); + + m_stdoutDest += m_stdoutFile.getContents(); + m_stderrDest += m_stderrFile.getContents(); + } + +#endif // CATCH_CONFIG_NEW_CAPTURE + +} // namespace Catch + +#if defined(CATCH_CONFIG_NEW_CAPTURE) + #if defined(_MSC_VER) + #undef dup + #undef dup2 + #undef fileno + #endif +#endif +// end catch_output_redirect.cpp +// start catch_polyfills.cpp + +#include + +namespace Catch { + +#if !defined(CATCH_CONFIG_POLYFILL_ISNAN) + bool isnan(float f) { + return std::isnan(f); + } + bool isnan(double d) { + return std::isnan(d); + } +#else + // For now we only use this for embarcadero + bool isnan(float f) { + return std::_isnan(f); + } + bool isnan(double d) { + return std::_isnan(d); + } +#endif + +} // end namespace Catch +// end catch_polyfills.cpp +// start catch_random_number_generator.cpp + +namespace Catch { + + std::mt19937& rng() { + static std::mt19937 s_rng; + return s_rng; + } + + void seedRng( IConfig const& config ) { + if( config.rngSeed() != 0 ) { + std::srand( config.rngSeed() ); + rng().seed( config.rngSeed() ); + } + } + + unsigned int rngSeed() { + return getCurrentContext().getConfig()->rngSeed(); + } +} +// end catch_random_number_generator.cpp +// start catch_registry_hub.cpp + +// start catch_test_case_registry_impl.h + +#include +#include +#include +#include + +namespace Catch { + + class TestCase; + struct IConfig; + + std::vector sortTests( IConfig const& config, std::vector const& unsortedTestCases ); + bool matchTest( TestCase const& testCase, TestSpec const& testSpec, IConfig const& config ); + + void enforceNoDuplicateTestCases( std::vector const& functions ); + + std::vector filterTests( std::vector const& testCases, TestSpec const& testSpec, IConfig const& config ); + std::vector const& getAllTestCasesSorted( IConfig const& config ); + + class TestRegistry : public ITestCaseRegistry { + public: + virtual ~TestRegistry() = default; + + virtual void registerTest( TestCase const& testCase ); + + std::vector const& getAllTests() const override; + std::vector const& getAllTestsSorted( IConfig const& config ) const override; + + private: + std::vector m_functions; + mutable RunTests::InWhatOrder m_currentSortOrder = RunTests::InDeclarationOrder; + mutable std::vector m_sortedFunctions; + std::size_t m_unnamedCount = 0; + std::ios_base::Init m_ostreamInit; // Forces cout/ cerr to be initialised + }; + + /////////////////////////////////////////////////////////////////////////// + + class TestInvokerAsFunction : public ITestInvoker { + void(*m_testAsFunction)(); + public: + TestInvokerAsFunction( void(*testAsFunction)() ) noexcept; + + void invoke() const override; + }; + + std::string extractClassName( StringRef const& classOrQualifiedMethodName ); + + /////////////////////////////////////////////////////////////////////////// + +} // end namespace Catch + +// end catch_test_case_registry_impl.h +// start catch_reporter_registry.h + +#include + +namespace Catch { + + class ReporterRegistry : public IReporterRegistry { + + public: + + ~ReporterRegistry() override; + + IStreamingReporterPtr create( std::string const& name, IConfigPtr const& config ) const override; + + void registerReporter( std::string const& name, IReporterFactoryPtr const& factory ); + void registerListener( IReporterFactoryPtr const& factory ); + + FactoryMap const& getFactories() const override; + Listeners const& getListeners() const override; + + private: + FactoryMap m_factories; + Listeners m_listeners; + }; +} + +// end catch_reporter_registry.h +// start catch_tag_alias_registry.h + +// start catch_tag_alias.h + +#include + +namespace Catch { + + struct TagAlias { + TagAlias(std::string const& _tag, SourceLineInfo _lineInfo); + + std::string tag; + SourceLineInfo lineInfo; + }; + +} // end namespace Catch + +// end catch_tag_alias.h +#include + +namespace Catch { + + class TagAliasRegistry : public ITagAliasRegistry { + public: + ~TagAliasRegistry() override; + TagAlias const* find( std::string const& alias ) const override; + std::string expandAliases( std::string const& unexpandedTestSpec ) const override; + void add( std::string const& alias, std::string const& tag, SourceLineInfo const& lineInfo ); + + private: + std::map m_registry; + }; + +} // end namespace Catch + +// end catch_tag_alias_registry.h +// start catch_startup_exception_registry.h + +#include +#include + +namespace Catch { + + class StartupExceptionRegistry { + public: + void add(std::exception_ptr const& exception) noexcept; + std::vector const& getExceptions() const noexcept; + private: + std::vector m_exceptions; + }; + +} // end namespace Catch + +// end catch_startup_exception_registry.h +// start catch_singletons.hpp + +namespace Catch { + + struct ISingleton { + virtual ~ISingleton(); + }; + + void addSingleton( ISingleton* singleton ); + void cleanupSingletons(); + + template + class Singleton : SingletonImplT, public ISingleton { + + static auto getInternal() -> Singleton* { + static Singleton* s_instance = nullptr; + if( !s_instance ) { + s_instance = new Singleton; + addSingleton( s_instance ); + } + return s_instance; + } + + public: + static auto get() -> InterfaceT const& { + return *getInternal(); + } + static auto getMutable() -> MutableInterfaceT& { + return *getInternal(); + } + }; + +} // namespace Catch + +// end catch_singletons.hpp +namespace Catch { + + namespace { + + class RegistryHub : public IRegistryHub, public IMutableRegistryHub, + private NonCopyable { + + public: // IRegistryHub + RegistryHub() = default; + IReporterRegistry const& getReporterRegistry() const override { + return m_reporterRegistry; + } + ITestCaseRegistry const& getTestCaseRegistry() const override { + return m_testCaseRegistry; + } + IExceptionTranslatorRegistry const& getExceptionTranslatorRegistry() const override { + return m_exceptionTranslatorRegistry; + } + ITagAliasRegistry const& getTagAliasRegistry() const override { + return m_tagAliasRegistry; + } + StartupExceptionRegistry const& getStartupExceptionRegistry() const override { + return m_exceptionRegistry; + } + + public: // IMutableRegistryHub + void registerReporter( std::string const& name, IReporterFactoryPtr const& factory ) override { + m_reporterRegistry.registerReporter( name, factory ); + } + void registerListener( IReporterFactoryPtr const& factory ) override { + m_reporterRegistry.registerListener( factory ); + } + void registerTest( TestCase const& testInfo ) override { + m_testCaseRegistry.registerTest( testInfo ); + } + void registerTranslator( const IExceptionTranslator* translator ) override { + m_exceptionTranslatorRegistry.registerTranslator( translator ); + } + void registerTagAlias( std::string const& alias, std::string const& tag, SourceLineInfo const& lineInfo ) override { + m_tagAliasRegistry.add( alias, tag, lineInfo ); + } + void registerStartupException() noexcept override { + m_exceptionRegistry.add(std::current_exception()); + } + + private: + TestRegistry m_testCaseRegistry; + ReporterRegistry m_reporterRegistry; + ExceptionTranslatorRegistry m_exceptionTranslatorRegistry; + TagAliasRegistry m_tagAliasRegistry; + StartupExceptionRegistry m_exceptionRegistry; + }; + } + + using RegistryHubSingleton = Singleton; + + IRegistryHub const& getRegistryHub() { + return RegistryHubSingleton::get(); + } + IMutableRegistryHub& getMutableRegistryHub() { + return RegistryHubSingleton::getMutable(); + } + void cleanUp() { + cleanupSingletons(); + cleanUpContext(); + } + std::string translateActiveException() { + return getRegistryHub().getExceptionTranslatorRegistry().translateActiveException(); + } + +} // end namespace Catch +// end catch_registry_hub.cpp +// start catch_reporter_registry.cpp + +namespace Catch { + + ReporterRegistry::~ReporterRegistry() = default; + + IStreamingReporterPtr ReporterRegistry::create( std::string const& name, IConfigPtr const& config ) const { + auto it = m_factories.find( name ); + if( it == m_factories.end() ) + return nullptr; + return it->second->create( ReporterConfig( config ) ); + } + + void ReporterRegistry::registerReporter( std::string const& name, IReporterFactoryPtr const& factory ) { + m_factories.emplace(name, factory); + } + void ReporterRegistry::registerListener( IReporterFactoryPtr const& factory ) { + m_listeners.push_back( factory ); + } + + IReporterRegistry::FactoryMap const& ReporterRegistry::getFactories() const { + return m_factories; + } + IReporterRegistry::Listeners const& ReporterRegistry::getListeners() const { + return m_listeners; + } + +} +// end catch_reporter_registry.cpp +// start catch_result_type.cpp + +namespace Catch { + + bool isOk( ResultWas::OfType resultType ) { + return ( resultType & ResultWas::FailureBit ) == 0; + } + bool isJustInfo( int flags ) { + return flags == ResultWas::Info; + } + + ResultDisposition::Flags operator | ( ResultDisposition::Flags lhs, ResultDisposition::Flags rhs ) { + return static_cast( static_cast( lhs ) | static_cast( rhs ) ); + } + + bool shouldContinueOnFailure( int flags ) { return ( flags & ResultDisposition::ContinueOnFailure ) != 0; } + bool shouldSuppressFailure( int flags ) { return ( flags & ResultDisposition::SuppressFail ) != 0; } + +} // end namespace Catch +// end catch_result_type.cpp +// start catch_run_context.cpp + +#include +#include +#include + +namespace Catch { + + namespace Generators { + struct GeneratorTracker : TestCaseTracking::TrackerBase, IGeneratorTracker { + GeneratorBasePtr m_generator; + + GeneratorTracker( TestCaseTracking::NameAndLocation const& nameAndLocation, TrackerContext& ctx, ITracker* parent ) + : TrackerBase( nameAndLocation, ctx, parent ) + {} + ~GeneratorTracker(); + + static GeneratorTracker& acquire( TrackerContext& ctx, TestCaseTracking::NameAndLocation const& nameAndLocation ) { + std::shared_ptr tracker; + + ITracker& currentTracker = ctx.currentTracker(); + if( TestCaseTracking::ITrackerPtr childTracker = currentTracker.findChild( nameAndLocation ) ) { + assert( childTracker ); + assert( childTracker->isGeneratorTracker() ); + tracker = std::static_pointer_cast( childTracker ); + } + else { + tracker = std::make_shared( nameAndLocation, ctx, ¤tTracker ); + currentTracker.addChild( tracker ); + } + + if( !ctx.completedCycle() && !tracker->isComplete() ) { + tracker->open(); + } + + return *tracker; + } + + // TrackerBase interface + bool isGeneratorTracker() const override { return true; } + auto hasGenerator() const -> bool override { + return !!m_generator; + } + void close() override { + TrackerBase::close(); + // Generator interface only finds out if it has another item on atual move + if (m_runState == CompletedSuccessfully && m_generator->next()) { + m_children.clear(); + m_runState = Executing; + } + } + + // IGeneratorTracker interface + auto getGenerator() const -> GeneratorBasePtr const& override { + return m_generator; + } + void setGenerator( GeneratorBasePtr&& generator ) override { + m_generator = std::move( generator ); + } + }; + GeneratorTracker::~GeneratorTracker() {} + } + + RunContext::RunContext(IConfigPtr const& _config, IStreamingReporterPtr&& reporter) + : m_runInfo(_config->name()), + m_context(getCurrentMutableContext()), + m_config(_config), + m_reporter(std::move(reporter)), + m_lastAssertionInfo{ StringRef(), SourceLineInfo("",0), StringRef(), ResultDisposition::Normal }, + m_includeSuccessfulResults( m_config->includeSuccessfulResults() || m_reporter->getPreferences().shouldReportAllAssertions ) + { + m_context.setRunner(this); + m_context.setConfig(m_config); + m_context.setResultCapture(this); + m_reporter->testRunStarting(m_runInfo); + } + + RunContext::~RunContext() { + m_reporter->testRunEnded(TestRunStats(m_runInfo, m_totals, aborting())); + } + + void RunContext::testGroupStarting(std::string const& testSpec, std::size_t groupIndex, std::size_t groupsCount) { + m_reporter->testGroupStarting(GroupInfo(testSpec, groupIndex, groupsCount)); + } + + void RunContext::testGroupEnded(std::string const& testSpec, Totals const& totals, std::size_t groupIndex, std::size_t groupsCount) { + m_reporter->testGroupEnded(TestGroupStats(GroupInfo(testSpec, groupIndex, groupsCount), totals, aborting())); + } + + Totals RunContext::runTest(TestCase const& testCase) { + Totals prevTotals = m_totals; + + std::string redirectedCout; + std::string redirectedCerr; + + auto const& testInfo = testCase.getTestCaseInfo(); + + m_reporter->testCaseStarting(testInfo); + + m_activeTestCase = &testCase; + + ITracker& rootTracker = m_trackerContext.startRun(); + assert(rootTracker.isSectionTracker()); + static_cast(rootTracker).addInitialFilters(m_config->getSectionsToRun()); + do { + m_trackerContext.startCycle(); + m_testCaseTracker = &SectionTracker::acquire(m_trackerContext, TestCaseTracking::NameAndLocation(testInfo.name, testInfo.lineInfo)); + runCurrentTest(redirectedCout, redirectedCerr); + } while (!m_testCaseTracker->isSuccessfullyCompleted() && !aborting()); + + Totals deltaTotals = m_totals.delta(prevTotals); + if (testInfo.expectedToFail() && deltaTotals.testCases.passed > 0) { + deltaTotals.assertions.failed++; + deltaTotals.testCases.passed--; + deltaTotals.testCases.failed++; + } + m_totals.testCases += deltaTotals.testCases; + m_reporter->testCaseEnded(TestCaseStats(testInfo, + deltaTotals, + redirectedCout, + redirectedCerr, + aborting())); + + m_activeTestCase = nullptr; + m_testCaseTracker = nullptr; + + return deltaTotals; + } + + IConfigPtr RunContext::config() const { + return m_config; + } + + IStreamingReporter& RunContext::reporter() const { + return *m_reporter; + } + + void RunContext::assertionEnded(AssertionResult const & result) { + if (result.getResultType() == ResultWas::Ok) { + m_totals.assertions.passed++; + m_lastAssertionPassed = true; + } else if (!result.isOk()) { + m_lastAssertionPassed = false; + if( m_activeTestCase->getTestCaseInfo().okToFail() ) + m_totals.assertions.failedButOk++; + else + m_totals.assertions.failed++; + } + else { + m_lastAssertionPassed = true; + } + + // We have no use for the return value (whether messages should be cleared), because messages were made scoped + // and should be let to clear themselves out. + static_cast(m_reporter->assertionEnded(AssertionStats(result, m_messages, m_totals))); + + if (result.getResultType() != ResultWas::Warning) + m_messageScopes.clear(); + + // Reset working state + resetAssertionInfo(); + m_lastResult = result; + } + void RunContext::resetAssertionInfo() { + m_lastAssertionInfo.macroName = StringRef(); + m_lastAssertionInfo.capturedExpression = "{Unknown expression after the reported line}"_sr; + } + + bool RunContext::sectionStarted(SectionInfo const & sectionInfo, Counts & assertions) { + ITracker& sectionTracker = SectionTracker::acquire(m_trackerContext, TestCaseTracking::NameAndLocation(sectionInfo.name, sectionInfo.lineInfo)); + if (!sectionTracker.isOpen()) + return false; + m_activeSections.push_back(§ionTracker); + + m_lastAssertionInfo.lineInfo = sectionInfo.lineInfo; + + m_reporter->sectionStarting(sectionInfo); + + assertions = m_totals.assertions; + + return true; + } + auto RunContext::acquireGeneratorTracker( SourceLineInfo const& lineInfo ) -> IGeneratorTracker& { + using namespace Generators; + GeneratorTracker& tracker = GeneratorTracker::acquire( m_trackerContext, TestCaseTracking::NameAndLocation( "generator", lineInfo ) ); + assert( tracker.isOpen() ); + m_lastAssertionInfo.lineInfo = lineInfo; + return tracker; + } + + bool RunContext::testForMissingAssertions(Counts& assertions) { + if (assertions.total() != 0) + return false; + if (!m_config->warnAboutMissingAssertions()) + return false; + if (m_trackerContext.currentTracker().hasChildren()) + return false; + m_totals.assertions.failed++; + assertions.failed++; + return true; + } + + void RunContext::sectionEnded(SectionEndInfo const & endInfo) { + Counts assertions = m_totals.assertions - endInfo.prevAssertions; + bool missingAssertions = testForMissingAssertions(assertions); + + if (!m_activeSections.empty()) { + m_activeSections.back()->close(); + m_activeSections.pop_back(); + } + + m_reporter->sectionEnded(SectionStats(endInfo.sectionInfo, assertions, endInfo.durationInSeconds, missingAssertions)); + m_messages.clear(); + m_messageScopes.clear(); + } + + void RunContext::sectionEndedEarly(SectionEndInfo const & endInfo) { + if (m_unfinishedSections.empty()) + m_activeSections.back()->fail(); + else + m_activeSections.back()->close(); + m_activeSections.pop_back(); + + m_unfinishedSections.push_back(endInfo); + } + void RunContext::benchmarkStarting( BenchmarkInfo const& info ) { + m_reporter->benchmarkStarting( info ); + } + void RunContext::benchmarkEnded( BenchmarkStats const& stats ) { + m_reporter->benchmarkEnded( stats ); + } + + void RunContext::pushScopedMessage(MessageInfo const & message) { + m_messages.push_back(message); + } + + void RunContext::popScopedMessage(MessageInfo const & message) { + m_messages.erase(std::remove(m_messages.begin(), m_messages.end(), message), m_messages.end()); + } + + void RunContext::emplaceUnscopedMessage( MessageBuilder const& builder ) { + m_messageScopes.emplace_back( builder ); + } + + std::string RunContext::getCurrentTestName() const { + return m_activeTestCase + ? m_activeTestCase->getTestCaseInfo().name + : std::string(); + } + + const AssertionResult * RunContext::getLastResult() const { + return &(*m_lastResult); + } + + void RunContext::exceptionEarlyReported() { + m_shouldReportUnexpected = false; + } + + void RunContext::handleFatalErrorCondition( StringRef message ) { + // First notify reporter that bad things happened + m_reporter->fatalErrorEncountered(message); + + // Don't rebuild the result -- the stringification itself can cause more fatal errors + // Instead, fake a result data. + AssertionResultData tempResult( ResultWas::FatalErrorCondition, { false } ); + tempResult.message = message; + AssertionResult result(m_lastAssertionInfo, tempResult); + + assertionEnded(result); + + handleUnfinishedSections(); + + // Recreate section for test case (as we will lose the one that was in scope) + auto const& testCaseInfo = m_activeTestCase->getTestCaseInfo(); + SectionInfo testCaseSection(testCaseInfo.lineInfo, testCaseInfo.name); + + Counts assertions; + assertions.failed = 1; + SectionStats testCaseSectionStats(testCaseSection, assertions, 0, false); + m_reporter->sectionEnded(testCaseSectionStats); + + auto const& testInfo = m_activeTestCase->getTestCaseInfo(); + + Totals deltaTotals; + deltaTotals.testCases.failed = 1; + deltaTotals.assertions.failed = 1; + m_reporter->testCaseEnded(TestCaseStats(testInfo, + deltaTotals, + std::string(), + std::string(), + false)); + m_totals.testCases.failed++; + testGroupEnded(std::string(), m_totals, 1, 1); + m_reporter->testRunEnded(TestRunStats(m_runInfo, m_totals, false)); + } + + bool RunContext::lastAssertionPassed() { + return m_lastAssertionPassed; + } + + void RunContext::assertionPassed() { + m_lastAssertionPassed = true; + ++m_totals.assertions.passed; + resetAssertionInfo(); + m_messageScopes.clear(); + } + + bool RunContext::aborting() const { + return m_totals.assertions.failed >= static_cast(m_config->abortAfter()); + } + + void RunContext::runCurrentTest(std::string & redirectedCout, std::string & redirectedCerr) { + auto const& testCaseInfo = m_activeTestCase->getTestCaseInfo(); + SectionInfo testCaseSection(testCaseInfo.lineInfo, testCaseInfo.name); + m_reporter->sectionStarting(testCaseSection); + Counts prevAssertions = m_totals.assertions; + double duration = 0; + m_shouldReportUnexpected = true; + m_lastAssertionInfo = { "TEST_CASE"_sr, testCaseInfo.lineInfo, StringRef(), ResultDisposition::Normal }; + + seedRng(*m_config); + + Timer timer; + CATCH_TRY { + if (m_reporter->getPreferences().shouldRedirectStdOut) { +#if !defined(CATCH_CONFIG_EXPERIMENTAL_REDIRECT) + RedirectedStreams redirectedStreams(redirectedCout, redirectedCerr); + + timer.start(); + invokeActiveTestCase(); +#else + OutputRedirect r(redirectedCout, redirectedCerr); + timer.start(); + invokeActiveTestCase(); +#endif + } else { + timer.start(); + invokeActiveTestCase(); + } + duration = timer.getElapsedSeconds(); + } CATCH_CATCH_ANON (TestFailureException&) { + // This just means the test was aborted due to failure + } CATCH_CATCH_ALL { + // Under CATCH_CONFIG_FAST_COMPILE, unexpected exceptions under REQUIRE assertions + // are reported without translation at the point of origin. + if( m_shouldReportUnexpected ) { + AssertionReaction dummyReaction; + handleUnexpectedInflightException( m_lastAssertionInfo, translateActiveException(), dummyReaction ); + } + } + Counts assertions = m_totals.assertions - prevAssertions; + bool missingAssertions = testForMissingAssertions(assertions); + + m_testCaseTracker->close(); + handleUnfinishedSections(); + m_messages.clear(); + m_messageScopes.clear(); + + SectionStats testCaseSectionStats(testCaseSection, assertions, duration, missingAssertions); + m_reporter->sectionEnded(testCaseSectionStats); + } + + void RunContext::invokeActiveTestCase() { + FatalConditionHandler fatalConditionHandler; // Handle signals + m_activeTestCase->invoke(); + fatalConditionHandler.reset(); + } + + void RunContext::handleUnfinishedSections() { + // If sections ended prematurely due to an exception we stored their + // infos here so we can tear them down outside the unwind process. + for (auto it = m_unfinishedSections.rbegin(), + itEnd = m_unfinishedSections.rend(); + it != itEnd; + ++it) + sectionEnded(*it); + m_unfinishedSections.clear(); + } + + void RunContext::handleExpr( + AssertionInfo const& info, + ITransientExpression const& expr, + AssertionReaction& reaction + ) { + m_reporter->assertionStarting( info ); + + bool negated = isFalseTest( info.resultDisposition ); + bool result = expr.getResult() != negated; + + if( result ) { + if (!m_includeSuccessfulResults) { + assertionPassed(); + } + else { + reportExpr(info, ResultWas::Ok, &expr, negated); + } + } + else { + reportExpr(info, ResultWas::ExpressionFailed, &expr, negated ); + populateReaction( reaction ); + } + } + void RunContext::reportExpr( + AssertionInfo const &info, + ResultWas::OfType resultType, + ITransientExpression const *expr, + bool negated ) { + + m_lastAssertionInfo = info; + AssertionResultData data( resultType, LazyExpression( negated ) ); + + AssertionResult assertionResult{ info, data }; + assertionResult.m_resultData.lazyExpression.m_transientExpression = expr; + + assertionEnded( assertionResult ); + } + + void RunContext::handleMessage( + AssertionInfo const& info, + ResultWas::OfType resultType, + StringRef const& message, + AssertionReaction& reaction + ) { + m_reporter->assertionStarting( info ); + + m_lastAssertionInfo = info; + + AssertionResultData data( resultType, LazyExpression( false ) ); + data.message = message; + AssertionResult assertionResult{ m_lastAssertionInfo, data }; + assertionEnded( assertionResult ); + if( !assertionResult.isOk() ) + populateReaction( reaction ); + } + void RunContext::handleUnexpectedExceptionNotThrown( + AssertionInfo const& info, + AssertionReaction& reaction + ) { + handleNonExpr(info, Catch::ResultWas::DidntThrowException, reaction); + } + + void RunContext::handleUnexpectedInflightException( + AssertionInfo const& info, + std::string const& message, + AssertionReaction& reaction + ) { + m_lastAssertionInfo = info; + + AssertionResultData data( ResultWas::ThrewException, LazyExpression( false ) ); + data.message = message; + AssertionResult assertionResult{ info, data }; + assertionEnded( assertionResult ); + populateReaction( reaction ); + } + + void RunContext::populateReaction( AssertionReaction& reaction ) { + reaction.shouldDebugBreak = m_config->shouldDebugBreak(); + reaction.shouldThrow = aborting() || (m_lastAssertionInfo.resultDisposition & ResultDisposition::Normal); + } + + void RunContext::handleIncomplete( + AssertionInfo const& info + ) { + m_lastAssertionInfo = info; + + AssertionResultData data( ResultWas::ThrewException, LazyExpression( false ) ); + data.message = "Exception translation was disabled by CATCH_CONFIG_FAST_COMPILE"; + AssertionResult assertionResult{ info, data }; + assertionEnded( assertionResult ); + } + void RunContext::handleNonExpr( + AssertionInfo const &info, + ResultWas::OfType resultType, + AssertionReaction &reaction + ) { + m_lastAssertionInfo = info; + + AssertionResultData data( resultType, LazyExpression( false ) ); + AssertionResult assertionResult{ info, data }; + assertionEnded( assertionResult ); + + if( !assertionResult.isOk() ) + populateReaction( reaction ); + } + + IResultCapture& getResultCapture() { + if (auto* capture = getCurrentContext().getResultCapture()) + return *capture; + else + CATCH_INTERNAL_ERROR("No result capture instance"); + } +} +// end catch_run_context.cpp +// start catch_section.cpp + +namespace Catch { + + Section::Section( SectionInfo const& info ) + : m_info( info ), + m_sectionIncluded( getResultCapture().sectionStarted( m_info, m_assertions ) ) + { + m_timer.start(); + } + + Section::~Section() { + if( m_sectionIncluded ) { + SectionEndInfo endInfo{ m_info, m_assertions, m_timer.getElapsedSeconds() }; + if( uncaught_exceptions() ) + getResultCapture().sectionEndedEarly( endInfo ); + else + getResultCapture().sectionEnded( endInfo ); + } + } + + // This indicates whether the section should be executed or not + Section::operator bool() const { + return m_sectionIncluded; + } + +} // end namespace Catch +// end catch_section.cpp +// start catch_section_info.cpp + +namespace Catch { + + SectionInfo::SectionInfo + ( SourceLineInfo const& _lineInfo, + std::string const& _name ) + : name( _name ), + lineInfo( _lineInfo ) + {} + +} // end namespace Catch +// end catch_section_info.cpp +// start catch_session.cpp + +// start catch_session.h + +#include + +namespace Catch { + + class Session : NonCopyable { + public: + + Session(); + ~Session() override; + + void showHelp() const; + void libIdentify(); + + int applyCommandLine( int argc, char const * const * argv ); + #if defined(CATCH_CONFIG_WCHAR) && defined(WIN32) && defined(UNICODE) + int applyCommandLine( int argc, wchar_t const * const * argv ); + #endif + + void useConfigData( ConfigData const& configData ); + + template + int run(int argc, CharT const * const argv[]) { + if (m_startupExceptions) + return 1; + int returnCode = applyCommandLine(argc, argv); + if (returnCode == 0) + returnCode = run(); + return returnCode; + } + + int run(); + + clara::Parser const& cli() const; + void cli( clara::Parser const& newParser ); + ConfigData& configData(); + Config& config(); + private: + int runInternal(); + + clara::Parser m_cli; + ConfigData m_configData; + std::shared_ptr m_config; + bool m_startupExceptions = false; + }; + +} // end namespace Catch + +// end catch_session.h +// start catch_version.h + +#include + +namespace Catch { + + // Versioning information + struct Version { + Version( Version const& ) = delete; + Version& operator=( Version const& ) = delete; + Version( unsigned int _majorVersion, + unsigned int _minorVersion, + unsigned int _patchNumber, + char const * const _branchName, + unsigned int _buildNumber ); + + unsigned int const majorVersion; + unsigned int const minorVersion; + unsigned int const patchNumber; + + // buildNumber is only used if branchName is not null + char const * const branchName; + unsigned int const buildNumber; + + friend std::ostream& operator << ( std::ostream& os, Version const& version ); + }; + + Version const& libraryVersion(); +} + +// end catch_version.h +#include +#include + +namespace Catch { + + namespace { + const int MaxExitCode = 255; + + IStreamingReporterPtr createReporter(std::string const& reporterName, IConfigPtr const& config) { + auto reporter = Catch::getRegistryHub().getReporterRegistry().create(reporterName, config); + CATCH_ENFORCE(reporter, "No reporter registered with name: '" << reporterName << "'"); + + return reporter; + } + + IStreamingReporterPtr makeReporter(std::shared_ptr const& config) { + if (Catch::getRegistryHub().getReporterRegistry().getListeners().empty()) { + return createReporter(config->getReporterName(), config); + } + + // On older platforms, returning std::unique_ptr + // when the return type is std::unique_ptr + // doesn't compile without a std::move call. However, this causes + // a warning on newer platforms. Thus, we have to work around + // it a bit and downcast the pointer manually. + auto ret = std::unique_ptr(new ListeningReporter); + auto& multi = static_cast(*ret); + auto const& listeners = Catch::getRegistryHub().getReporterRegistry().getListeners(); + for (auto const& listener : listeners) { + multi.addListener(listener->create(Catch::ReporterConfig(config))); + } + multi.addReporter(createReporter(config->getReporterName(), config)); + return ret; + } + + Catch::Totals runTests(std::shared_ptr const& config) { + auto reporter = makeReporter(config); + + RunContext context(config, std::move(reporter)); + + Totals totals; + + context.testGroupStarting(config->name(), 1, 1); + + TestSpec testSpec = config->testSpec(); + + auto const& allTestCases = getAllTestCasesSorted(*config); + for (auto const& testCase : allTestCases) { + if (!context.aborting() && matchTest(testCase, testSpec, *config)) + totals += context.runTest(testCase); + else + context.reporter().skipTest(testCase); + } + + if (config->warnAboutNoTests() && totals.testCases.total() == 0) { + ReusableStringStream testConfig; + + bool first = true; + for (const auto& input : config->getTestsOrTags()) { + if (!first) { testConfig << ' '; } + first = false; + testConfig << input; + } + + context.reporter().noMatchingTestCases(testConfig.str()); + totals.error = -1; + } + + context.testGroupEnded(config->name(), totals, 1, 1); + return totals; + } + + void applyFilenamesAsTags(Catch::IConfig const& config) { + auto& tests = const_cast&>(getAllTestCasesSorted(config)); + for (auto& testCase : tests) { + auto tags = testCase.tags; + + std::string filename = testCase.lineInfo.file; + auto lastSlash = filename.find_last_of("\\/"); + if (lastSlash != std::string::npos) { + filename.erase(0, lastSlash); + filename[0] = '#'; + } + + auto lastDot = filename.find_last_of('.'); + if (lastDot != std::string::npos) { + filename.erase(lastDot); + } + + tags.push_back(std::move(filename)); + setTags(testCase, tags); + } + } + + } // anon namespace + + Session::Session() { + static bool alreadyInstantiated = false; + if( alreadyInstantiated ) { + CATCH_TRY { CATCH_INTERNAL_ERROR( "Only one instance of Catch::Session can ever be used" ); } + CATCH_CATCH_ALL { getMutableRegistryHub().registerStartupException(); } + } + + // There cannot be exceptions at startup in no-exception mode. +#if !defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) + const auto& exceptions = getRegistryHub().getStartupExceptionRegistry().getExceptions(); + if ( !exceptions.empty() ) { + m_startupExceptions = true; + Colour colourGuard( Colour::Red ); + Catch::cerr() << "Errors occurred during startup!" << '\n'; + // iterate over all exceptions and notify user + for ( const auto& ex_ptr : exceptions ) { + try { + std::rethrow_exception(ex_ptr); + } catch ( std::exception const& ex ) { + Catch::cerr() << Column( ex.what() ).indent(2) << '\n'; + } + } + } +#endif + + alreadyInstantiated = true; + m_cli = makeCommandLineParser( m_configData ); + } + Session::~Session() { + Catch::cleanUp(); + } + + void Session::showHelp() const { + Catch::cout() + << "\nCatch v" << libraryVersion() << "\n" + << m_cli << std::endl + << "For more detailed usage please see the project docs\n" << std::endl; + } + void Session::libIdentify() { + Catch::cout() + << std::left << std::setw(16) << "description: " << "A Catch test executable\n" + << std::left << std::setw(16) << "category: " << "testframework\n" + << std::left << std::setw(16) << "framework: " << "Catch Test\n" + << std::left << std::setw(16) << "version: " << libraryVersion() << std::endl; + } + + int Session::applyCommandLine( int argc, char const * const * argv ) { + if( m_startupExceptions ) + return 1; + + auto result = m_cli.parse( clara::Args( argc, argv ) ); + if( !result ) { + config(); + getCurrentMutableContext().setConfig(m_config); + Catch::cerr() + << Colour( Colour::Red ) + << "\nError(s) in input:\n" + << Column( result.errorMessage() ).indent( 2 ) + << "\n\n"; + Catch::cerr() << "Run with -? for usage\n" << std::endl; + return MaxExitCode; + } + + if( m_configData.showHelp ) + showHelp(); + if( m_configData.libIdentify ) + libIdentify(); + m_config.reset(); + return 0; + } + +#if defined(CATCH_CONFIG_WCHAR) && defined(WIN32) && defined(UNICODE) + int Session::applyCommandLine( int argc, wchar_t const * const * argv ) { + + char **utf8Argv = new char *[ argc ]; + + for ( int i = 0; i < argc; ++i ) { + int bufSize = WideCharToMultiByte( CP_UTF8, 0, argv[i], -1, NULL, 0, NULL, NULL ); + + utf8Argv[ i ] = new char[ bufSize ]; + + WideCharToMultiByte( CP_UTF8, 0, argv[i], -1, utf8Argv[i], bufSize, NULL, NULL ); + } + + int returnCode = applyCommandLine( argc, utf8Argv ); + + for ( int i = 0; i < argc; ++i ) + delete [] utf8Argv[ i ]; + + delete [] utf8Argv; + + return returnCode; + } +#endif + + void Session::useConfigData( ConfigData const& configData ) { + m_configData = configData; + m_config.reset(); + } + + int Session::run() { + if( ( m_configData.waitForKeypress & WaitForKeypress::BeforeStart ) != 0 ) { + Catch::cout() << "...waiting for enter/ return before starting" << std::endl; + static_cast(std::getchar()); + } + int exitCode = runInternal(); + if( ( m_configData.waitForKeypress & WaitForKeypress::BeforeExit ) != 0 ) { + Catch::cout() << "...waiting for enter/ return before exiting, with code: " << exitCode << std::endl; + static_cast(std::getchar()); + } + return exitCode; + } + + clara::Parser const& Session::cli() const { + return m_cli; + } + void Session::cli( clara::Parser const& newParser ) { + m_cli = newParser; + } + ConfigData& Session::configData() { + return m_configData; + } + Config& Session::config() { + if( !m_config ) + m_config = std::make_shared( m_configData ); + return *m_config; + } + + int Session::runInternal() { + if( m_startupExceptions ) + return 1; + + if (m_configData.showHelp || m_configData.libIdentify) { + return 0; + } + + CATCH_TRY { + config(); // Force config to be constructed + + seedRng( *m_config ); + + if( m_configData.filenamesAsTags ) + applyFilenamesAsTags( *m_config ); + + // Handle list request + if( Option listed = list( m_config ) ) + return static_cast( *listed ); + + auto totals = runTests( m_config ); + // Note that on unices only the lower 8 bits are usually used, clamping + // the return value to 255 prevents false negative when some multiple + // of 256 tests has failed + return (std::min) (MaxExitCode, (std::max) (totals.error, static_cast(totals.assertions.failed))); + } +#if !defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) + catch( std::exception& ex ) { + Catch::cerr() << ex.what() << std::endl; + return MaxExitCode; + } +#endif + } + +} // end namespace Catch +// end catch_session.cpp +// start catch_singletons.cpp + +#include + +namespace Catch { + + namespace { + static auto getSingletons() -> std::vector*& { + static std::vector* g_singletons = nullptr; + if( !g_singletons ) + g_singletons = new std::vector(); + return g_singletons; + } + } + + ISingleton::~ISingleton() {} + + void addSingleton(ISingleton* singleton ) { + getSingletons()->push_back( singleton ); + } + void cleanupSingletons() { + auto& singletons = getSingletons(); + for( auto singleton : *singletons ) + delete singleton; + delete singletons; + singletons = nullptr; + } + +} // namespace Catch +// end catch_singletons.cpp +// start catch_startup_exception_registry.cpp + +namespace Catch { +void StartupExceptionRegistry::add( std::exception_ptr const& exception ) noexcept { + CATCH_TRY { + m_exceptions.push_back(exception); + } CATCH_CATCH_ALL { + // If we run out of memory during start-up there's really not a lot more we can do about it + std::terminate(); + } + } + + std::vector const& StartupExceptionRegistry::getExceptions() const noexcept { + return m_exceptions; + } + +} // end namespace Catch +// end catch_startup_exception_registry.cpp +// start catch_stream.cpp + +#include +#include +#include +#include +#include +#include + +namespace Catch { + + Catch::IStream::~IStream() = default; + + namespace detail { namespace { + template + class StreamBufImpl : public std::streambuf { + char data[bufferSize]; + WriterF m_writer; + + public: + StreamBufImpl() { + setp( data, data + sizeof(data) ); + } + + ~StreamBufImpl() noexcept { + StreamBufImpl::sync(); + } + + private: + int overflow( int c ) override { + sync(); + + if( c != EOF ) { + if( pbase() == epptr() ) + m_writer( std::string( 1, static_cast( c ) ) ); + else + sputc( static_cast( c ) ); + } + return 0; + } + + int sync() override { + if( pbase() != pptr() ) { + m_writer( std::string( pbase(), static_cast( pptr() - pbase() ) ) ); + setp( pbase(), epptr() ); + } + return 0; + } + }; + + /////////////////////////////////////////////////////////////////////////// + + struct OutputDebugWriter { + + void operator()( std::string const&str ) { + writeToDebugConsole( str ); + } + }; + + /////////////////////////////////////////////////////////////////////////// + + class FileStream : public IStream { + mutable std::ofstream m_ofs; + public: + FileStream( StringRef filename ) { + m_ofs.open( filename.c_str() ); + CATCH_ENFORCE( !m_ofs.fail(), "Unable to open file: '" << filename << "'" ); + } + ~FileStream() override = default; + public: // IStream + std::ostream& stream() const override { + return m_ofs; + } + }; + + /////////////////////////////////////////////////////////////////////////// + + class CoutStream : public IStream { + mutable std::ostream m_os; + public: + // Store the streambuf from cout up-front because + // cout may get redirected when running tests + CoutStream() : m_os( Catch::cout().rdbuf() ) {} + ~CoutStream() override = default; + + public: // IStream + std::ostream& stream() const override { return m_os; } + }; + + /////////////////////////////////////////////////////////////////////////// + + class DebugOutStream : public IStream { + std::unique_ptr> m_streamBuf; + mutable std::ostream m_os; + public: + DebugOutStream() + : m_streamBuf( new StreamBufImpl() ), + m_os( m_streamBuf.get() ) + {} + + ~DebugOutStream() override = default; + + public: // IStream + std::ostream& stream() const override { return m_os; } + }; + + }} // namespace anon::detail + + /////////////////////////////////////////////////////////////////////////// + + auto makeStream( StringRef const &filename ) -> IStream const* { + if( filename.empty() ) + return new detail::CoutStream(); + else if( filename[0] == '%' ) { + if( filename == "%debug" ) + return new detail::DebugOutStream(); + else + CATCH_ERROR( "Unrecognised stream: '" << filename << "'" ); + } + else + return new detail::FileStream( filename ); + } + + // This class encapsulates the idea of a pool of ostringstreams that can be reused. + struct StringStreams { + std::vector> m_streams; + std::vector m_unused; + std::ostringstream m_referenceStream; // Used for copy state/ flags from + + auto add() -> std::size_t { + if( m_unused.empty() ) { + m_streams.push_back( std::unique_ptr( new std::ostringstream ) ); + return m_streams.size()-1; + } + else { + auto index = m_unused.back(); + m_unused.pop_back(); + return index; + } + } + + void release( std::size_t index ) { + m_streams[index]->copyfmt( m_referenceStream ); // Restore initial flags and other state + m_unused.push_back(index); + } + }; + + ReusableStringStream::ReusableStringStream() + : m_index( Singleton::getMutable().add() ), + m_oss( Singleton::getMutable().m_streams[m_index].get() ) + {} + + ReusableStringStream::~ReusableStringStream() { + static_cast( m_oss )->str(""); + m_oss->clear(); + Singleton::getMutable().release( m_index ); + } + + auto ReusableStringStream::str() const -> std::string { + return static_cast( m_oss )->str(); + } + + /////////////////////////////////////////////////////////////////////////// + +#ifndef CATCH_CONFIG_NOSTDOUT // If you #define this you must implement these functions + std::ostream& cout() { return std::cout; } + std::ostream& cerr() { return std::cerr; } + std::ostream& clog() { return std::clog; } +#endif +} +// end catch_stream.cpp +// start catch_string_manip.cpp + +#include +#include +#include +#include + +namespace Catch { + + namespace { + char toLowerCh(char c) { + return static_cast( std::tolower( c ) ); + } + } + + bool startsWith( std::string const& s, std::string const& prefix ) { + return s.size() >= prefix.size() && std::equal(prefix.begin(), prefix.end(), s.begin()); + } + bool startsWith( std::string const& s, char prefix ) { + return !s.empty() && s[0] == prefix; + } + bool endsWith( std::string const& s, std::string const& suffix ) { + return s.size() >= suffix.size() && std::equal(suffix.rbegin(), suffix.rend(), s.rbegin()); + } + bool endsWith( std::string const& s, char suffix ) { + return !s.empty() && s[s.size()-1] == suffix; + } + bool contains( std::string const& s, std::string const& infix ) { + return s.find( infix ) != std::string::npos; + } + void toLowerInPlace( std::string& s ) { + std::transform( s.begin(), s.end(), s.begin(), toLowerCh ); + } + std::string toLower( std::string const& s ) { + std::string lc = s; + toLowerInPlace( lc ); + return lc; + } + std::string trim( std::string const& str ) { + static char const* whitespaceChars = "\n\r\t "; + std::string::size_type start = str.find_first_not_of( whitespaceChars ); + std::string::size_type end = str.find_last_not_of( whitespaceChars ); + + return start != std::string::npos ? str.substr( start, 1+end-start ) : std::string(); + } + + bool replaceInPlace( std::string& str, std::string const& replaceThis, std::string const& withThis ) { + bool replaced = false; + std::size_t i = str.find( replaceThis ); + while( i != std::string::npos ) { + replaced = true; + str = str.substr( 0, i ) + withThis + str.substr( i+replaceThis.size() ); + if( i < str.size()-withThis.size() ) + i = str.find( replaceThis, i+withThis.size() ); + else + i = std::string::npos; + } + return replaced; + } + + pluralise::pluralise( std::size_t count, std::string const& label ) + : m_count( count ), + m_label( label ) + {} + + std::ostream& operator << ( std::ostream& os, pluralise const& pluraliser ) { + os << pluraliser.m_count << ' ' << pluraliser.m_label; + if( pluraliser.m_count != 1 ) + os << 's'; + return os; + } + +} +// end catch_string_manip.cpp +// start catch_stringref.cpp + +#if defined(__clang__) +# pragma clang diagnostic push +# pragma clang diagnostic ignored "-Wexit-time-destructors" +#endif + +#include +#include +#include + +namespace { + const uint32_t byte_2_lead = 0xC0; + const uint32_t byte_3_lead = 0xE0; + const uint32_t byte_4_lead = 0xF0; +} + +namespace Catch { + StringRef::StringRef( char const* rawChars ) noexcept + : StringRef( rawChars, static_cast(std::strlen(rawChars) ) ) + {} + + StringRef::operator std::string() const { + return std::string( m_start, m_size ); + } + + void StringRef::swap( StringRef& other ) noexcept { + std::swap( m_start, other.m_start ); + std::swap( m_size, other.m_size ); + std::swap( m_data, other.m_data ); + } + + auto StringRef::c_str() const -> char const* { + if( isSubstring() ) + const_cast( this )->takeOwnership(); + return m_start; + } + auto StringRef::currentData() const noexcept -> char const* { + return m_start; + } + + auto StringRef::isOwned() const noexcept -> bool { + return m_data != nullptr; + } + auto StringRef::isSubstring() const noexcept -> bool { + return m_start[m_size] != '\0'; + } + + void StringRef::takeOwnership() { + if( !isOwned() ) { + m_data = new char[m_size+1]; + memcpy( m_data, m_start, m_size ); + m_data[m_size] = '\0'; + m_start = m_data; + } + } + auto StringRef::substr( size_type start, size_type size ) const noexcept -> StringRef { + if( start < m_size ) + return StringRef( m_start+start, size ); + else + return StringRef(); + } + auto StringRef::operator == ( StringRef const& other ) const noexcept -> bool { + return + size() == other.size() && + (std::strncmp( m_start, other.m_start, size() ) == 0); + } + auto StringRef::operator != ( StringRef const& other ) const noexcept -> bool { + return !operator==( other ); + } + + auto StringRef::operator[](size_type index) const noexcept -> char { + return m_start[index]; + } + + auto StringRef::numberOfCharacters() const noexcept -> size_type { + size_type noChars = m_size; + // Make adjustments for uft encodings + for( size_type i=0; i < m_size; ++i ) { + char c = m_start[i]; + if( ( c & byte_2_lead ) == byte_2_lead ) { + noChars--; + if (( c & byte_3_lead ) == byte_3_lead ) + noChars--; + if( ( c & byte_4_lead ) == byte_4_lead ) + noChars--; + } + } + return noChars; + } + + auto operator + ( StringRef const& lhs, StringRef const& rhs ) -> std::string { + std::string str; + str.reserve( lhs.size() + rhs.size() ); + str += lhs; + str += rhs; + return str; + } + auto operator + ( StringRef const& lhs, const char* rhs ) -> std::string { + return std::string( lhs ) + std::string( rhs ); + } + auto operator + ( char const* lhs, StringRef const& rhs ) -> std::string { + return std::string( lhs ) + std::string( rhs ); + } + + auto operator << ( std::ostream& os, StringRef const& str ) -> std::ostream& { + return os.write(str.currentData(), str.size()); + } + + auto operator+=( std::string& lhs, StringRef const& rhs ) -> std::string& { + lhs.append(rhs.currentData(), rhs.size()); + return lhs; + } + +} // namespace Catch + +#if defined(__clang__) +# pragma clang diagnostic pop +#endif +// end catch_stringref.cpp +// start catch_tag_alias.cpp + +namespace Catch { + TagAlias::TagAlias(std::string const & _tag, SourceLineInfo _lineInfo): tag(_tag), lineInfo(_lineInfo) {} +} +// end catch_tag_alias.cpp +// start catch_tag_alias_autoregistrar.cpp + +namespace Catch { + + RegistrarForTagAliases::RegistrarForTagAliases(char const* alias, char const* tag, SourceLineInfo const& lineInfo) { + CATCH_TRY { + getMutableRegistryHub().registerTagAlias(alias, tag, lineInfo); + } CATCH_CATCH_ALL { + // Do not throw when constructing global objects, instead register the exception to be processed later + getMutableRegistryHub().registerStartupException(); + } + } + +} +// end catch_tag_alias_autoregistrar.cpp +// start catch_tag_alias_registry.cpp + +#include + +namespace Catch { + + TagAliasRegistry::~TagAliasRegistry() {} + + TagAlias const* TagAliasRegistry::find( std::string const& alias ) const { + auto it = m_registry.find( alias ); + if( it != m_registry.end() ) + return &(it->second); + else + return nullptr; + } + + std::string TagAliasRegistry::expandAliases( std::string const& unexpandedTestSpec ) const { + std::string expandedTestSpec = unexpandedTestSpec; + for( auto const& registryKvp : m_registry ) { + std::size_t pos = expandedTestSpec.find( registryKvp.first ); + if( pos != std::string::npos ) { + expandedTestSpec = expandedTestSpec.substr( 0, pos ) + + registryKvp.second.tag + + expandedTestSpec.substr( pos + registryKvp.first.size() ); + } + } + return expandedTestSpec; + } + + void TagAliasRegistry::add( std::string const& alias, std::string const& tag, SourceLineInfo const& lineInfo ) { + CATCH_ENFORCE( startsWith(alias, "[@") && endsWith(alias, ']'), + "error: tag alias, '" << alias << "' is not of the form [@alias name].\n" << lineInfo ); + + CATCH_ENFORCE( m_registry.insert(std::make_pair(alias, TagAlias(tag, lineInfo))).second, + "error: tag alias, '" << alias << "' already registered.\n" + << "\tFirst seen at: " << find(alias)->lineInfo << "\n" + << "\tRedefined at: " << lineInfo ); + } + + ITagAliasRegistry::~ITagAliasRegistry() {} + + ITagAliasRegistry const& ITagAliasRegistry::get() { + return getRegistryHub().getTagAliasRegistry(); + } + +} // end namespace Catch +// end catch_tag_alias_registry.cpp +// start catch_test_case_info.cpp + +#include +#include +#include +#include + +namespace Catch { + + namespace { + TestCaseInfo::SpecialProperties parseSpecialTag( std::string const& tag ) { + if( startsWith( tag, '.' ) || + tag == "!hide" ) + return TestCaseInfo::IsHidden; + else if( tag == "!throws" ) + return TestCaseInfo::Throws; + else if( tag == "!shouldfail" ) + return TestCaseInfo::ShouldFail; + else if( tag == "!mayfail" ) + return TestCaseInfo::MayFail; + else if( tag == "!nonportable" ) + return TestCaseInfo::NonPortable; + else if( tag == "!benchmark" ) + return static_cast( TestCaseInfo::Benchmark | TestCaseInfo::IsHidden ); + else + return TestCaseInfo::None; + } + bool isReservedTag( std::string const& tag ) { + return parseSpecialTag( tag ) == TestCaseInfo::None && tag.size() > 0 && !std::isalnum( static_cast(tag[0]) ); + } + void enforceNotReservedTag( std::string const& tag, SourceLineInfo const& _lineInfo ) { + CATCH_ENFORCE( !isReservedTag(tag), + "Tag name: [" << tag << "] is not allowed.\n" + << "Tag names starting with non alpha-numeric characters are reserved\n" + << _lineInfo ); + } + } + + TestCase makeTestCase( ITestInvoker* _testCase, + std::string const& _className, + NameAndTags const& nameAndTags, + SourceLineInfo const& _lineInfo ) + { + bool isHidden = false; + + // Parse out tags + std::vector tags; + std::string desc, tag; + bool inTag = false; + std::string _descOrTags = nameAndTags.tags; + for (char c : _descOrTags) { + if( !inTag ) { + if( c == '[' ) + inTag = true; + else + desc += c; + } + else { + if( c == ']' ) { + TestCaseInfo::SpecialProperties prop = parseSpecialTag( tag ); + if( ( prop & TestCaseInfo::IsHidden ) != 0 ) + isHidden = true; + else if( prop == TestCaseInfo::None ) + enforceNotReservedTag( tag, _lineInfo ); + + tags.push_back( tag ); + tag.clear(); + inTag = false; + } + else + tag += c; + } + } + if( isHidden ) { + tags.push_back( "." ); + } + + TestCaseInfo info( nameAndTags.name, _className, desc, tags, _lineInfo ); + return TestCase( _testCase, std::move(info) ); + } + + void setTags( TestCaseInfo& testCaseInfo, std::vector tags ) { + std::sort(begin(tags), end(tags)); + tags.erase(std::unique(begin(tags), end(tags)), end(tags)); + testCaseInfo.lcaseTags.clear(); + + for( auto const& tag : tags ) { + std::string lcaseTag = toLower( tag ); + testCaseInfo.properties = static_cast( testCaseInfo.properties | parseSpecialTag( lcaseTag ) ); + testCaseInfo.lcaseTags.push_back( lcaseTag ); + } + testCaseInfo.tags = std::move(tags); + } + + TestCaseInfo::TestCaseInfo( std::string const& _name, + std::string const& _className, + std::string const& _description, + std::vector const& _tags, + SourceLineInfo const& _lineInfo ) + : name( _name ), + className( _className ), + description( _description ), + lineInfo( _lineInfo ), + properties( None ) + { + setTags( *this, _tags ); + } + + bool TestCaseInfo::isHidden() const { + return ( properties & IsHidden ) != 0; + } + bool TestCaseInfo::throws() const { + return ( properties & Throws ) != 0; + } + bool TestCaseInfo::okToFail() const { + return ( properties & (ShouldFail | MayFail ) ) != 0; + } + bool TestCaseInfo::expectedToFail() const { + return ( properties & (ShouldFail ) ) != 0; + } + + std::string TestCaseInfo::tagsAsString() const { + std::string ret; + // '[' and ']' per tag + std::size_t full_size = 2 * tags.size(); + for (const auto& tag : tags) { + full_size += tag.size(); + } + ret.reserve(full_size); + for (const auto& tag : tags) { + ret.push_back('['); + ret.append(tag); + ret.push_back(']'); + } + + return ret; + } + + TestCase::TestCase( ITestInvoker* testCase, TestCaseInfo&& info ) : TestCaseInfo( std::move(info) ), test( testCase ) {} + + TestCase TestCase::withName( std::string const& _newName ) const { + TestCase other( *this ); + other.name = _newName; + return other; + } + + void TestCase::invoke() const { + test->invoke(); + } + + bool TestCase::operator == ( TestCase const& other ) const { + return test.get() == other.test.get() && + name == other.name && + className == other.className; + } + + bool TestCase::operator < ( TestCase const& other ) const { + return name < other.name; + } + + TestCaseInfo const& TestCase::getTestCaseInfo() const + { + return *this; + } + +} // end namespace Catch +// end catch_test_case_info.cpp +// start catch_test_case_registry_impl.cpp + +#include + +namespace Catch { + + std::vector sortTests( IConfig const& config, std::vector const& unsortedTestCases ) { + + std::vector sorted = unsortedTestCases; + + switch( config.runOrder() ) { + case RunTests::InLexicographicalOrder: + std::sort( sorted.begin(), sorted.end() ); + break; + case RunTests::InRandomOrder: + seedRng( config ); + std::shuffle( sorted.begin(), sorted.end(), rng() ); + break; + case RunTests::InDeclarationOrder: + // already in declaration order + break; + } + return sorted; + } + bool matchTest( TestCase const& testCase, TestSpec const& testSpec, IConfig const& config ) { + return testSpec.matches( testCase ) && ( config.allowThrows() || !testCase.throws() ); + } + + void enforceNoDuplicateTestCases( std::vector const& functions ) { + std::set seenFunctions; + for( auto const& function : functions ) { + auto prev = seenFunctions.insert( function ); + CATCH_ENFORCE( prev.second, + "error: TEST_CASE( \"" << function.name << "\" ) already defined.\n" + << "\tFirst seen at " << prev.first->getTestCaseInfo().lineInfo << "\n" + << "\tRedefined at " << function.getTestCaseInfo().lineInfo ); + } + } + + std::vector filterTests( std::vector const& testCases, TestSpec const& testSpec, IConfig const& config ) { + std::vector filtered; + filtered.reserve( testCases.size() ); + for( auto const& testCase : testCases ) + if( matchTest( testCase, testSpec, config ) ) + filtered.push_back( testCase ); + return filtered; + } + std::vector const& getAllTestCasesSorted( IConfig const& config ) { + return getRegistryHub().getTestCaseRegistry().getAllTestsSorted( config ); + } + + void TestRegistry::registerTest( TestCase const& testCase ) { + std::string name = testCase.getTestCaseInfo().name; + if( name.empty() ) { + ReusableStringStream rss; + rss << "Anonymous test case " << ++m_unnamedCount; + return registerTest( testCase.withName( rss.str() ) ); + } + m_functions.push_back( testCase ); + } + + std::vector const& TestRegistry::getAllTests() const { + return m_functions; + } + std::vector const& TestRegistry::getAllTestsSorted( IConfig const& config ) const { + if( m_sortedFunctions.empty() ) + enforceNoDuplicateTestCases( m_functions ); + + if( m_currentSortOrder != config.runOrder() || m_sortedFunctions.empty() ) { + m_sortedFunctions = sortTests( config, m_functions ); + m_currentSortOrder = config.runOrder(); + } + return m_sortedFunctions; + } + + /////////////////////////////////////////////////////////////////////////// + TestInvokerAsFunction::TestInvokerAsFunction( void(*testAsFunction)() ) noexcept : m_testAsFunction( testAsFunction ) {} + + void TestInvokerAsFunction::invoke() const { + m_testAsFunction(); + } + + std::string extractClassName( StringRef const& classOrQualifiedMethodName ) { + std::string className = classOrQualifiedMethodName; + if( startsWith( className, '&' ) ) + { + std::size_t lastColons = className.rfind( "::" ); + std::size_t penultimateColons = className.rfind( "::", lastColons-1 ); + if( penultimateColons == std::string::npos ) + penultimateColons = 1; + className = className.substr( penultimateColons, lastColons-penultimateColons ); + } + return className; + } + +} // end namespace Catch +// end catch_test_case_registry_impl.cpp +// start catch_test_case_tracker.cpp + +#include +#include +#include +#include +#include + +#if defined(__clang__) +# pragma clang diagnostic push +# pragma clang diagnostic ignored "-Wexit-time-destructors" +#endif + +namespace Catch { +namespace TestCaseTracking { + + NameAndLocation::NameAndLocation( std::string const& _name, SourceLineInfo const& _location ) + : name( _name ), + location( _location ) + {} + + ITracker::~ITracker() = default; + + TrackerContext& TrackerContext::instance() { + static TrackerContext s_instance; + return s_instance; + } + + ITracker& TrackerContext::startRun() { + m_rootTracker = std::make_shared( NameAndLocation( "{root}", CATCH_INTERNAL_LINEINFO ), *this, nullptr ); + m_currentTracker = nullptr; + m_runState = Executing; + return *m_rootTracker; + } + + void TrackerContext::endRun() { + m_rootTracker.reset(); + m_currentTracker = nullptr; + m_runState = NotStarted; + } + + void TrackerContext::startCycle() { + m_currentTracker = m_rootTracker.get(); + m_runState = Executing; + } + void TrackerContext::completeCycle() { + m_runState = CompletedCycle; + } + + bool TrackerContext::completedCycle() const { + return m_runState == CompletedCycle; + } + ITracker& TrackerContext::currentTracker() { + return *m_currentTracker; + } + void TrackerContext::setCurrentTracker( ITracker* tracker ) { + m_currentTracker = tracker; + } + + TrackerBase::TrackerBase( NameAndLocation const& nameAndLocation, TrackerContext& ctx, ITracker* parent ) + : m_nameAndLocation( nameAndLocation ), + m_ctx( ctx ), + m_parent( parent ) + {} + + NameAndLocation const& TrackerBase::nameAndLocation() const { + return m_nameAndLocation; + } + bool TrackerBase::isComplete() const { + return m_runState == CompletedSuccessfully || m_runState == Failed; + } + bool TrackerBase::isSuccessfullyCompleted() const { + return m_runState == CompletedSuccessfully; + } + bool TrackerBase::isOpen() const { + return m_runState != NotStarted && !isComplete(); + } + bool TrackerBase::hasChildren() const { + return !m_children.empty(); + } + + void TrackerBase::addChild( ITrackerPtr const& child ) { + m_children.push_back( child ); + } + + ITrackerPtr TrackerBase::findChild( NameAndLocation const& nameAndLocation ) { + auto it = std::find_if( m_children.begin(), m_children.end(), + [&nameAndLocation]( ITrackerPtr const& tracker ){ + return + tracker->nameAndLocation().location == nameAndLocation.location && + tracker->nameAndLocation().name == nameAndLocation.name; + } ); + return( it != m_children.end() ) + ? *it + : nullptr; + } + ITracker& TrackerBase::parent() { + assert( m_parent ); // Should always be non-null except for root + return *m_parent; + } + + void TrackerBase::openChild() { + if( m_runState != ExecutingChildren ) { + m_runState = ExecutingChildren; + if( m_parent ) + m_parent->openChild(); + } + } + + bool TrackerBase::isSectionTracker() const { return false; } + bool TrackerBase::isGeneratorTracker() const { return false; } + + void TrackerBase::open() { + m_runState = Executing; + moveToThis(); + if( m_parent ) + m_parent->openChild(); + } + + void TrackerBase::close() { + + // Close any still open children (e.g. generators) + while( &m_ctx.currentTracker() != this ) + m_ctx.currentTracker().close(); + + switch( m_runState ) { + case NeedsAnotherRun: + break; + + case Executing: + m_runState = CompletedSuccessfully; + break; + case ExecutingChildren: + if( m_children.empty() || m_children.back()->isComplete() ) + m_runState = CompletedSuccessfully; + break; + + case NotStarted: + case CompletedSuccessfully: + case Failed: + CATCH_INTERNAL_ERROR( "Illogical state: " << m_runState ); + + default: + CATCH_INTERNAL_ERROR( "Unknown state: " << m_runState ); + } + moveToParent(); + m_ctx.completeCycle(); + } + void TrackerBase::fail() { + m_runState = Failed; + if( m_parent ) + m_parent->markAsNeedingAnotherRun(); + moveToParent(); + m_ctx.completeCycle(); + } + void TrackerBase::markAsNeedingAnotherRun() { + m_runState = NeedsAnotherRun; + } + + void TrackerBase::moveToParent() { + assert( m_parent ); + m_ctx.setCurrentTracker( m_parent ); + } + void TrackerBase::moveToThis() { + m_ctx.setCurrentTracker( this ); + } + + SectionTracker::SectionTracker( NameAndLocation const& nameAndLocation, TrackerContext& ctx, ITracker* parent ) + : TrackerBase( nameAndLocation, ctx, parent ) + { + if( parent ) { + while( !parent->isSectionTracker() ) + parent = &parent->parent(); + + SectionTracker& parentSection = static_cast( *parent ); + addNextFilters( parentSection.m_filters ); + } + } + + bool SectionTracker::isComplete() const { + bool complete = true; + + if ((m_filters.empty() || m_filters[0] == "") || + std::find(m_filters.begin(), m_filters.end(), + m_nameAndLocation.name) != m_filters.end()) + complete = TrackerBase::isComplete(); + return complete; + + } + + bool SectionTracker::isSectionTracker() const { return true; } + + SectionTracker& SectionTracker::acquire( TrackerContext& ctx, NameAndLocation const& nameAndLocation ) { + std::shared_ptr section; + + ITracker& currentTracker = ctx.currentTracker(); + if( ITrackerPtr childTracker = currentTracker.findChild( nameAndLocation ) ) { + assert( childTracker ); + assert( childTracker->isSectionTracker() ); + section = std::static_pointer_cast( childTracker ); + } + else { + section = std::make_shared( nameAndLocation, ctx, ¤tTracker ); + currentTracker.addChild( section ); + } + if( !ctx.completedCycle() ) + section->tryOpen(); + return *section; + } + + void SectionTracker::tryOpen() { + if( !isComplete() && (m_filters.empty() || m_filters[0].empty() || m_filters[0] == m_nameAndLocation.name ) ) + open(); + } + + void SectionTracker::addInitialFilters( std::vector const& filters ) { + if( !filters.empty() ) { + m_filters.push_back(""); // Root - should never be consulted + m_filters.push_back(""); // Test Case - not a section filter + m_filters.insert( m_filters.end(), filters.begin(), filters.end() ); + } + } + void SectionTracker::addNextFilters( std::vector const& filters ) { + if( filters.size() > 1 ) + m_filters.insert( m_filters.end(), ++filters.begin(), filters.end() ); + } + +} // namespace TestCaseTracking + +using TestCaseTracking::ITracker; +using TestCaseTracking::TrackerContext; +using TestCaseTracking::SectionTracker; + +} // namespace Catch + +#if defined(__clang__) +# pragma clang diagnostic pop +#endif +// end catch_test_case_tracker.cpp +// start catch_test_registry.cpp + +namespace Catch { + + auto makeTestInvoker( void(*testAsFunction)() ) noexcept -> ITestInvoker* { + return new(std::nothrow) TestInvokerAsFunction( testAsFunction ); + } + + NameAndTags::NameAndTags( StringRef const& name_ , StringRef const& tags_ ) noexcept : name( name_ ), tags( tags_ ) {} + + AutoReg::AutoReg( ITestInvoker* invoker, SourceLineInfo const& lineInfo, StringRef const& classOrMethod, NameAndTags const& nameAndTags ) noexcept { + CATCH_TRY { + getMutableRegistryHub() + .registerTest( + makeTestCase( + invoker, + extractClassName( classOrMethod ), + nameAndTags, + lineInfo)); + } CATCH_CATCH_ALL { + // Do not throw when constructing global objects, instead register the exception to be processed later + getMutableRegistryHub().registerStartupException(); + } + } + + AutoReg::~AutoReg() = default; +} +// end catch_test_registry.cpp +// start catch_test_spec.cpp + +#include +#include +#include +#include + +namespace Catch { + + TestSpec::Pattern::~Pattern() = default; + TestSpec::NamePattern::~NamePattern() = default; + TestSpec::TagPattern::~TagPattern() = default; + TestSpec::ExcludedPattern::~ExcludedPattern() = default; + + TestSpec::NamePattern::NamePattern( std::string const& name ) + : m_wildcardPattern( toLower( name ), CaseSensitive::No ) + {} + bool TestSpec::NamePattern::matches( TestCaseInfo const& testCase ) const { + return m_wildcardPattern.matches( toLower( testCase.name ) ); + } + + TestSpec::TagPattern::TagPattern( std::string const& tag ) : m_tag( toLower( tag ) ) {} + bool TestSpec::TagPattern::matches( TestCaseInfo const& testCase ) const { + return std::find(begin(testCase.lcaseTags), + end(testCase.lcaseTags), + m_tag) != end(testCase.lcaseTags); + } + + TestSpec::ExcludedPattern::ExcludedPattern( PatternPtr const& underlyingPattern ) : m_underlyingPattern( underlyingPattern ) {} + bool TestSpec::ExcludedPattern::matches( TestCaseInfo const& testCase ) const { return !m_underlyingPattern->matches( testCase ); } + + bool TestSpec::Filter::matches( TestCaseInfo const& testCase ) const { + // All patterns in a filter must match for the filter to be a match + for( auto const& pattern : m_patterns ) { + if( !pattern->matches( testCase ) ) + return false; + } + return true; + } + + bool TestSpec::hasFilters() const { + return !m_filters.empty(); + } + bool TestSpec::matches( TestCaseInfo const& testCase ) const { + // A TestSpec matches if any filter matches + for( auto const& filter : m_filters ) + if( filter.matches( testCase ) ) + return true; + return false; + } +} +// end catch_test_spec.cpp +// start catch_test_spec_parser.cpp + +namespace Catch { + + TestSpecParser::TestSpecParser( ITagAliasRegistry const& tagAliases ) : m_tagAliases( &tagAliases ) {} + + TestSpecParser& TestSpecParser::parse( std::string const& arg ) { + m_mode = None; + m_exclusion = false; + m_start = std::string::npos; + m_arg = m_tagAliases->expandAliases( arg ); + m_escapeChars.clear(); + for( m_pos = 0; m_pos < m_arg.size(); ++m_pos ) + visitChar( m_arg[m_pos] ); + if( m_mode == Name ) + addPattern(); + return *this; + } + TestSpec TestSpecParser::testSpec() { + addFilter(); + return m_testSpec; + } + + void TestSpecParser::visitChar( char c ) { + if( m_mode == None ) { + switch( c ) { + case ' ': return; + case '~': m_exclusion = true; return; + case '[': return startNewMode( Tag, ++m_pos ); + case '"': return startNewMode( QuotedName, ++m_pos ); + case '\\': return escape(); + default: startNewMode( Name, m_pos ); break; + } + } + if( m_mode == Name ) { + if( c == ',' ) { + addPattern(); + addFilter(); + } + else if( c == '[' ) { + if( subString() == "exclude:" ) + m_exclusion = true; + else + addPattern(); + startNewMode( Tag, ++m_pos ); + } + else if( c == '\\' ) + escape(); + } + else if( m_mode == EscapedName ) + m_mode = Name; + else if( m_mode == QuotedName && c == '"' ) + addPattern(); + else if( m_mode == Tag && c == ']' ) + addPattern(); + } + void TestSpecParser::startNewMode( Mode mode, std::size_t start ) { + m_mode = mode; + m_start = start; + } + void TestSpecParser::escape() { + if( m_mode == None ) + m_start = m_pos; + m_mode = EscapedName; + m_escapeChars.push_back( m_pos ); + } + std::string TestSpecParser::subString() const { return m_arg.substr( m_start, m_pos - m_start ); } + + void TestSpecParser::addFilter() { + if( !m_currentFilter.m_patterns.empty() ) { + m_testSpec.m_filters.push_back( m_currentFilter ); + m_currentFilter = TestSpec::Filter(); + } + } + + TestSpec parseTestSpec( std::string const& arg ) { + return TestSpecParser( ITagAliasRegistry::get() ).parse( arg ).testSpec(); + } + +} // namespace Catch +// end catch_test_spec_parser.cpp +// start catch_timer.cpp + +#include + +static const uint64_t nanosecondsInSecond = 1000000000; + +namespace Catch { + + auto getCurrentNanosecondsSinceEpoch() -> uint64_t { + return std::chrono::duration_cast( std::chrono::high_resolution_clock::now().time_since_epoch() ).count(); + } + + namespace { + auto estimateClockResolution() -> uint64_t { + uint64_t sum = 0; + static const uint64_t iterations = 1000000; + + auto startTime = getCurrentNanosecondsSinceEpoch(); + + for( std::size_t i = 0; i < iterations; ++i ) { + + uint64_t ticks; + uint64_t baseTicks = getCurrentNanosecondsSinceEpoch(); + do { + ticks = getCurrentNanosecondsSinceEpoch(); + } while( ticks == baseTicks ); + + auto delta = ticks - baseTicks; + sum += delta; + + // If we have been calibrating for over 3 seconds -- the clock + // is terrible and we should move on. + // TBD: How to signal that the measured resolution is probably wrong? + if (ticks > startTime + 3 * nanosecondsInSecond) { + return sum / ( i + 1u ); + } + } + + // We're just taking the mean, here. To do better we could take the std. dev and exclude outliers + // - and potentially do more iterations if there's a high variance. + return sum/iterations; + } + } + auto getEstimatedClockResolution() -> uint64_t { + static auto s_resolution = estimateClockResolution(); + return s_resolution; + } + + void Timer::start() { + m_nanoseconds = getCurrentNanosecondsSinceEpoch(); + } + auto Timer::getElapsedNanoseconds() const -> uint64_t { + return getCurrentNanosecondsSinceEpoch() - m_nanoseconds; + } + auto Timer::getElapsedMicroseconds() const -> uint64_t { + return getElapsedNanoseconds()/1000; + } + auto Timer::getElapsedMilliseconds() const -> unsigned int { + return static_cast(getElapsedMicroseconds()/1000); + } + auto Timer::getElapsedSeconds() const -> double { + return getElapsedMicroseconds()/1000000.0; + } + +} // namespace Catch +// end catch_timer.cpp +// start catch_tostring.cpp + +#if defined(__clang__) +# pragma clang diagnostic push +# pragma clang diagnostic ignored "-Wexit-time-destructors" +# pragma clang diagnostic ignored "-Wglobal-constructors" +#endif + +// Enable specific decls locally +#if !defined(CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER) +#define CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER +#endif + +#include +#include + +namespace Catch { + +namespace Detail { + + const std::string unprintableString = "{?}"; + + namespace { + const int hexThreshold = 255; + + struct Endianness { + enum Arch { Big, Little }; + + static Arch which() { + union _{ + int asInt; + char asChar[sizeof (int)]; + } u; + + u.asInt = 1; + return ( u.asChar[sizeof(int)-1] == 1 ) ? Big : Little; + } + }; + } + + std::string rawMemoryToString( const void *object, std::size_t size ) { + // Reverse order for little endian architectures + int i = 0, end = static_cast( size ), inc = 1; + if( Endianness::which() == Endianness::Little ) { + i = end-1; + end = inc = -1; + } + + unsigned char const *bytes = static_cast(object); + ReusableStringStream rss; + rss << "0x" << std::setfill('0') << std::hex; + for( ; i != end; i += inc ) + rss << std::setw(2) << static_cast(bytes[i]); + return rss.str(); + } +} + +template +std::string fpToString( T value, int precision ) { + if (Catch::isnan(value)) { + return "nan"; + } + + ReusableStringStream rss; + rss << std::setprecision( precision ) + << std::fixed + << value; + std::string d = rss.str(); + std::size_t i = d.find_last_not_of( '0' ); + if( i != std::string::npos && i != d.size()-1 ) { + if( d[i] == '.' ) + i++; + d = d.substr( 0, i+1 ); + } + return d; +} + +//// ======================================================= //// +// +// Out-of-line defs for full specialization of StringMaker +// +//// ======================================================= //// + +std::string StringMaker::convert(const std::string& str) { + if (!getCurrentContext().getConfig()->showInvisibles()) { + return '"' + str + '"'; + } + + std::string s("\""); + for (char c : str) { + switch (c) { + case '\n': + s.append("\\n"); + break; + case '\t': + s.append("\\t"); + break; + default: + s.push_back(c); + break; + } + } + s.append("\""); + return s; +} + +#ifdef CATCH_CONFIG_CPP17_STRING_VIEW +std::string StringMaker::convert(std::string_view str) { + return ::Catch::Detail::stringify(std::string{ str }); +} +#endif + +std::string StringMaker::convert(char const* str) { + if (str) { + return ::Catch::Detail::stringify(std::string{ str }); + } else { + return{ "{null string}" }; + } +} +std::string StringMaker::convert(char* str) { + if (str) { + return ::Catch::Detail::stringify(std::string{ str }); + } else { + return{ "{null string}" }; + } +} + +#ifdef CATCH_CONFIG_WCHAR +std::string StringMaker::convert(const std::wstring& wstr) { + std::string s; + s.reserve(wstr.size()); + for (auto c : wstr) { + s += (c <= 0xff) ? static_cast(c) : '?'; + } + return ::Catch::Detail::stringify(s); +} + +# ifdef CATCH_CONFIG_CPP17_STRING_VIEW +std::string StringMaker::convert(std::wstring_view str) { + return StringMaker::convert(std::wstring(str)); +} +# endif + +std::string StringMaker::convert(wchar_t const * str) { + if (str) { + return ::Catch::Detail::stringify(std::wstring{ str }); + } else { + return{ "{null string}" }; + } +} +std::string StringMaker::convert(wchar_t * str) { + if (str) { + return ::Catch::Detail::stringify(std::wstring{ str }); + } else { + return{ "{null string}" }; + } +} +#endif + +std::string StringMaker::convert(int value) { + return ::Catch::Detail::stringify(static_cast(value)); +} +std::string StringMaker::convert(long value) { + return ::Catch::Detail::stringify(static_cast(value)); +} +std::string StringMaker::convert(long long value) { + ReusableStringStream rss; + rss << value; + if (value > Detail::hexThreshold) { + rss << " (0x" << std::hex << value << ')'; + } + return rss.str(); +} + +std::string StringMaker::convert(unsigned int value) { + return ::Catch::Detail::stringify(static_cast(value)); +} +std::string StringMaker::convert(unsigned long value) { + return ::Catch::Detail::stringify(static_cast(value)); +} +std::string StringMaker::convert(unsigned long long value) { + ReusableStringStream rss; + rss << value; + if (value > Detail::hexThreshold) { + rss << " (0x" << std::hex << value << ')'; + } + return rss.str(); +} + +std::string StringMaker::convert(bool b) { + return b ? "true" : "false"; +} + +std::string StringMaker::convert(signed char value) { + if (value == '\r') { + return "'\\r'"; + } else if (value == '\f') { + return "'\\f'"; + } else if (value == '\n') { + return "'\\n'"; + } else if (value == '\t') { + return "'\\t'"; + } else if ('\0' <= value && value < ' ') { + return ::Catch::Detail::stringify(static_cast(value)); + } else { + char chstr[] = "' '"; + chstr[1] = value; + return chstr; + } +} +std::string StringMaker::convert(char c) { + return ::Catch::Detail::stringify(static_cast(c)); +} +std::string StringMaker::convert(unsigned char c) { + return ::Catch::Detail::stringify(static_cast(c)); +} + +std::string StringMaker::convert(std::nullptr_t) { + return "nullptr"; +} + +std::string StringMaker::convert(float value) { + return fpToString(value, 5) + 'f'; +} +std::string StringMaker::convert(double value) { + return fpToString(value, 10); +} + +std::string ratio_string::symbol() { return "a"; } +std::string ratio_string::symbol() { return "f"; } +std::string ratio_string::symbol() { return "p"; } +std::string ratio_string::symbol() { return "n"; } +std::string ratio_string::symbol() { return "u"; } +std::string ratio_string::symbol() { return "m"; } + +} // end namespace Catch + +#if defined(__clang__) +# pragma clang diagnostic pop +#endif + +// end catch_tostring.cpp +// start catch_totals.cpp + +namespace Catch { + + Counts Counts::operator - ( Counts const& other ) const { + Counts diff; + diff.passed = passed - other.passed; + diff.failed = failed - other.failed; + diff.failedButOk = failedButOk - other.failedButOk; + return diff; + } + + Counts& Counts::operator += ( Counts const& other ) { + passed += other.passed; + failed += other.failed; + failedButOk += other.failedButOk; + return *this; + } + + std::size_t Counts::total() const { + return passed + failed + failedButOk; + } + bool Counts::allPassed() const { + return failed == 0 && failedButOk == 0; + } + bool Counts::allOk() const { + return failed == 0; + } + + Totals Totals::operator - ( Totals const& other ) const { + Totals diff; + diff.assertions = assertions - other.assertions; + diff.testCases = testCases - other.testCases; + return diff; + } + + Totals& Totals::operator += ( Totals const& other ) { + assertions += other.assertions; + testCases += other.testCases; + return *this; + } + + Totals Totals::delta( Totals const& prevTotals ) const { + Totals diff = *this - prevTotals; + if( diff.assertions.failed > 0 ) + ++diff.testCases.failed; + else if( diff.assertions.failedButOk > 0 ) + ++diff.testCases.failedButOk; + else + ++diff.testCases.passed; + return diff; + } + +} +// end catch_totals.cpp +// start catch_uncaught_exceptions.cpp + +#include + +namespace Catch { + bool uncaught_exceptions() { +#if defined(CATCH_CONFIG_CPP17_UNCAUGHT_EXCEPTIONS) + return std::uncaught_exceptions() > 0; +#else + return std::uncaught_exception(); +#endif + } +} // end namespace Catch +// end catch_uncaught_exceptions.cpp +// start catch_version.cpp + +#include + +namespace Catch { + + Version::Version + ( unsigned int _majorVersion, + unsigned int _minorVersion, + unsigned int _patchNumber, + char const * const _branchName, + unsigned int _buildNumber ) + : majorVersion( _majorVersion ), + minorVersion( _minorVersion ), + patchNumber( _patchNumber ), + branchName( _branchName ), + buildNumber( _buildNumber ) + {} + + std::ostream& operator << ( std::ostream& os, Version const& version ) { + os << version.majorVersion << '.' + << version.minorVersion << '.' + << version.patchNumber; + // branchName is never null -> 0th char is \0 if it is empty + if (version.branchName[0]) { + os << '-' << version.branchName + << '.' << version.buildNumber; + } + return os; + } + + Version const& libraryVersion() { + static Version version( 2, 7, 0, "", 0 ); + return version; + } + +} +// end catch_version.cpp +// start catch_wildcard_pattern.cpp + +#include + +namespace Catch { + + WildcardPattern::WildcardPattern( std::string const& pattern, + CaseSensitive::Choice caseSensitivity ) + : m_caseSensitivity( caseSensitivity ), + m_pattern( adjustCase( pattern ) ) + { + if( startsWith( m_pattern, '*' ) ) { + m_pattern = m_pattern.substr( 1 ); + m_wildcard = WildcardAtStart; + } + if( endsWith( m_pattern, '*' ) ) { + m_pattern = m_pattern.substr( 0, m_pattern.size()-1 ); + m_wildcard = static_cast( m_wildcard | WildcardAtEnd ); + } + } + + bool WildcardPattern::matches( std::string const& str ) const { + switch( m_wildcard ) { + case NoWildcard: + return m_pattern == adjustCase( str ); + case WildcardAtStart: + return endsWith( adjustCase( str ), m_pattern ); + case WildcardAtEnd: + return startsWith( adjustCase( str ), m_pattern ); + case WildcardAtBothEnds: + return contains( adjustCase( str ), m_pattern ); + default: + CATCH_INTERNAL_ERROR( "Unknown enum" ); + } + } + + std::string WildcardPattern::adjustCase( std::string const& str ) const { + return m_caseSensitivity == CaseSensitive::No ? toLower( str ) : str; + } +} +// end catch_wildcard_pattern.cpp +// start catch_xmlwriter.cpp + +#include + +using uchar = unsigned char; + +namespace Catch { + +namespace { + + size_t trailingBytes(unsigned char c) { + if ((c & 0xE0) == 0xC0) { + return 2; + } + if ((c & 0xF0) == 0xE0) { + return 3; + } + if ((c & 0xF8) == 0xF0) { + return 4; + } + CATCH_INTERNAL_ERROR("Invalid multibyte utf-8 start byte encountered"); + } + + uint32_t headerValue(unsigned char c) { + if ((c & 0xE0) == 0xC0) { + return c & 0x1F; + } + if ((c & 0xF0) == 0xE0) { + return c & 0x0F; + } + if ((c & 0xF8) == 0xF0) { + return c & 0x07; + } + CATCH_INTERNAL_ERROR("Invalid multibyte utf-8 start byte encountered"); + } + + void hexEscapeChar(std::ostream& os, unsigned char c) { + std::ios_base::fmtflags f(os.flags()); + os << "\\x" + << std::uppercase << std::hex << std::setfill('0') << std::setw(2) + << static_cast(c); + os.flags(f); + } + +} // anonymous namespace + + XmlEncode::XmlEncode( std::string const& str, ForWhat forWhat ) + : m_str( str ), + m_forWhat( forWhat ) + {} + + void XmlEncode::encodeTo( std::ostream& os ) const { + // Apostrophe escaping not necessary if we always use " to write attributes + // (see: http://www.w3.org/TR/xml/#syntax) + + for( std::size_t idx = 0; idx < m_str.size(); ++ idx ) { + uchar c = m_str[idx]; + switch (c) { + case '<': os << "<"; break; + case '&': os << "&"; break; + + case '>': + // See: http://www.w3.org/TR/xml/#syntax + if (idx > 2 && m_str[idx - 1] == ']' && m_str[idx - 2] == ']') + os << ">"; + else + os << c; + break; + + case '\"': + if (m_forWhat == ForAttributes) + os << """; + else + os << c; + break; + + default: + // Check for control characters and invalid utf-8 + + // Escape control characters in standard ascii + // see http://stackoverflow.com/questions/404107/why-are-control-characters-illegal-in-xml-1-0 + if (c < 0x09 || (c > 0x0D && c < 0x20) || c == 0x7F) { + hexEscapeChar(os, c); + break; + } + + // Plain ASCII: Write it to stream + if (c < 0x7F) { + os << c; + break; + } + + // UTF-8 territory + // Check if the encoding is valid and if it is not, hex escape bytes. + // Important: We do not check the exact decoded values for validity, only the encoding format + // First check that this bytes is a valid lead byte: + // This means that it is not encoded as 1111 1XXX + // Or as 10XX XXXX + if (c < 0xC0 || + c >= 0xF8) { + hexEscapeChar(os, c); + break; + } + + auto encBytes = trailingBytes(c); + // Are there enough bytes left to avoid accessing out-of-bounds memory? + if (idx + encBytes - 1 >= m_str.size()) { + hexEscapeChar(os, c); + break; + } + // The header is valid, check data + // The next encBytes bytes must together be a valid utf-8 + // This means: bitpattern 10XX XXXX and the extracted value is sane (ish) + bool valid = true; + uint32_t value = headerValue(c); + for (std::size_t n = 1; n < encBytes; ++n) { + uchar nc = m_str[idx + n]; + valid &= ((nc & 0xC0) == 0x80); + value = (value << 6) | (nc & 0x3F); + } + + if ( + // Wrong bit pattern of following bytes + (!valid) || + // Overlong encodings + (value < 0x80) || + (0x80 <= value && value < 0x800 && encBytes > 2) || + (0x800 < value && value < 0x10000 && encBytes > 3) || + // Encoded value out of range + (value >= 0x110000) + ) { + hexEscapeChar(os, c); + break; + } + + // If we got here, this is in fact a valid(ish) utf-8 sequence + for (std::size_t n = 0; n < encBytes; ++n) { + os << m_str[idx + n]; + } + idx += encBytes - 1; + break; + } + } + } + + std::ostream& operator << ( std::ostream& os, XmlEncode const& xmlEncode ) { + xmlEncode.encodeTo( os ); + return os; + } + + XmlWriter::ScopedElement::ScopedElement( XmlWriter* writer ) + : m_writer( writer ) + {} + + XmlWriter::ScopedElement::ScopedElement( ScopedElement&& other ) noexcept + : m_writer( other.m_writer ){ + other.m_writer = nullptr; + } + XmlWriter::ScopedElement& XmlWriter::ScopedElement::operator=( ScopedElement&& other ) noexcept { + if ( m_writer ) { + m_writer->endElement(); + } + m_writer = other.m_writer; + other.m_writer = nullptr; + return *this; + } + + XmlWriter::ScopedElement::~ScopedElement() { + if( m_writer ) + m_writer->endElement(); + } + + XmlWriter::ScopedElement& XmlWriter::ScopedElement::writeText( std::string const& text, bool indent ) { + m_writer->writeText( text, indent ); + return *this; + } + + XmlWriter::XmlWriter( std::ostream& os ) : m_os( os ) + { + writeDeclaration(); + } + + XmlWriter::~XmlWriter() { + while( !m_tags.empty() ) + endElement(); + } + + XmlWriter& XmlWriter::startElement( std::string const& name ) { + ensureTagClosed(); + newlineIfNecessary(); + m_os << m_indent << '<' << name; + m_tags.push_back( name ); + m_indent += " "; + m_tagIsOpen = true; + return *this; + } + + XmlWriter::ScopedElement XmlWriter::scopedElement( std::string const& name ) { + ScopedElement scoped( this ); + startElement( name ); + return scoped; + } + + XmlWriter& XmlWriter::endElement() { + newlineIfNecessary(); + m_indent = m_indent.substr( 0, m_indent.size()-2 ); + if( m_tagIsOpen ) { + m_os << "/>"; + m_tagIsOpen = false; + } + else { + m_os << m_indent << ""; + } + m_os << std::endl; + m_tags.pop_back(); + return *this; + } + + XmlWriter& XmlWriter::writeAttribute( std::string const& name, std::string const& attribute ) { + if( !name.empty() && !attribute.empty() ) + m_os << ' ' << name << "=\"" << XmlEncode( attribute, XmlEncode::ForAttributes ) << '"'; + return *this; + } + + XmlWriter& XmlWriter::writeAttribute( std::string const& name, bool attribute ) { + m_os << ' ' << name << "=\"" << ( attribute ? "true" : "false" ) << '"'; + return *this; + } + + XmlWriter& XmlWriter::writeText( std::string const& text, bool indent ) { + if( !text.empty() ){ + bool tagWasOpen = m_tagIsOpen; + ensureTagClosed(); + if( tagWasOpen && indent ) + m_os << m_indent; + m_os << XmlEncode( text ); + m_needsNewline = true; + } + return *this; + } + + XmlWriter& XmlWriter::writeComment( std::string const& text ) { + ensureTagClosed(); + m_os << m_indent << ""; + m_needsNewline = true; + return *this; + } + + void XmlWriter::writeStylesheetRef( std::string const& url ) { + m_os << "\n"; + } + + XmlWriter& XmlWriter::writeBlankLine() { + ensureTagClosed(); + m_os << '\n'; + return *this; + } + + void XmlWriter::ensureTagClosed() { + if( m_tagIsOpen ) { + m_os << ">" << std::endl; + m_tagIsOpen = false; + } + } + + void XmlWriter::writeDeclaration() { + m_os << "\n"; + } + + void XmlWriter::newlineIfNecessary() { + if( m_needsNewline ) { + m_os << std::endl; + m_needsNewline = false; + } + } +} +// end catch_xmlwriter.cpp +// start catch_reporter_bases.cpp + +#include +#include +#include +#include +#include + +namespace Catch { + void prepareExpandedExpression(AssertionResult& result) { + result.getExpandedExpression(); + } + + // Because formatting using c++ streams is stateful, drop down to C is required + // Alternatively we could use stringstream, but its performance is... not good. + std::string getFormattedDuration( double duration ) { + // Max exponent + 1 is required to represent the whole part + // + 1 for decimal point + // + 3 for the 3 decimal places + // + 1 for null terminator + const std::size_t maxDoubleSize = DBL_MAX_10_EXP + 1 + 1 + 3 + 1; + char buffer[maxDoubleSize]; + + // Save previous errno, to prevent sprintf from overwriting it + ErrnoGuard guard; +#ifdef _MSC_VER + sprintf_s(buffer, "%.3f", duration); +#else + std::sprintf(buffer, "%.3f", duration); +#endif + return std::string(buffer); + } + + TestEventListenerBase::TestEventListenerBase(ReporterConfig const & _config) + :StreamingReporterBase(_config) {} + + std::set TestEventListenerBase::getSupportedVerbosities() { + return { Verbosity::Quiet, Verbosity::Normal, Verbosity::High }; + } + + void TestEventListenerBase::assertionStarting(AssertionInfo const &) {} + + bool TestEventListenerBase::assertionEnded(AssertionStats const &) { + return false; + } + +} // end namespace Catch +// end catch_reporter_bases.cpp +// start catch_reporter_compact.cpp + +namespace { + +#ifdef CATCH_PLATFORM_MAC + const char* failedString() { return "FAILED"; } + const char* passedString() { return "PASSED"; } +#else + const char* failedString() { return "failed"; } + const char* passedString() { return "passed"; } +#endif + + // Colour::LightGrey + Catch::Colour::Code dimColour() { return Catch::Colour::FileName; } + + std::string bothOrAll( std::size_t count ) { + return count == 1 ? std::string() : + count == 2 ? "both " : "all " ; + } + +} // anon namespace + +namespace Catch { +namespace { +// Colour, message variants: +// - white: No tests ran. +// - red: Failed [both/all] N test cases, failed [both/all] M assertions. +// - white: Passed [both/all] N test cases (no assertions). +// - red: Failed N tests cases, failed M assertions. +// - green: Passed [both/all] N tests cases with M assertions. +void printTotals(std::ostream& out, const Totals& totals) { + if (totals.testCases.total() == 0) { + out << "No tests ran."; + } else if (totals.testCases.failed == totals.testCases.total()) { + Colour colour(Colour::ResultError); + const std::string qualify_assertions_failed = + totals.assertions.failed == totals.assertions.total() ? + bothOrAll(totals.assertions.failed) : std::string(); + out << + "Failed " << bothOrAll(totals.testCases.failed) + << pluralise(totals.testCases.failed, "test case") << ", " + "failed " << qualify_assertions_failed << + pluralise(totals.assertions.failed, "assertion") << '.'; + } else if (totals.assertions.total() == 0) { + out << + "Passed " << bothOrAll(totals.testCases.total()) + << pluralise(totals.testCases.total(), "test case") + << " (no assertions)."; + } else if (totals.assertions.failed) { + Colour colour(Colour::ResultError); + out << + "Failed " << pluralise(totals.testCases.failed, "test case") << ", " + "failed " << pluralise(totals.assertions.failed, "assertion") << '.'; + } else { + Colour colour(Colour::ResultSuccess); + out << + "Passed " << bothOrAll(totals.testCases.passed) + << pluralise(totals.testCases.passed, "test case") << + " with " << pluralise(totals.assertions.passed, "assertion") << '.'; + } +} + +// Implementation of CompactReporter formatting +class AssertionPrinter { +public: + AssertionPrinter& operator= (AssertionPrinter const&) = delete; + AssertionPrinter(AssertionPrinter const&) = delete; + AssertionPrinter(std::ostream& _stream, AssertionStats const& _stats, bool _printInfoMessages) + : stream(_stream) + , result(_stats.assertionResult) + , messages(_stats.infoMessages) + , itMessage(_stats.infoMessages.begin()) + , printInfoMessages(_printInfoMessages) {} + + void print() { + printSourceInfo(); + + itMessage = messages.begin(); + + switch (result.getResultType()) { + case ResultWas::Ok: + printResultType(Colour::ResultSuccess, passedString()); + printOriginalExpression(); + printReconstructedExpression(); + if (!result.hasExpression()) + printRemainingMessages(Colour::None); + else + printRemainingMessages(); + break; + case ResultWas::ExpressionFailed: + if (result.isOk()) + printResultType(Colour::ResultSuccess, failedString() + std::string(" - but was ok")); + else + printResultType(Colour::Error, failedString()); + printOriginalExpression(); + printReconstructedExpression(); + printRemainingMessages(); + break; + case ResultWas::ThrewException: + printResultType(Colour::Error, failedString()); + printIssue("unexpected exception with message:"); + printMessage(); + printExpressionWas(); + printRemainingMessages(); + break; + case ResultWas::FatalErrorCondition: + printResultType(Colour::Error, failedString()); + printIssue("fatal error condition with message:"); + printMessage(); + printExpressionWas(); + printRemainingMessages(); + break; + case ResultWas::DidntThrowException: + printResultType(Colour::Error, failedString()); + printIssue("expected exception, got none"); + printExpressionWas(); + printRemainingMessages(); + break; + case ResultWas::Info: + printResultType(Colour::None, "info"); + printMessage(); + printRemainingMessages(); + break; + case ResultWas::Warning: + printResultType(Colour::None, "warning"); + printMessage(); + printRemainingMessages(); + break; + case ResultWas::ExplicitFailure: + printResultType(Colour::Error, failedString()); + printIssue("explicitly"); + printRemainingMessages(Colour::None); + break; + // These cases are here to prevent compiler warnings + case ResultWas::Unknown: + case ResultWas::FailureBit: + case ResultWas::Exception: + printResultType(Colour::Error, "** internal error **"); + break; + } + } + +private: + void printSourceInfo() const { + Colour colourGuard(Colour::FileName); + stream << result.getSourceInfo() << ':'; + } + + void printResultType(Colour::Code colour, std::string const& passOrFail) const { + if (!passOrFail.empty()) { + { + Colour colourGuard(colour); + stream << ' ' << passOrFail; + } + stream << ':'; + } + } + + void printIssue(std::string const& issue) const { + stream << ' ' << issue; + } + + void printExpressionWas() { + if (result.hasExpression()) { + stream << ';'; + { + Colour colour(dimColour()); + stream << " expression was:"; + } + printOriginalExpression(); + } + } + + void printOriginalExpression() const { + if (result.hasExpression()) { + stream << ' ' << result.getExpression(); + } + } + + void printReconstructedExpression() const { + if (result.hasExpandedExpression()) { + { + Colour colour(dimColour()); + stream << " for: "; + } + stream << result.getExpandedExpression(); + } + } + + void printMessage() { + if (itMessage != messages.end()) { + stream << " '" << itMessage->message << '\''; + ++itMessage; + } + } + + void printRemainingMessages(Colour::Code colour = dimColour()) { + if (itMessage == messages.end()) + return; + + // using messages.end() directly yields (or auto) compilation error: + std::vector::const_iterator itEnd = messages.end(); + const std::size_t N = static_cast(std::distance(itMessage, itEnd)); + + { + Colour colourGuard(colour); + stream << " with " << pluralise(N, "message") << ':'; + } + + for (; itMessage != itEnd; ) { + // If this assertion is a warning ignore any INFO messages + if (printInfoMessages || itMessage->type != ResultWas::Info) { + stream << " '" << itMessage->message << '\''; + if (++itMessage != itEnd) { + Colour colourGuard(dimColour()); + stream << " and"; + } + } + } + } + +private: + std::ostream& stream; + AssertionResult const& result; + std::vector messages; + std::vector::const_iterator itMessage; + bool printInfoMessages; +}; + +} // anon namespace + + std::string CompactReporter::getDescription() { + return "Reports test results on a single line, suitable for IDEs"; + } + + ReporterPreferences CompactReporter::getPreferences() const { + return m_reporterPrefs; + } + + void CompactReporter::noMatchingTestCases( std::string const& spec ) { + stream << "No test cases matched '" << spec << '\'' << std::endl; + } + + void CompactReporter::assertionStarting( AssertionInfo const& ) {} + + bool CompactReporter::assertionEnded( AssertionStats const& _assertionStats ) { + AssertionResult const& result = _assertionStats.assertionResult; + + bool printInfoMessages = true; + + // Drop out if result was successful and we're not printing those + if( !m_config->includeSuccessfulResults() && result.isOk() ) { + if( result.getResultType() != ResultWas::Warning ) + return false; + printInfoMessages = false; + } + + AssertionPrinter printer( stream, _assertionStats, printInfoMessages ); + printer.print(); + + stream << std::endl; + return true; + } + + void CompactReporter::sectionEnded(SectionStats const& _sectionStats) { + if (m_config->showDurations() == ShowDurations::Always) { + stream << getFormattedDuration(_sectionStats.durationInSeconds) << " s: " << _sectionStats.sectionInfo.name << std::endl; + } + } + + void CompactReporter::testRunEnded( TestRunStats const& _testRunStats ) { + printTotals( stream, _testRunStats.totals ); + stream << '\n' << std::endl; + StreamingReporterBase::testRunEnded( _testRunStats ); + } + + CompactReporter::~CompactReporter() {} + + CATCH_REGISTER_REPORTER( "compact", CompactReporter ) + +} // end namespace Catch +// end catch_reporter_compact.cpp +// start catch_reporter_console.cpp + +#include +#include + +#if defined(_MSC_VER) +#pragma warning(push) +#pragma warning(disable:4061) // Not all labels are EXPLICITLY handled in switch + // Note that 4062 (not all labels are handled + // and default is missing) is enabled +#endif + +namespace Catch { + +namespace { + +// Formatter impl for ConsoleReporter +class ConsoleAssertionPrinter { +public: + ConsoleAssertionPrinter& operator= (ConsoleAssertionPrinter const&) = delete; + ConsoleAssertionPrinter(ConsoleAssertionPrinter const&) = delete; + ConsoleAssertionPrinter(std::ostream& _stream, AssertionStats const& _stats, bool _printInfoMessages) + : stream(_stream), + stats(_stats), + result(_stats.assertionResult), + colour(Colour::None), + message(result.getMessage()), + messages(_stats.infoMessages), + printInfoMessages(_printInfoMessages) { + switch (result.getResultType()) { + case ResultWas::Ok: + colour = Colour::Success; + passOrFail = "PASSED"; + //if( result.hasMessage() ) + if (_stats.infoMessages.size() == 1) + messageLabel = "with message"; + if (_stats.infoMessages.size() > 1) + messageLabel = "with messages"; + break; + case ResultWas::ExpressionFailed: + if (result.isOk()) { + colour = Colour::Success; + passOrFail = "FAILED - but was ok"; + } else { + colour = Colour::Error; + passOrFail = "FAILED"; + } + if (_stats.infoMessages.size() == 1) + messageLabel = "with message"; + if (_stats.infoMessages.size() > 1) + messageLabel = "with messages"; + break; + case ResultWas::ThrewException: + colour = Colour::Error; + passOrFail = "FAILED"; + messageLabel = "due to unexpected exception with "; + if (_stats.infoMessages.size() == 1) + messageLabel += "message"; + if (_stats.infoMessages.size() > 1) + messageLabel += "messages"; + break; + case ResultWas::FatalErrorCondition: + colour = Colour::Error; + passOrFail = "FAILED"; + messageLabel = "due to a fatal error condition"; + break; + case ResultWas::DidntThrowException: + colour = Colour::Error; + passOrFail = "FAILED"; + messageLabel = "because no exception was thrown where one was expected"; + break; + case ResultWas::Info: + messageLabel = "info"; + break; + case ResultWas::Warning: + messageLabel = "warning"; + break; + case ResultWas::ExplicitFailure: + passOrFail = "FAILED"; + colour = Colour::Error; + if (_stats.infoMessages.size() == 1) + messageLabel = "explicitly with message"; + if (_stats.infoMessages.size() > 1) + messageLabel = "explicitly with messages"; + break; + // These cases are here to prevent compiler warnings + case ResultWas::Unknown: + case ResultWas::FailureBit: + case ResultWas::Exception: + passOrFail = "** internal error **"; + colour = Colour::Error; + break; + } + } + + void print() const { + printSourceInfo(); + if (stats.totals.assertions.total() > 0) { + printResultType(); + printOriginalExpression(); + printReconstructedExpression(); + } else { + stream << '\n'; + } + printMessage(); + } + +private: + void printResultType() const { + if (!passOrFail.empty()) { + Colour colourGuard(colour); + stream << passOrFail << ":\n"; + } + } + void printOriginalExpression() const { + if (result.hasExpression()) { + Colour colourGuard(Colour::OriginalExpression); + stream << " "; + stream << result.getExpressionInMacro(); + stream << '\n'; + } + } + void printReconstructedExpression() const { + if (result.hasExpandedExpression()) { + stream << "with expansion:\n"; + Colour colourGuard(Colour::ReconstructedExpression); + stream << Column(result.getExpandedExpression()).indent(2) << '\n'; + } + } + void printMessage() const { + if (!messageLabel.empty()) + stream << messageLabel << ':' << '\n'; + for (auto const& msg : messages) { + // If this assertion is a warning ignore any INFO messages + if (printInfoMessages || msg.type != ResultWas::Info) + stream << Column(msg.message).indent(2) << '\n'; + } + } + void printSourceInfo() const { + Colour colourGuard(Colour::FileName); + stream << result.getSourceInfo() << ": "; + } + + std::ostream& stream; + AssertionStats const& stats; + AssertionResult const& result; + Colour::Code colour; + std::string passOrFail; + std::string messageLabel; + std::string message; + std::vector messages; + bool printInfoMessages; +}; + +std::size_t makeRatio(std::size_t number, std::size_t total) { + std::size_t ratio = total > 0 ? CATCH_CONFIG_CONSOLE_WIDTH * number / total : 0; + return (ratio == 0 && number > 0) ? 1 : ratio; +} + +std::size_t& findMax(std::size_t& i, std::size_t& j, std::size_t& k) { + if (i > j && i > k) + return i; + else if (j > k) + return j; + else + return k; +} + +struct ColumnInfo { + enum Justification { Left, Right }; + std::string name; + int width; + Justification justification; +}; +struct ColumnBreak {}; +struct RowBreak {}; + +class Duration { + enum class Unit { + Auto, + Nanoseconds, + Microseconds, + Milliseconds, + Seconds, + Minutes + }; + static const uint64_t s_nanosecondsInAMicrosecond = 1000; + static const uint64_t s_nanosecondsInAMillisecond = 1000 * s_nanosecondsInAMicrosecond; + static const uint64_t s_nanosecondsInASecond = 1000 * s_nanosecondsInAMillisecond; + static const uint64_t s_nanosecondsInAMinute = 60 * s_nanosecondsInASecond; + + uint64_t m_inNanoseconds; + Unit m_units; + +public: + explicit Duration(uint64_t inNanoseconds, Unit units = Unit::Auto) + : m_inNanoseconds(inNanoseconds), + m_units(units) { + if (m_units == Unit::Auto) { + if (m_inNanoseconds < s_nanosecondsInAMicrosecond) + m_units = Unit::Nanoseconds; + else if (m_inNanoseconds < s_nanosecondsInAMillisecond) + m_units = Unit::Microseconds; + else if (m_inNanoseconds < s_nanosecondsInASecond) + m_units = Unit::Milliseconds; + else if (m_inNanoseconds < s_nanosecondsInAMinute) + m_units = Unit::Seconds; + else + m_units = Unit::Minutes; + } + + } + + auto value() const -> double { + switch (m_units) { + case Unit::Microseconds: + return m_inNanoseconds / static_cast(s_nanosecondsInAMicrosecond); + case Unit::Milliseconds: + return m_inNanoseconds / static_cast(s_nanosecondsInAMillisecond); + case Unit::Seconds: + return m_inNanoseconds / static_cast(s_nanosecondsInASecond); + case Unit::Minutes: + return m_inNanoseconds / static_cast(s_nanosecondsInAMinute); + default: + return static_cast(m_inNanoseconds); + } + } + auto unitsAsString() const -> std::string { + switch (m_units) { + case Unit::Nanoseconds: + return "ns"; + case Unit::Microseconds: + return "us"; + case Unit::Milliseconds: + return "ms"; + case Unit::Seconds: + return "s"; + case Unit::Minutes: + return "m"; + default: + return "** internal error **"; + } + + } + friend auto operator << (std::ostream& os, Duration const& duration) -> std::ostream& { + return os << duration.value() << " " << duration.unitsAsString(); + } +}; +} // end anon namespace + +class TablePrinter { + std::ostream& m_os; + std::vector m_columnInfos; + std::ostringstream m_oss; + int m_currentColumn = -1; + bool m_isOpen = false; + +public: + TablePrinter( std::ostream& os, std::vector columnInfos ) + : m_os( os ), + m_columnInfos( std::move( columnInfos ) ) {} + + auto columnInfos() const -> std::vector const& { + return m_columnInfos; + } + + void open() { + if (!m_isOpen) { + m_isOpen = true; + *this << RowBreak(); + for (auto const& info : m_columnInfos) + *this << info.name << ColumnBreak(); + *this << RowBreak(); + m_os << Catch::getLineOfChars<'-'>() << "\n"; + } + } + void close() { + if (m_isOpen) { + *this << RowBreak(); + m_os << std::endl; + m_isOpen = false; + } + } + + template + friend TablePrinter& operator << (TablePrinter& tp, T const& value) { + tp.m_oss << value; + return tp; + } + + friend TablePrinter& operator << (TablePrinter& tp, ColumnBreak) { + auto colStr = tp.m_oss.str(); + // This takes account of utf8 encodings + auto strSize = Catch::StringRef(colStr).numberOfCharacters(); + tp.m_oss.str(""); + tp.open(); + if (tp.m_currentColumn == static_cast(tp.m_columnInfos.size() - 1)) { + tp.m_currentColumn = -1; + tp.m_os << "\n"; + } + tp.m_currentColumn++; + + auto colInfo = tp.m_columnInfos[tp.m_currentColumn]; + auto padding = (strSize + 2 < static_cast(colInfo.width)) + ? std::string(colInfo.width - (strSize + 2), ' ') + : std::string(); + if (colInfo.justification == ColumnInfo::Left) + tp.m_os << colStr << padding << " "; + else + tp.m_os << padding << colStr << " "; + return tp; + } + + friend TablePrinter& operator << (TablePrinter& tp, RowBreak) { + if (tp.m_currentColumn > 0) { + tp.m_os << "\n"; + tp.m_currentColumn = -1; + } + return tp; + } +}; + +ConsoleReporter::ConsoleReporter(ReporterConfig const& config) + : StreamingReporterBase(config), + m_tablePrinter(new TablePrinter(config.stream(), + { + { "benchmark name", CATCH_CONFIG_CONSOLE_WIDTH - 32, ColumnInfo::Left }, + { "iters", 8, ColumnInfo::Right }, + { "elapsed ns", 14, ColumnInfo::Right }, + { "average", 14, ColumnInfo::Right } + })) {} +ConsoleReporter::~ConsoleReporter() = default; + +std::string ConsoleReporter::getDescription() { + return "Reports test results as plain lines of text"; +} + +void ConsoleReporter::noMatchingTestCases(std::string const& spec) { + stream << "No test cases matched '" << spec << '\'' << std::endl; +} + +void ConsoleReporter::assertionStarting(AssertionInfo const&) {} + +bool ConsoleReporter::assertionEnded(AssertionStats const& _assertionStats) { + AssertionResult const& result = _assertionStats.assertionResult; + + bool includeResults = m_config->includeSuccessfulResults() || !result.isOk(); + + // Drop out if result was successful but we're not printing them. + if (!includeResults && result.getResultType() != ResultWas::Warning) + return false; + + lazyPrint(); + + ConsoleAssertionPrinter printer(stream, _assertionStats, includeResults); + printer.print(); + stream << std::endl; + return true; +} + +void ConsoleReporter::sectionStarting(SectionInfo const& _sectionInfo) { + m_headerPrinted = false; + StreamingReporterBase::sectionStarting(_sectionInfo); +} +void ConsoleReporter::sectionEnded(SectionStats const& _sectionStats) { + m_tablePrinter->close(); + if (_sectionStats.missingAssertions) { + lazyPrint(); + Colour colour(Colour::ResultError); + if (m_sectionStack.size() > 1) + stream << "\nNo assertions in section"; + else + stream << "\nNo assertions in test case"; + stream << " '" << _sectionStats.sectionInfo.name << "'\n" << std::endl; + } + if (m_config->showDurations() == ShowDurations::Always) { + stream << getFormattedDuration(_sectionStats.durationInSeconds) << " s: " << _sectionStats.sectionInfo.name << std::endl; + } + if (m_headerPrinted) { + m_headerPrinted = false; + } + StreamingReporterBase::sectionEnded(_sectionStats); +} + +void ConsoleReporter::benchmarkStarting(BenchmarkInfo const& info) { + lazyPrintWithoutClosingBenchmarkTable(); + + auto nameCol = Column( info.name ).width( static_cast( m_tablePrinter->columnInfos()[0].width - 2 ) ); + + bool firstLine = true; + for (auto line : nameCol) { + if (!firstLine) + (*m_tablePrinter) << ColumnBreak() << ColumnBreak() << ColumnBreak(); + else + firstLine = false; + + (*m_tablePrinter) << line << ColumnBreak(); + } +} +void ConsoleReporter::benchmarkEnded(BenchmarkStats const& stats) { + Duration average(stats.elapsedTimeInNanoseconds / stats.iterations); + (*m_tablePrinter) + << stats.iterations << ColumnBreak() + << stats.elapsedTimeInNanoseconds << ColumnBreak() + << average << ColumnBreak(); +} + +void ConsoleReporter::testCaseEnded(TestCaseStats const& _testCaseStats) { + m_tablePrinter->close(); + StreamingReporterBase::testCaseEnded(_testCaseStats); + m_headerPrinted = false; +} +void ConsoleReporter::testGroupEnded(TestGroupStats const& _testGroupStats) { + if (currentGroupInfo.used) { + printSummaryDivider(); + stream << "Summary for group '" << _testGroupStats.groupInfo.name << "':\n"; + printTotals(_testGroupStats.totals); + stream << '\n' << std::endl; + } + StreamingReporterBase::testGroupEnded(_testGroupStats); +} +void ConsoleReporter::testRunEnded(TestRunStats const& _testRunStats) { + printTotalsDivider(_testRunStats.totals); + printTotals(_testRunStats.totals); + stream << std::endl; + StreamingReporterBase::testRunEnded(_testRunStats); +} + +void ConsoleReporter::lazyPrint() { + + m_tablePrinter->close(); + lazyPrintWithoutClosingBenchmarkTable(); +} + +void ConsoleReporter::lazyPrintWithoutClosingBenchmarkTable() { + + if (!currentTestRunInfo.used) + lazyPrintRunInfo(); + if (!currentGroupInfo.used) + lazyPrintGroupInfo(); + + if (!m_headerPrinted) { + printTestCaseAndSectionHeader(); + m_headerPrinted = true; + } +} +void ConsoleReporter::lazyPrintRunInfo() { + stream << '\n' << getLineOfChars<'~'>() << '\n'; + Colour colour(Colour::SecondaryText); + stream << currentTestRunInfo->name + << " is a Catch v" << libraryVersion() << " host application.\n" + << "Run with -? for options\n\n"; + + if (m_config->rngSeed() != 0) + stream << "Randomness seeded to: " << m_config->rngSeed() << "\n\n"; + + currentTestRunInfo.used = true; +} +void ConsoleReporter::lazyPrintGroupInfo() { + if (!currentGroupInfo->name.empty() && currentGroupInfo->groupsCounts > 1) { + printClosedHeader("Group: " + currentGroupInfo->name); + currentGroupInfo.used = true; + } +} +void ConsoleReporter::printTestCaseAndSectionHeader() { + assert(!m_sectionStack.empty()); + printOpenHeader(currentTestCaseInfo->name); + + if (m_sectionStack.size() > 1) { + Colour colourGuard(Colour::Headers); + + auto + it = m_sectionStack.begin() + 1, // Skip first section (test case) + itEnd = m_sectionStack.end(); + for (; it != itEnd; ++it) + printHeaderString(it->name, 2); + } + + SourceLineInfo lineInfo = m_sectionStack.back().lineInfo; + + if (!lineInfo.empty()) { + stream << getLineOfChars<'-'>() << '\n'; + Colour colourGuard(Colour::FileName); + stream << lineInfo << '\n'; + } + stream << getLineOfChars<'.'>() << '\n' << std::endl; +} + +void ConsoleReporter::printClosedHeader(std::string const& _name) { + printOpenHeader(_name); + stream << getLineOfChars<'.'>() << '\n'; +} +void ConsoleReporter::printOpenHeader(std::string const& _name) { + stream << getLineOfChars<'-'>() << '\n'; + { + Colour colourGuard(Colour::Headers); + printHeaderString(_name); + } +} + +// if string has a : in first line will set indent to follow it on +// subsequent lines +void ConsoleReporter::printHeaderString(std::string const& _string, std::size_t indent) { + std::size_t i = _string.find(": "); + if (i != std::string::npos) + i += 2; + else + i = 0; + stream << Column(_string).indent(indent + i).initialIndent(indent) << '\n'; +} + +struct SummaryColumn { + + SummaryColumn( std::string _label, Colour::Code _colour ) + : label( std::move( _label ) ), + colour( _colour ) {} + SummaryColumn addRow( std::size_t count ) { + ReusableStringStream rss; + rss << count; + std::string row = rss.str(); + for (auto& oldRow : rows) { + while (oldRow.size() < row.size()) + oldRow = ' ' + oldRow; + while (oldRow.size() > row.size()) + row = ' ' + row; + } + rows.push_back(row); + return *this; + } + + std::string label; + Colour::Code colour; + std::vector rows; + +}; + +void ConsoleReporter::printTotals( Totals const& totals ) { + if (totals.testCases.total() == 0) { + stream << Colour(Colour::Warning) << "No tests ran\n"; + } else if (totals.assertions.total() > 0 && totals.testCases.allPassed()) { + stream << Colour(Colour::ResultSuccess) << "All tests passed"; + stream << " (" + << pluralise(totals.assertions.passed, "assertion") << " in " + << pluralise(totals.testCases.passed, "test case") << ')' + << '\n'; + } else { + + std::vector columns; + columns.push_back(SummaryColumn("", Colour::None) + .addRow(totals.testCases.total()) + .addRow(totals.assertions.total())); + columns.push_back(SummaryColumn("passed", Colour::Success) + .addRow(totals.testCases.passed) + .addRow(totals.assertions.passed)); + columns.push_back(SummaryColumn("failed", Colour::ResultError) + .addRow(totals.testCases.failed) + .addRow(totals.assertions.failed)); + columns.push_back(SummaryColumn("failed as expected", Colour::ResultExpectedFailure) + .addRow(totals.testCases.failedButOk) + .addRow(totals.assertions.failedButOk)); + + printSummaryRow("test cases", columns, 0); + printSummaryRow("assertions", columns, 1); + } +} +void ConsoleReporter::printSummaryRow(std::string const& label, std::vector const& cols, std::size_t row) { + for (auto col : cols) { + std::string value = col.rows[row]; + if (col.label.empty()) { + stream << label << ": "; + if (value != "0") + stream << value; + else + stream << Colour(Colour::Warning) << "- none -"; + } else if (value != "0") { + stream << Colour(Colour::LightGrey) << " | "; + stream << Colour(col.colour) + << value << ' ' << col.label; + } + } + stream << '\n'; +} + +void ConsoleReporter::printTotalsDivider(Totals const& totals) { + if (totals.testCases.total() > 0) { + std::size_t failedRatio = makeRatio(totals.testCases.failed, totals.testCases.total()); + std::size_t failedButOkRatio = makeRatio(totals.testCases.failedButOk, totals.testCases.total()); + std::size_t passedRatio = makeRatio(totals.testCases.passed, totals.testCases.total()); + while (failedRatio + failedButOkRatio + passedRatio < CATCH_CONFIG_CONSOLE_WIDTH - 1) + findMax(failedRatio, failedButOkRatio, passedRatio)++; + while (failedRatio + failedButOkRatio + passedRatio > CATCH_CONFIG_CONSOLE_WIDTH - 1) + findMax(failedRatio, failedButOkRatio, passedRatio)--; + + stream << Colour(Colour::Error) << std::string(failedRatio, '='); + stream << Colour(Colour::ResultExpectedFailure) << std::string(failedButOkRatio, '='); + if (totals.testCases.allPassed()) + stream << Colour(Colour::ResultSuccess) << std::string(passedRatio, '='); + else + stream << Colour(Colour::Success) << std::string(passedRatio, '='); + } else { + stream << Colour(Colour::Warning) << std::string(CATCH_CONFIG_CONSOLE_WIDTH - 1, '='); + } + stream << '\n'; +} +void ConsoleReporter::printSummaryDivider() { + stream << getLineOfChars<'-'>() << '\n'; +} + +CATCH_REGISTER_REPORTER("console", ConsoleReporter) + +} // end namespace Catch + +#if defined(_MSC_VER) +#pragma warning(pop) +#endif +// end catch_reporter_console.cpp +// start catch_reporter_junit.cpp + +#include +#include +#include +#include + +namespace Catch { + + namespace { + std::string getCurrentTimestamp() { + // Beware, this is not reentrant because of backward compatibility issues + // Also, UTC only, again because of backward compatibility (%z is C++11) + time_t rawtime; + std::time(&rawtime); + auto const timeStampSize = sizeof("2017-01-16T17:06:45Z"); + +#ifdef _MSC_VER + std::tm timeInfo = {}; + gmtime_s(&timeInfo, &rawtime); +#else + std::tm* timeInfo; + timeInfo = std::gmtime(&rawtime); +#endif + + char timeStamp[timeStampSize]; + const char * const fmt = "%Y-%m-%dT%H:%M:%SZ"; + +#ifdef _MSC_VER + std::strftime(timeStamp, timeStampSize, fmt, &timeInfo); +#else + std::strftime(timeStamp, timeStampSize, fmt, timeInfo); +#endif + return std::string(timeStamp); + } + + std::string fileNameTag(const std::vector &tags) { + auto it = std::find_if(begin(tags), + end(tags), + [] (std::string const& tag) {return tag.front() == '#'; }); + if (it != tags.end()) + return it->substr(1); + return std::string(); + } + } // anonymous namespace + + JunitReporter::JunitReporter( ReporterConfig const& _config ) + : CumulativeReporterBase( _config ), + xml( _config.stream() ) + { + m_reporterPrefs.shouldRedirectStdOut = true; + m_reporterPrefs.shouldReportAllAssertions = true; + } + + JunitReporter::~JunitReporter() {} + + std::string JunitReporter::getDescription() { + return "Reports test results in an XML format that looks like Ant's junitreport target"; + } + + void JunitReporter::noMatchingTestCases( std::string const& /*spec*/ ) {} + + void JunitReporter::testRunStarting( TestRunInfo const& runInfo ) { + CumulativeReporterBase::testRunStarting( runInfo ); + xml.startElement( "testsuites" ); + if( m_config->rngSeed() != 0 ) { + xml.startElement( "properties" ); + xml.scopedElement( "property" ) + .writeAttribute( "name", "random-seed" ) + .writeAttribute( "value", m_config->rngSeed() ); + xml.endElement(); + } + } + + void JunitReporter::testGroupStarting( GroupInfo const& groupInfo ) { + suiteTimer.start(); + stdOutForSuite.clear(); + stdErrForSuite.clear(); + unexpectedExceptions = 0; + CumulativeReporterBase::testGroupStarting( groupInfo ); + } + + void JunitReporter::testCaseStarting( TestCaseInfo const& testCaseInfo ) { + m_okToFail = testCaseInfo.okToFail(); + } + + bool JunitReporter::assertionEnded( AssertionStats const& assertionStats ) { + if( assertionStats.assertionResult.getResultType() == ResultWas::ThrewException && !m_okToFail ) + unexpectedExceptions++; + return CumulativeReporterBase::assertionEnded( assertionStats ); + } + + void JunitReporter::testCaseEnded( TestCaseStats const& testCaseStats ) { + stdOutForSuite += testCaseStats.stdOut; + stdErrForSuite += testCaseStats.stdErr; + CumulativeReporterBase::testCaseEnded( testCaseStats ); + } + + void JunitReporter::testGroupEnded( TestGroupStats const& testGroupStats ) { + double suiteTime = suiteTimer.getElapsedSeconds(); + CumulativeReporterBase::testGroupEnded( testGroupStats ); + writeGroup( *m_testGroups.back(), suiteTime ); + } + + void JunitReporter::testRunEndedCumulative() { + xml.endElement(); + } + + void JunitReporter::writeGroup( TestGroupNode const& groupNode, double suiteTime ) { + XmlWriter::ScopedElement e = xml.scopedElement( "testsuite" ); + TestGroupStats const& stats = groupNode.value; + xml.writeAttribute( "name", stats.groupInfo.name ); + xml.writeAttribute( "errors", unexpectedExceptions ); + xml.writeAttribute( "failures", stats.totals.assertions.failed-unexpectedExceptions ); + xml.writeAttribute( "tests", stats.totals.assertions.total() ); + xml.writeAttribute( "hostname", "tbd" ); // !TBD + if( m_config->showDurations() == ShowDurations::Never ) + xml.writeAttribute( "time", "" ); + else + xml.writeAttribute( "time", suiteTime ); + xml.writeAttribute( "timestamp", getCurrentTimestamp() ); + + // Write test cases + for( auto const& child : groupNode.children ) + writeTestCase( *child ); + + xml.scopedElement( "system-out" ).writeText( trim( stdOutForSuite ), false ); + xml.scopedElement( "system-err" ).writeText( trim( stdErrForSuite ), false ); + } + + void JunitReporter::writeTestCase( TestCaseNode const& testCaseNode ) { + TestCaseStats const& stats = testCaseNode.value; + + // All test cases have exactly one section - which represents the + // test case itself. That section may have 0-n nested sections + assert( testCaseNode.children.size() == 1 ); + SectionNode const& rootSection = *testCaseNode.children.front(); + + std::string className = stats.testInfo.className; + + if( className.empty() ) { + className = fileNameTag(stats.testInfo.tags); + if ( className.empty() ) + className = "global"; + } + + if ( !m_config->name().empty() ) + className = m_config->name() + "." + className; + + writeSection( className, "", rootSection ); + } + + void JunitReporter::writeSection( std::string const& className, + std::string const& rootName, + SectionNode const& sectionNode ) { + std::string name = trim( sectionNode.stats.sectionInfo.name ); + if( !rootName.empty() ) + name = rootName + '/' + name; + + if( !sectionNode.assertions.empty() || + !sectionNode.stdOut.empty() || + !sectionNode.stdErr.empty() ) { + XmlWriter::ScopedElement e = xml.scopedElement( "testcase" ); + if( className.empty() ) { + xml.writeAttribute( "classname", name ); + xml.writeAttribute( "name", "root" ); + } + else { + xml.writeAttribute( "classname", className ); + xml.writeAttribute( "name", name ); + } + xml.writeAttribute( "time", ::Catch::Detail::stringify( sectionNode.stats.durationInSeconds ) ); + + writeAssertions( sectionNode ); + + if( !sectionNode.stdOut.empty() ) + xml.scopedElement( "system-out" ).writeText( trim( sectionNode.stdOut ), false ); + if( !sectionNode.stdErr.empty() ) + xml.scopedElement( "system-err" ).writeText( trim( sectionNode.stdErr ), false ); + } + for( auto const& childNode : sectionNode.childSections ) + if( className.empty() ) + writeSection( name, "", *childNode ); + else + writeSection( className, name, *childNode ); + } + + void JunitReporter::writeAssertions( SectionNode const& sectionNode ) { + for( auto const& assertion : sectionNode.assertions ) + writeAssertion( assertion ); + } + + void JunitReporter::writeAssertion( AssertionStats const& stats ) { + AssertionResult const& result = stats.assertionResult; + if( !result.isOk() ) { + std::string elementName; + switch( result.getResultType() ) { + case ResultWas::ThrewException: + case ResultWas::FatalErrorCondition: + elementName = "error"; + break; + case ResultWas::ExplicitFailure: + elementName = "failure"; + break; + case ResultWas::ExpressionFailed: + elementName = "failure"; + break; + case ResultWas::DidntThrowException: + elementName = "failure"; + break; + + // We should never see these here: + case ResultWas::Info: + case ResultWas::Warning: + case ResultWas::Ok: + case ResultWas::Unknown: + case ResultWas::FailureBit: + case ResultWas::Exception: + elementName = "internalError"; + break; + } + + XmlWriter::ScopedElement e = xml.scopedElement( elementName ); + + xml.writeAttribute( "message", result.getExpandedExpression() ); + xml.writeAttribute( "type", result.getTestMacroName() ); + + ReusableStringStream rss; + if( !result.getMessage().empty() ) + rss << result.getMessage() << '\n'; + for( auto const& msg : stats.infoMessages ) + if( msg.type == ResultWas::Info ) + rss << msg.message << '\n'; + + rss << "at " << result.getSourceInfo(); + xml.writeText( rss.str(), false ); + } + } + + CATCH_REGISTER_REPORTER( "junit", JunitReporter ) + +} // end namespace Catch +// end catch_reporter_junit.cpp +// start catch_reporter_listening.cpp + +#include + +namespace Catch { + + ListeningReporter::ListeningReporter() { + // We will assume that listeners will always want all assertions + m_preferences.shouldReportAllAssertions = true; + } + + void ListeningReporter::addListener( IStreamingReporterPtr&& listener ) { + m_listeners.push_back( std::move( listener ) ); + } + + void ListeningReporter::addReporter(IStreamingReporterPtr&& reporter) { + assert(!m_reporter && "Listening reporter can wrap only 1 real reporter"); + m_reporter = std::move( reporter ); + m_preferences.shouldRedirectStdOut = m_reporter->getPreferences().shouldRedirectStdOut; + } + + ReporterPreferences ListeningReporter::getPreferences() const { + return m_preferences; + } + + std::set ListeningReporter::getSupportedVerbosities() { + return std::set{ }; + } + + void ListeningReporter::noMatchingTestCases( std::string const& spec ) { + for ( auto const& listener : m_listeners ) { + listener->noMatchingTestCases( spec ); + } + m_reporter->noMatchingTestCases( spec ); + } + + void ListeningReporter::benchmarkStarting( BenchmarkInfo const& benchmarkInfo ) { + for ( auto const& listener : m_listeners ) { + listener->benchmarkStarting( benchmarkInfo ); + } + m_reporter->benchmarkStarting( benchmarkInfo ); + } + void ListeningReporter::benchmarkEnded( BenchmarkStats const& benchmarkStats ) { + for ( auto const& listener : m_listeners ) { + listener->benchmarkEnded( benchmarkStats ); + } + m_reporter->benchmarkEnded( benchmarkStats ); + } + + void ListeningReporter::testRunStarting( TestRunInfo const& testRunInfo ) { + for ( auto const& listener : m_listeners ) { + listener->testRunStarting( testRunInfo ); + } + m_reporter->testRunStarting( testRunInfo ); + } + + void ListeningReporter::testGroupStarting( GroupInfo const& groupInfo ) { + for ( auto const& listener : m_listeners ) { + listener->testGroupStarting( groupInfo ); + } + m_reporter->testGroupStarting( groupInfo ); + } + + void ListeningReporter::testCaseStarting( TestCaseInfo const& testInfo ) { + for ( auto const& listener : m_listeners ) { + listener->testCaseStarting( testInfo ); + } + m_reporter->testCaseStarting( testInfo ); + } + + void ListeningReporter::sectionStarting( SectionInfo const& sectionInfo ) { + for ( auto const& listener : m_listeners ) { + listener->sectionStarting( sectionInfo ); + } + m_reporter->sectionStarting( sectionInfo ); + } + + void ListeningReporter::assertionStarting( AssertionInfo const& assertionInfo ) { + for ( auto const& listener : m_listeners ) { + listener->assertionStarting( assertionInfo ); + } + m_reporter->assertionStarting( assertionInfo ); + } + + // The return value indicates if the messages buffer should be cleared: + bool ListeningReporter::assertionEnded( AssertionStats const& assertionStats ) { + for( auto const& listener : m_listeners ) { + static_cast( listener->assertionEnded( assertionStats ) ); + } + return m_reporter->assertionEnded( assertionStats ); + } + + void ListeningReporter::sectionEnded( SectionStats const& sectionStats ) { + for ( auto const& listener : m_listeners ) { + listener->sectionEnded( sectionStats ); + } + m_reporter->sectionEnded( sectionStats ); + } + + void ListeningReporter::testCaseEnded( TestCaseStats const& testCaseStats ) { + for ( auto const& listener : m_listeners ) { + listener->testCaseEnded( testCaseStats ); + } + m_reporter->testCaseEnded( testCaseStats ); + } + + void ListeningReporter::testGroupEnded( TestGroupStats const& testGroupStats ) { + for ( auto const& listener : m_listeners ) { + listener->testGroupEnded( testGroupStats ); + } + m_reporter->testGroupEnded( testGroupStats ); + } + + void ListeningReporter::testRunEnded( TestRunStats const& testRunStats ) { + for ( auto const& listener : m_listeners ) { + listener->testRunEnded( testRunStats ); + } + m_reporter->testRunEnded( testRunStats ); + } + + void ListeningReporter::skipTest( TestCaseInfo const& testInfo ) { + for ( auto const& listener : m_listeners ) { + listener->skipTest( testInfo ); + } + m_reporter->skipTest( testInfo ); + } + + bool ListeningReporter::isMulti() const { + return true; + } + +} // end namespace Catch +// end catch_reporter_listening.cpp +// start catch_reporter_xml.cpp + +#if defined(_MSC_VER) +#pragma warning(push) +#pragma warning(disable:4061) // Not all labels are EXPLICITLY handled in switch + // Note that 4062 (not all labels are handled + // and default is missing) is enabled +#endif + +namespace Catch { + XmlReporter::XmlReporter( ReporterConfig const& _config ) + : StreamingReporterBase( _config ), + m_xml(_config.stream()) + { + m_reporterPrefs.shouldRedirectStdOut = true; + m_reporterPrefs.shouldReportAllAssertions = true; + } + + XmlReporter::~XmlReporter() = default; + + std::string XmlReporter::getDescription() { + return "Reports test results as an XML document"; + } + + std::string XmlReporter::getStylesheetRef() const { + return std::string(); + } + + void XmlReporter::writeSourceInfo( SourceLineInfo const& sourceInfo ) { + m_xml + .writeAttribute( "filename", sourceInfo.file ) + .writeAttribute( "line", sourceInfo.line ); + } + + void XmlReporter::noMatchingTestCases( std::string const& s ) { + StreamingReporterBase::noMatchingTestCases( s ); + } + + void XmlReporter::testRunStarting( TestRunInfo const& testInfo ) { + StreamingReporterBase::testRunStarting( testInfo ); + std::string stylesheetRef = getStylesheetRef(); + if( !stylesheetRef.empty() ) + m_xml.writeStylesheetRef( stylesheetRef ); + m_xml.startElement( "Catch" ); + if( !m_config->name().empty() ) + m_xml.writeAttribute( "name", m_config->name() ); + if( m_config->rngSeed() != 0 ) + m_xml.scopedElement( "Randomness" ) + .writeAttribute( "seed", m_config->rngSeed() ); + } + + void XmlReporter::testGroupStarting( GroupInfo const& groupInfo ) { + StreamingReporterBase::testGroupStarting( groupInfo ); + m_xml.startElement( "Group" ) + .writeAttribute( "name", groupInfo.name ); + } + + void XmlReporter::testCaseStarting( TestCaseInfo const& testInfo ) { + StreamingReporterBase::testCaseStarting(testInfo); + m_xml.startElement( "TestCase" ) + .writeAttribute( "name", trim( testInfo.name ) ) + .writeAttribute( "description", testInfo.description ) + .writeAttribute( "tags", testInfo.tagsAsString() ); + + writeSourceInfo( testInfo.lineInfo ); + + if ( m_config->showDurations() == ShowDurations::Always ) + m_testCaseTimer.start(); + m_xml.ensureTagClosed(); + } + + void XmlReporter::sectionStarting( SectionInfo const& sectionInfo ) { + StreamingReporterBase::sectionStarting( sectionInfo ); + if( m_sectionDepth++ > 0 ) { + m_xml.startElement( "Section" ) + .writeAttribute( "name", trim( sectionInfo.name ) ); + writeSourceInfo( sectionInfo.lineInfo ); + m_xml.ensureTagClosed(); + } + } + + void XmlReporter::assertionStarting( AssertionInfo const& ) { } + + bool XmlReporter::assertionEnded( AssertionStats const& assertionStats ) { + + AssertionResult const& result = assertionStats.assertionResult; + + bool includeResults = m_config->includeSuccessfulResults() || !result.isOk(); + + if( includeResults || result.getResultType() == ResultWas::Warning ) { + // Print any info messages in tags. + for( auto const& msg : assertionStats.infoMessages ) { + if( msg.type == ResultWas::Info && includeResults ) { + m_xml.scopedElement( "Info" ) + .writeText( msg.message ); + } else if ( msg.type == ResultWas::Warning ) { + m_xml.scopedElement( "Warning" ) + .writeText( msg.message ); + } + } + } + + // Drop out if result was successful but we're not printing them. + if( !includeResults && result.getResultType() != ResultWas::Warning ) + return true; + + // Print the expression if there is one. + if( result.hasExpression() ) { + m_xml.startElement( "Expression" ) + .writeAttribute( "success", result.succeeded() ) + .writeAttribute( "type", result.getTestMacroName() ); + + writeSourceInfo( result.getSourceInfo() ); + + m_xml.scopedElement( "Original" ) + .writeText( result.getExpression() ); + m_xml.scopedElement( "Expanded" ) + .writeText( result.getExpandedExpression() ); + } + + // And... Print a result applicable to each result type. + switch( result.getResultType() ) { + case ResultWas::ThrewException: + m_xml.startElement( "Exception" ); + writeSourceInfo( result.getSourceInfo() ); + m_xml.writeText( result.getMessage() ); + m_xml.endElement(); + break; + case ResultWas::FatalErrorCondition: + m_xml.startElement( "FatalErrorCondition" ); + writeSourceInfo( result.getSourceInfo() ); + m_xml.writeText( result.getMessage() ); + m_xml.endElement(); + break; + case ResultWas::Info: + m_xml.scopedElement( "Info" ) + .writeText( result.getMessage() ); + break; + case ResultWas::Warning: + // Warning will already have been written + break; + case ResultWas::ExplicitFailure: + m_xml.startElement( "Failure" ); + writeSourceInfo( result.getSourceInfo() ); + m_xml.writeText( result.getMessage() ); + m_xml.endElement(); + break; + default: + break; + } + + if( result.hasExpression() ) + m_xml.endElement(); + + return true; + } + + void XmlReporter::sectionEnded( SectionStats const& sectionStats ) { + StreamingReporterBase::sectionEnded( sectionStats ); + if( --m_sectionDepth > 0 ) { + XmlWriter::ScopedElement e = m_xml.scopedElement( "OverallResults" ); + e.writeAttribute( "successes", sectionStats.assertions.passed ); + e.writeAttribute( "failures", sectionStats.assertions.failed ); + e.writeAttribute( "expectedFailures", sectionStats.assertions.failedButOk ); + + if ( m_config->showDurations() == ShowDurations::Always ) + e.writeAttribute( "durationInSeconds", sectionStats.durationInSeconds ); + + m_xml.endElement(); + } + } + + void XmlReporter::testCaseEnded( TestCaseStats const& testCaseStats ) { + StreamingReporterBase::testCaseEnded( testCaseStats ); + XmlWriter::ScopedElement e = m_xml.scopedElement( "OverallResult" ); + e.writeAttribute( "success", testCaseStats.totals.assertions.allOk() ); + + if ( m_config->showDurations() == ShowDurations::Always ) + e.writeAttribute( "durationInSeconds", m_testCaseTimer.getElapsedSeconds() ); + + if( !testCaseStats.stdOut.empty() ) + m_xml.scopedElement( "StdOut" ).writeText( trim( testCaseStats.stdOut ), false ); + if( !testCaseStats.stdErr.empty() ) + m_xml.scopedElement( "StdErr" ).writeText( trim( testCaseStats.stdErr ), false ); + + m_xml.endElement(); + } + + void XmlReporter::testGroupEnded( TestGroupStats const& testGroupStats ) { + StreamingReporterBase::testGroupEnded( testGroupStats ); + // TODO: Check testGroupStats.aborting and act accordingly. + m_xml.scopedElement( "OverallResults" ) + .writeAttribute( "successes", testGroupStats.totals.assertions.passed ) + .writeAttribute( "failures", testGroupStats.totals.assertions.failed ) + .writeAttribute( "expectedFailures", testGroupStats.totals.assertions.failedButOk ); + m_xml.endElement(); + } + + void XmlReporter::testRunEnded( TestRunStats const& testRunStats ) { + StreamingReporterBase::testRunEnded( testRunStats ); + m_xml.scopedElement( "OverallResults" ) + .writeAttribute( "successes", testRunStats.totals.assertions.passed ) + .writeAttribute( "failures", testRunStats.totals.assertions.failed ) + .writeAttribute( "expectedFailures", testRunStats.totals.assertions.failedButOk ); + m_xml.endElement(); + } + + CATCH_REGISTER_REPORTER( "xml", XmlReporter ) + +} // end namespace Catch + +#if defined(_MSC_VER) +#pragma warning(pop) +#endif +// end catch_reporter_xml.cpp + +namespace Catch { + LeakDetector leakDetector; +} + +#ifdef __clang__ +#pragma clang diagnostic pop +#endif + +// end catch_impl.hpp +#endif + +#ifdef CATCH_CONFIG_MAIN +// start catch_default_main.hpp + +#ifndef __OBJC__ + +#if defined(CATCH_CONFIG_WCHAR) && defined(WIN32) && defined(_UNICODE) && !defined(DO_NOT_USE_WMAIN) +// Standard C/C++ Win32 Unicode wmain entry point +extern "C" int wmain (int argc, wchar_t * argv[], wchar_t * []) { +#else +// Standard C/C++ main entry point +int main (int argc, char * argv[]) { +#endif + + return Catch::Session().run( argc, argv ); +} + +#else // __OBJC__ + +// Objective-C entry point +int main (int argc, char * const argv[]) { +#if !CATCH_ARC_ENABLED + NSAutoreleasePool * pool = [[NSAutoreleasePool alloc] init]; +#endif + + Catch::registerTestMethods(); + int result = Catch::Session().run( argc, (char**)argv ); + +#if !CATCH_ARC_ENABLED + [pool drain]; +#endif + + return result; +} + +#endif // __OBJC__ + +// end catch_default_main.hpp +#endif + +#if !defined(CATCH_CONFIG_IMPL_ONLY) + +#ifdef CLARA_CONFIG_MAIN_NOT_DEFINED +# undef CLARA_CONFIG_MAIN +#endif + +#if !defined(CATCH_CONFIG_DISABLE) +////// +// If this config identifier is defined then all CATCH macros are prefixed with CATCH_ +#ifdef CATCH_CONFIG_PREFIX_ALL + +#define CATCH_REQUIRE( ... ) INTERNAL_CATCH_TEST( "CATCH_REQUIRE", Catch::ResultDisposition::Normal, __VA_ARGS__ ) +#define CATCH_REQUIRE_FALSE( ... ) INTERNAL_CATCH_TEST( "CATCH_REQUIRE_FALSE", Catch::ResultDisposition::Normal | Catch::ResultDisposition::FalseTest, __VA_ARGS__ ) + +#define CATCH_REQUIRE_THROWS( ... ) INTERNAL_CATCH_THROWS( "CATCH_REQUIRE_THROWS", Catch::ResultDisposition::Normal, __VA_ARGS__ ) +#define CATCH_REQUIRE_THROWS_AS( expr, exceptionType ) INTERNAL_CATCH_THROWS_AS( "CATCH_REQUIRE_THROWS_AS", exceptionType, Catch::ResultDisposition::Normal, expr ) +#define CATCH_REQUIRE_THROWS_WITH( expr, matcher ) INTERNAL_CATCH_THROWS_STR_MATCHES( "CATCH_REQUIRE_THROWS_WITH", Catch::ResultDisposition::Normal, matcher, expr ) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CATCH_REQUIRE_THROWS_MATCHES( expr, exceptionType, matcher ) INTERNAL_CATCH_THROWS_MATCHES( "CATCH_REQUIRE_THROWS_MATCHES", exceptionType, Catch::ResultDisposition::Normal, matcher, expr ) +#endif// CATCH_CONFIG_DISABLE_MATCHERS +#define CATCH_REQUIRE_NOTHROW( ... ) INTERNAL_CATCH_NO_THROW( "CATCH_REQUIRE_NOTHROW", Catch::ResultDisposition::Normal, __VA_ARGS__ ) + +#define CATCH_CHECK( ... ) INTERNAL_CATCH_TEST( "CATCH_CHECK", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CATCH_CHECK_FALSE( ... ) INTERNAL_CATCH_TEST( "CATCH_CHECK_FALSE", Catch::ResultDisposition::ContinueOnFailure | Catch::ResultDisposition::FalseTest, __VA_ARGS__ ) +#define CATCH_CHECKED_IF( ... ) INTERNAL_CATCH_IF( "CATCH_CHECKED_IF", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CATCH_CHECKED_ELSE( ... ) INTERNAL_CATCH_ELSE( "CATCH_CHECKED_ELSE", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CATCH_CHECK_NOFAIL( ... ) INTERNAL_CATCH_TEST( "CATCH_CHECK_NOFAIL", Catch::ResultDisposition::ContinueOnFailure | Catch::ResultDisposition::SuppressFail, __VA_ARGS__ ) + +#define CATCH_CHECK_THROWS( ... ) INTERNAL_CATCH_THROWS( "CATCH_CHECK_THROWS", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CATCH_CHECK_THROWS_AS( expr, exceptionType ) INTERNAL_CATCH_THROWS_AS( "CATCH_CHECK_THROWS_AS", exceptionType, Catch::ResultDisposition::ContinueOnFailure, expr ) +#define CATCH_CHECK_THROWS_WITH( expr, matcher ) INTERNAL_CATCH_THROWS_STR_MATCHES( "CATCH_CHECK_THROWS_WITH", Catch::ResultDisposition::ContinueOnFailure, matcher, expr ) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CATCH_CHECK_THROWS_MATCHES( expr, exceptionType, matcher ) INTERNAL_CATCH_THROWS_MATCHES( "CATCH_CHECK_THROWS_MATCHES", exceptionType, Catch::ResultDisposition::ContinueOnFailure, matcher, expr ) +#endif // CATCH_CONFIG_DISABLE_MATCHERS +#define CATCH_CHECK_NOTHROW( ... ) INTERNAL_CATCH_NO_THROW( "CATCH_CHECK_NOTHROW", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) + +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CATCH_CHECK_THAT( arg, matcher ) INTERNAL_CHECK_THAT( "CATCH_CHECK_THAT", matcher, Catch::ResultDisposition::ContinueOnFailure, arg ) + +#define CATCH_REQUIRE_THAT( arg, matcher ) INTERNAL_CHECK_THAT( "CATCH_REQUIRE_THAT", matcher, Catch::ResultDisposition::Normal, arg ) +#endif // CATCH_CONFIG_DISABLE_MATCHERS + +#define CATCH_INFO( msg ) INTERNAL_CATCH_INFO( "CATCH_INFO", msg ) +#define CATCH_WARN( msg ) INTERNAL_CATCH_MSG( "CATCH_WARN", Catch::ResultWas::Warning, Catch::ResultDisposition::ContinueOnFailure, msg ) +#define CATCH_CAPTURE( ... ) INTERNAL_CATCH_CAPTURE( INTERNAL_CATCH_UNIQUE_NAME(capturer), "CATCH_CAPTURE",__VA_ARGS__ ) + +#define CATCH_TEST_CASE( ... ) INTERNAL_CATCH_TESTCASE( __VA_ARGS__ ) +#define CATCH_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#define CATCH_METHOD_AS_TEST_CASE( method, ... ) INTERNAL_CATCH_METHOD_AS_TEST_CASE( method, __VA_ARGS__ ) +#define CATCH_REGISTER_TEST_CASE( Function, ... ) INTERNAL_CATCH_REGISTER_TESTCASE( Function, __VA_ARGS__ ) +#define CATCH_SECTION( ... ) INTERNAL_CATCH_SECTION( __VA_ARGS__ ) +#define CATCH_DYNAMIC_SECTION( ... ) INTERNAL_CATCH_DYNAMIC_SECTION( __VA_ARGS__ ) +#define CATCH_FAIL( ... ) INTERNAL_CATCH_MSG( "CATCH_FAIL", Catch::ResultWas::ExplicitFailure, Catch::ResultDisposition::Normal, __VA_ARGS__ ) +#define CATCH_FAIL_CHECK( ... ) INTERNAL_CATCH_MSG( "CATCH_FAIL_CHECK", Catch::ResultWas::ExplicitFailure, Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CATCH_SUCCEED( ... ) INTERNAL_CATCH_MSG( "CATCH_SUCCEED", Catch::ResultWas::Ok, Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) + +#define CATCH_ANON_TEST_CASE() INTERNAL_CATCH_TESTCASE() + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define CATCH_TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE( __VA_ARGS__ ) +#define CATCH_TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE( ... ) INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE( __VA_ARGS__ ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#else +#define CATCH_TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE( __VA_ARGS__ ) ) +#define CATCH_TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE( ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE( __VA_ARGS__ ) ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, __VA_ARGS__ ) ) +#endif + +#if !defined(CATCH_CONFIG_RUNTIME_STATIC_REQUIRE) +#define CATCH_STATIC_REQUIRE( ... ) static_assert( __VA_ARGS__ , #__VA_ARGS__ ); CATCH_SUCCEED( #__VA_ARGS__ ) +#define CATCH_STATIC_REQUIRE_FALSE( ... ) static_assert( !(__VA_ARGS__), "!(" #__VA_ARGS__ ")" ); CATCH_SUCCEED( #__VA_ARGS__ ) +#else +#define CATCH_STATIC_REQUIRE( ... ) CATCH_REQUIRE( __VA_ARGS__ ) +#define CATCH_STATIC_REQUIRE_FALSE( ... ) CATCH_REQUIRE_FALSE( __VA_ARGS__ ) +#endif + +// "BDD-style" convenience wrappers +#define CATCH_SCENARIO( ... ) CATCH_TEST_CASE( "Scenario: " __VA_ARGS__ ) +#define CATCH_SCENARIO_METHOD( className, ... ) INTERNAL_CATCH_TEST_CASE_METHOD( className, "Scenario: " __VA_ARGS__ ) +#define CATCH_GIVEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " Given: " << desc ) +#define CATCH_AND_GIVEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( "And given: " << desc ) +#define CATCH_WHEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " When: " << desc ) +#define CATCH_AND_WHEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " And when: " << desc ) +#define CATCH_THEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " Then: " << desc ) +#define CATCH_AND_THEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " And: " << desc ) + +// If CATCH_CONFIG_PREFIX_ALL is not defined then the CATCH_ prefix is not required +#else + +#define REQUIRE( ... ) INTERNAL_CATCH_TEST( "REQUIRE", Catch::ResultDisposition::Normal, __VA_ARGS__ ) +#define REQUIRE_FALSE( ... ) INTERNAL_CATCH_TEST( "REQUIRE_FALSE", Catch::ResultDisposition::Normal | Catch::ResultDisposition::FalseTest, __VA_ARGS__ ) + +#define REQUIRE_THROWS( ... ) INTERNAL_CATCH_THROWS( "REQUIRE_THROWS", Catch::ResultDisposition::Normal, __VA_ARGS__ ) +#define REQUIRE_THROWS_AS( expr, exceptionType ) INTERNAL_CATCH_THROWS_AS( "REQUIRE_THROWS_AS", exceptionType, Catch::ResultDisposition::Normal, expr ) +#define REQUIRE_THROWS_WITH( expr, matcher ) INTERNAL_CATCH_THROWS_STR_MATCHES( "REQUIRE_THROWS_WITH", Catch::ResultDisposition::Normal, matcher, expr ) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define REQUIRE_THROWS_MATCHES( expr, exceptionType, matcher ) INTERNAL_CATCH_THROWS_MATCHES( "REQUIRE_THROWS_MATCHES", exceptionType, Catch::ResultDisposition::Normal, matcher, expr ) +#endif // CATCH_CONFIG_DISABLE_MATCHERS +#define REQUIRE_NOTHROW( ... ) INTERNAL_CATCH_NO_THROW( "REQUIRE_NOTHROW", Catch::ResultDisposition::Normal, __VA_ARGS__ ) + +#define CHECK( ... ) INTERNAL_CATCH_TEST( "CHECK", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CHECK_FALSE( ... ) INTERNAL_CATCH_TEST( "CHECK_FALSE", Catch::ResultDisposition::ContinueOnFailure | Catch::ResultDisposition::FalseTest, __VA_ARGS__ ) +#define CHECKED_IF( ... ) INTERNAL_CATCH_IF( "CHECKED_IF", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CHECKED_ELSE( ... ) INTERNAL_CATCH_ELSE( "CHECKED_ELSE", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CHECK_NOFAIL( ... ) INTERNAL_CATCH_TEST( "CHECK_NOFAIL", Catch::ResultDisposition::ContinueOnFailure | Catch::ResultDisposition::SuppressFail, __VA_ARGS__ ) + +#define CHECK_THROWS( ... ) INTERNAL_CATCH_THROWS( "CHECK_THROWS", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CHECK_THROWS_AS( expr, exceptionType ) INTERNAL_CATCH_THROWS_AS( "CHECK_THROWS_AS", exceptionType, Catch::ResultDisposition::ContinueOnFailure, expr ) +#define CHECK_THROWS_WITH( expr, matcher ) INTERNAL_CATCH_THROWS_STR_MATCHES( "CHECK_THROWS_WITH", Catch::ResultDisposition::ContinueOnFailure, matcher, expr ) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CHECK_THROWS_MATCHES( expr, exceptionType, matcher ) INTERNAL_CATCH_THROWS_MATCHES( "CHECK_THROWS_MATCHES", exceptionType, Catch::ResultDisposition::ContinueOnFailure, matcher, expr ) +#endif // CATCH_CONFIG_DISABLE_MATCHERS +#define CHECK_NOTHROW( ... ) INTERNAL_CATCH_NO_THROW( "CHECK_NOTHROW", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) + +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CHECK_THAT( arg, matcher ) INTERNAL_CHECK_THAT( "CHECK_THAT", matcher, Catch::ResultDisposition::ContinueOnFailure, arg ) + +#define REQUIRE_THAT( arg, matcher ) INTERNAL_CHECK_THAT( "REQUIRE_THAT", matcher, Catch::ResultDisposition::Normal, arg ) +#endif // CATCH_CONFIG_DISABLE_MATCHERS + +#define INFO( msg ) INTERNAL_CATCH_INFO( "INFO", msg ) +#define UNSCOPED_INFO( msg ) INTERNAL_CATCH_UNSCOPED_INFO( "UNSCOPED_INFO", msg ) +#define WARN( msg ) INTERNAL_CATCH_MSG( "WARN", Catch::ResultWas::Warning, Catch::ResultDisposition::ContinueOnFailure, msg ) +#define CAPTURE( ... ) INTERNAL_CATCH_CAPTURE( INTERNAL_CATCH_UNIQUE_NAME(capturer), "CAPTURE",__VA_ARGS__ ) + +#define TEST_CASE( ... ) INTERNAL_CATCH_TESTCASE( __VA_ARGS__ ) +#define TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#define METHOD_AS_TEST_CASE( method, ... ) INTERNAL_CATCH_METHOD_AS_TEST_CASE( method, __VA_ARGS__ ) +#define REGISTER_TEST_CASE( Function, ... ) INTERNAL_CATCH_REGISTER_TESTCASE( Function, __VA_ARGS__ ) +#define SECTION( ... ) INTERNAL_CATCH_SECTION( __VA_ARGS__ ) +#define DYNAMIC_SECTION( ... ) INTERNAL_CATCH_DYNAMIC_SECTION( __VA_ARGS__ ) +#define FAIL( ... ) INTERNAL_CATCH_MSG( "FAIL", Catch::ResultWas::ExplicitFailure, Catch::ResultDisposition::Normal, __VA_ARGS__ ) +#define FAIL_CHECK( ... ) INTERNAL_CATCH_MSG( "FAIL_CHECK", Catch::ResultWas::ExplicitFailure, Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define SUCCEED( ... ) INTERNAL_CATCH_MSG( "SUCCEED", Catch::ResultWas::Ok, Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define ANON_TEST_CASE() INTERNAL_CATCH_TESTCASE() + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE( __VA_ARGS__ ) +#define TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#define TEMPLATE_PRODUCT_TEST_CASE( ... ) INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE( __VA_ARGS__ ) +#define TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#else +#define TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE( __VA_ARGS__ ) ) +#define TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) ) +#define TEMPLATE_PRODUCT_TEST_CASE( ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE( __VA_ARGS__ ) ) +#define TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, __VA_ARGS__ ) ) +#endif + +#if !defined(CATCH_CONFIG_RUNTIME_STATIC_REQUIRE) +#define STATIC_REQUIRE( ... ) static_assert( __VA_ARGS__, #__VA_ARGS__ ); SUCCEED( #__VA_ARGS__ ) +#define STATIC_REQUIRE_FALSE( ... ) static_assert( !(__VA_ARGS__), "!(" #__VA_ARGS__ ")" ); SUCCEED( "!(" #__VA_ARGS__ ")" ) +#else +#define STATIC_REQUIRE( ... ) REQUIRE( __VA_ARGS__ ) +#define STATIC_REQUIRE_FALSE( ... ) REQUIRE_FALSE( __VA_ARGS__ ) +#endif + +#endif + +#define CATCH_TRANSLATE_EXCEPTION( signature ) INTERNAL_CATCH_TRANSLATE_EXCEPTION( signature ) + +// "BDD-style" convenience wrappers +#define SCENARIO( ... ) TEST_CASE( "Scenario: " __VA_ARGS__ ) +#define SCENARIO_METHOD( className, ... ) INTERNAL_CATCH_TEST_CASE_METHOD( className, "Scenario: " __VA_ARGS__ ) + +#define GIVEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " Given: " << desc ) +#define AND_GIVEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( "And given: " << desc ) +#define WHEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " When: " << desc ) +#define AND_WHEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " And when: " << desc ) +#define THEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " Then: " << desc ) +#define AND_THEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " And: " << desc ) + +using Catch::Detail::Approx; + +#else // CATCH_CONFIG_DISABLE + +////// +// If this config identifier is defined then all CATCH macros are prefixed with CATCH_ +#ifdef CATCH_CONFIG_PREFIX_ALL + +#define CATCH_REQUIRE( ... ) (void)(0) +#define CATCH_REQUIRE_FALSE( ... ) (void)(0) + +#define CATCH_REQUIRE_THROWS( ... ) (void)(0) +#define CATCH_REQUIRE_THROWS_AS( expr, exceptionType ) (void)(0) +#define CATCH_REQUIRE_THROWS_WITH( expr, matcher ) (void)(0) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CATCH_REQUIRE_THROWS_MATCHES( expr, exceptionType, matcher ) (void)(0) +#endif// CATCH_CONFIG_DISABLE_MATCHERS +#define CATCH_REQUIRE_NOTHROW( ... ) (void)(0) + +#define CATCH_CHECK( ... ) (void)(0) +#define CATCH_CHECK_FALSE( ... ) (void)(0) +#define CATCH_CHECKED_IF( ... ) if (__VA_ARGS__) +#define CATCH_CHECKED_ELSE( ... ) if (!(__VA_ARGS__)) +#define CATCH_CHECK_NOFAIL( ... ) (void)(0) + +#define CATCH_CHECK_THROWS( ... ) (void)(0) +#define CATCH_CHECK_THROWS_AS( expr, exceptionType ) (void)(0) +#define CATCH_CHECK_THROWS_WITH( expr, matcher ) (void)(0) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CATCH_CHECK_THROWS_MATCHES( expr, exceptionType, matcher ) (void)(0) +#endif // CATCH_CONFIG_DISABLE_MATCHERS +#define CATCH_CHECK_NOTHROW( ... ) (void)(0) + +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CATCH_CHECK_THAT( arg, matcher ) (void)(0) + +#define CATCH_REQUIRE_THAT( arg, matcher ) (void)(0) +#endif // CATCH_CONFIG_DISABLE_MATCHERS + +#define CATCH_INFO( msg ) (void)(0) +#define CATCH_WARN( msg ) (void)(0) +#define CATCH_CAPTURE( msg ) (void)(0) + +#define CATCH_TEST_CASE( ... ) INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )) +#define CATCH_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )) +#define CATCH_METHOD_AS_TEST_CASE( method, ... ) +#define CATCH_REGISTER_TEST_CASE( Function, ... ) (void)(0) +#define CATCH_SECTION( ... ) +#define CATCH_DYNAMIC_SECTION( ... ) +#define CATCH_FAIL( ... ) (void)(0) +#define CATCH_FAIL_CHECK( ... ) (void)(0) +#define CATCH_SUCCEED( ... ) (void)(0) + +#define CATCH_ANON_TEST_CASE() INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )) + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define CATCH_TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ) ) +#define CATCH_TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), className ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE( ... ) CATCH_TEMPLATE_TEST_CASE( __VA_ARGS__ ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) CATCH_TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#else +#define CATCH_TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ) ) ) +#define CATCH_TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), className ) ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE( ... ) CATCH_TEMPLATE_TEST_CASE( __VA_ARGS__ ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) CATCH_TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#endif + +// "BDD-style" convenience wrappers +#define CATCH_SCENARIO( ... ) INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )) +#define CATCH_SCENARIO_METHOD( className, ... ) INTERNAL_CATCH_TESTCASE_METHOD_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ ), className ) +#define CATCH_GIVEN( desc ) +#define CATCH_AND_GIVEN( desc ) +#define CATCH_WHEN( desc ) +#define CATCH_AND_WHEN( desc ) +#define CATCH_THEN( desc ) +#define CATCH_AND_THEN( desc ) + +#define CATCH_STATIC_REQUIRE( ... ) (void)(0) +#define CATCH_STATIC_REQUIRE_FALSE( ... ) (void)(0) + +// If CATCH_CONFIG_PREFIX_ALL is not defined then the CATCH_ prefix is not required +#else + +#define REQUIRE( ... ) (void)(0) +#define REQUIRE_FALSE( ... ) (void)(0) + +#define REQUIRE_THROWS( ... ) (void)(0) +#define REQUIRE_THROWS_AS( expr, exceptionType ) (void)(0) +#define REQUIRE_THROWS_WITH( expr, matcher ) (void)(0) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define REQUIRE_THROWS_MATCHES( expr, exceptionType, matcher ) (void)(0) +#endif // CATCH_CONFIG_DISABLE_MATCHERS +#define REQUIRE_NOTHROW( ... ) (void)(0) + +#define CHECK( ... ) (void)(0) +#define CHECK_FALSE( ... ) (void)(0) +#define CHECKED_IF( ... ) if (__VA_ARGS__) +#define CHECKED_ELSE( ... ) if (!(__VA_ARGS__)) +#define CHECK_NOFAIL( ... ) (void)(0) + +#define CHECK_THROWS( ... ) (void)(0) +#define CHECK_THROWS_AS( expr, exceptionType ) (void)(0) +#define CHECK_THROWS_WITH( expr, matcher ) (void)(0) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CHECK_THROWS_MATCHES( expr, exceptionType, matcher ) (void)(0) +#endif // CATCH_CONFIG_DISABLE_MATCHERS +#define CHECK_NOTHROW( ... ) (void)(0) + +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CHECK_THAT( arg, matcher ) (void)(0) + +#define REQUIRE_THAT( arg, matcher ) (void)(0) +#endif // CATCH_CONFIG_DISABLE_MATCHERS + +#define INFO( msg ) (void)(0) +#define WARN( msg ) (void)(0) +#define CAPTURE( msg ) (void)(0) + +#define TEST_CASE( ... ) INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )) +#define TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )) +#define METHOD_AS_TEST_CASE( method, ... ) +#define REGISTER_TEST_CASE( Function, ... ) (void)(0) +#define SECTION( ... ) +#define DYNAMIC_SECTION( ... ) +#define FAIL( ... ) (void)(0) +#define FAIL_CHECK( ... ) (void)(0) +#define SUCCEED( ... ) (void)(0) +#define ANON_TEST_CASE() INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )) + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ) ) +#define TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), className ) +#define TEMPLATE_PRODUCT_TEST_CASE( ... ) TEMPLATE_TEST_CASE( __VA_ARGS__ ) +#define TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#else +#define TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ) ) ) +#define TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), className ) ) +#define TEMPLATE_PRODUCT_TEST_CASE( ... ) TEMPLATE_TEST_CASE( __VA_ARGS__ ) +#define TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#endif + +#define STATIC_REQUIRE( ... ) (void)(0) +#define STATIC_REQUIRE_FALSE( ... ) (void)(0) + +#endif + +#define CATCH_TRANSLATE_EXCEPTION( signature ) INTERNAL_CATCH_TRANSLATE_EXCEPTION_NO_REG( INTERNAL_CATCH_UNIQUE_NAME( catch_internal_ExceptionTranslator ), signature ) + +// "BDD-style" convenience wrappers +#define SCENARIO( ... ) INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ ) ) +#define SCENARIO_METHOD( className, ... ) INTERNAL_CATCH_TESTCASE_METHOD_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ ), className ) + +#define GIVEN( desc ) +#define AND_GIVEN( desc ) +#define WHEN( desc ) +#define AND_WHEN( desc ) +#define THEN( desc ) +#define AND_THEN( desc ) + +using Catch::Detail::Approx; + +#endif + +#endif // ! CATCH_CONFIG_IMPL_ONLY + +// start catch_reenable_warnings.h + + +#ifdef __clang__ +# ifdef __ICC // icpc defines the __clang__ macro +# pragma warning(pop) +# else +# pragma clang diagnostic pop +# endif +#elif defined __GNUC__ +# pragma GCC diagnostic pop +#endif + +// end catch_reenable_warnings.h +// end catch.hpp +#endif // TWOBLUECUBES_SINGLE_INCLUDE_CATCH_HPP_INCLUDED + diff --git a/exercises/hamming/CMakeLists.txt b/exercises/hamming/CMakeLists.txt index 97f8615d..b81b3564 100644 --- a/exercises/hamming/CMakeLists.txt +++ b/exercises/hamming/CMakeLists.txt @@ -7,12 +7,6 @@ cmake_minimum_required(VERSION 3.1.3) # Name the project after the exercise project(${exercise} CXX) -# Locate Boost libraries: unit_test_framework and date_time -set(Boost_USE_STATIC_LIBS ON) -set(Boost_USE_MULTITHREADED ON) -set(Boost_USE_STATIC_RUNTIME OFF) -find_package(Boost 1.59 REQUIRED COMPONENTS unit_test_framework date_time) - # Get a source filename from the exercise name by replacing -'s with _'s string(REPLACE "-" "_" file ${exercise}) @@ -38,13 +32,6 @@ if("${CMAKE_CXX_COMPILER_ID}" MATCHES "(GNU|Clang)") ) endif() -# We need boost libraries -target_link_libraries(${exercise} - PRIVATE - Boost::unit_test_framework - Boost::date_time -) - # Configure to run all the tests? if(${EXERCISM_RUN_ALL_TESTS}) target_compile_definitions(${exercise} PRIVATE EXERCISM_RUN_ALL_TESTS) diff --git a/exercises/hamming/hamming_test.cpp b/exercises/hamming/hamming_test.cpp index 3e45cba7..db390021 100644 --- a/exercises/hamming/hamming_test.cpp +++ b/exercises/hamming/hamming_test.cpp @@ -1,51 +1,51 @@ #include "hamming.h" #include -#define BOOST_TEST_MAIN -#include +#define CATCH_CONFIG_MAIN +#include "test/catch.hpp" -BOOST_AUTO_TEST_CASE(no_difference_between_identical_strands) +TEST_CASE("no_difference_between_identical_strands") { - BOOST_REQUIRE_EQUAL(0, hamming::compute("A", "A")); + REQUIRE(0 == hamming::compute("A", "A")); } #if defined(EXERCISM_RUN_ALL_TESTS) -BOOST_AUTO_TEST_CASE(complete_hamming_distance_for_single_nucleotide_strand) +TEST_CASE("complete_hamming_distance_for_single_nucleotide_strand") { - BOOST_REQUIRE_EQUAL(1, hamming::compute("A", "G")); + REQUIRE(1 == hamming::compute("A", "G")); } -BOOST_AUTO_TEST_CASE(complete_hamming_distance_for_small_strand) +TEST_CASE("complete_hamming_distance_for_small_strand") { - BOOST_REQUIRE_EQUAL(2, hamming::compute("AG", "CT")); + REQUIRE(2 == hamming::compute("AG", "CT")); } -BOOST_AUTO_TEST_CASE(small_hamming_distance) +TEST_CASE("small_hamming_distance") { - BOOST_REQUIRE_EQUAL(1, hamming::compute("AT", "CT")); + REQUIRE(1 == hamming::compute("AT", "CT")); } -BOOST_AUTO_TEST_CASE(small_hamming_distance_in_longer_strand) +TEST_CASE("small_hamming_distance_in_longer_strand") { - BOOST_REQUIRE_EQUAL(1, hamming::compute("GGACG", "GGTCG")); + REQUIRE(1 == hamming::compute("GGACG", "GGTCG")); } -BOOST_AUTO_TEST_CASE(domain_error_when_first_string_is_longer) +TEST_CASE("domain_error_when_first_string_is_longer") { - BOOST_REQUIRE_THROW(hamming::compute("AAAG", "AAA"), std::domain_error); + REQUIRE_THROWS_AS(hamming::compute("AAAG", "AAA"), std::domain_error); } -BOOST_AUTO_TEST_CASE(domain_error_when_second_string_is_longer) +TEST_CASE("domain_error_when_second_string_is_longer") { - BOOST_REQUIRE_THROW(hamming::compute("AAA", "AAAG"), std::domain_error); + REQUIRE_THROWS_AS(hamming::compute("AAA", "AAAG"), std::domain_error); } -BOOST_AUTO_TEST_CASE(large_hamming_distance) +TEST_CASE("large_hamming_distance") { - BOOST_REQUIRE_EQUAL(4, hamming::compute("GATACA", "GCATAA")); + REQUIRE(4 == hamming::compute("GATACA", "GCATAA")); } -BOOST_AUTO_TEST_CASE(hamming_distance_in_very_long_strand) +TEST_CASE("hamming_distance_in_very_long_strand") { - BOOST_REQUIRE_EQUAL(9, hamming::compute("GGACGGATTCTG", "AGGACGGATTCT")); + REQUIRE(9 == hamming::compute("GGACGGATTCTG", "AGGACGGATTCT")); } #endif diff --git a/exercises/hamming/test/catch.hpp b/exercises/hamming/test/catch.hpp new file mode 100644 index 00000000..1850fff1 --- /dev/null +++ b/exercises/hamming/test/catch.hpp @@ -0,0 +1,14934 @@ +/* + * Catch v2.7.0 + * Generated: 2019-03-07 21:34:30.252164 + * ---------------------------------------------------------- + * This file has been merged from multiple headers. Please don't edit it directly + * Copyright (c) 2019 Two Blue Cubes Ltd. All rights reserved. + * + * Distributed under the Boost Software License, Version 1.0. (See accompanying + * file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt) + */ +#ifndef TWOBLUECUBES_SINGLE_INCLUDE_CATCH_HPP_INCLUDED +#define TWOBLUECUBES_SINGLE_INCLUDE_CATCH_HPP_INCLUDED +// start catch.hpp + + +#define CATCH_VERSION_MAJOR 2 +#define CATCH_VERSION_MINOR 7 +#define CATCH_VERSION_PATCH 0 + +#ifdef __clang__ +# pragma clang system_header +#elif defined __GNUC__ +# pragma GCC system_header +#endif + +// start catch_suppress_warnings.h + +#ifdef __clang__ +# ifdef __ICC // icpc defines the __clang__ macro +# pragma warning(push) +# pragma warning(disable: 161 1682) +# else // __ICC +# pragma clang diagnostic push +# pragma clang diagnostic ignored "-Wpadded" +# pragma clang diagnostic ignored "-Wswitch-enum" +# pragma clang diagnostic ignored "-Wcovered-switch-default" +# endif +#elif defined __GNUC__ + // Because REQUIREs trigger GCC's -Wparentheses, and because still + // supported version of g++ have only buggy support for _Pragmas, + // Wparentheses have to be suppressed globally. +# pragma GCC diagnostic ignored "-Wparentheses" // See #674 for details + +# pragma GCC diagnostic push +# pragma GCC diagnostic ignored "-Wunused-variable" +# pragma GCC diagnostic ignored "-Wpadded" +#endif +// end catch_suppress_warnings.h +#if defined(CATCH_CONFIG_MAIN) || defined(CATCH_CONFIG_RUNNER) +# define CATCH_IMPL +# define CATCH_CONFIG_ALL_PARTS +#endif + +// In the impl file, we want to have access to all parts of the headers +// Can also be used to sanely support PCHs +#if defined(CATCH_CONFIG_ALL_PARTS) +# define CATCH_CONFIG_EXTERNAL_INTERFACES +# if defined(CATCH_CONFIG_DISABLE_MATCHERS) +# undef CATCH_CONFIG_DISABLE_MATCHERS +# endif +# if !defined(CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER) +# define CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER +# endif +#endif + +#if !defined(CATCH_CONFIG_IMPL_ONLY) +// start catch_platform.h + +#ifdef __APPLE__ +# include +# if TARGET_OS_OSX == 1 +# define CATCH_PLATFORM_MAC +# elif TARGET_OS_IPHONE == 1 +# define CATCH_PLATFORM_IPHONE +# endif + +#elif defined(linux) || defined(__linux) || defined(__linux__) +# define CATCH_PLATFORM_LINUX + +#elif defined(WIN32) || defined(__WIN32__) || defined(_WIN32) || defined(_MSC_VER) || defined(__MINGW32__) +# define CATCH_PLATFORM_WINDOWS +#endif + +// end catch_platform.h + +#ifdef CATCH_IMPL +# ifndef CLARA_CONFIG_MAIN +# define CLARA_CONFIG_MAIN_NOT_DEFINED +# define CLARA_CONFIG_MAIN +# endif +#endif + +// start catch_user_interfaces.h + +namespace Catch { + unsigned int rngSeed(); +} + +// end catch_user_interfaces.h +// start catch_tag_alias_autoregistrar.h + +// start catch_common.h + +// start catch_compiler_capabilities.h + +// Detect a number of compiler features - by compiler +// The following features are defined: +// +// CATCH_CONFIG_COUNTER : is the __COUNTER__ macro supported? +// CATCH_CONFIG_WINDOWS_SEH : is Windows SEH supported? +// CATCH_CONFIG_POSIX_SIGNALS : are POSIX signals supported? +// CATCH_CONFIG_DISABLE_EXCEPTIONS : Are exceptions enabled? +// **************** +// Note to maintainers: if new toggles are added please document them +// in configuration.md, too +// **************** + +// In general each macro has a _NO_ form +// (e.g. CATCH_CONFIG_NO_POSIX_SIGNALS) which disables the feature. +// Many features, at point of detection, define an _INTERNAL_ macro, so they +// can be combined, en-mass, with the _NO_ forms later. + +#ifdef __cplusplus + +# if (__cplusplus >= 201402L) || (defined(_MSVC_LANG) && _MSVC_LANG >= 201402L) +# define CATCH_CPP14_OR_GREATER +# endif + +# if (__cplusplus >= 201703L) || (defined(_MSVC_LANG) && _MSVC_LANG >= 201703L) +# define CATCH_CPP17_OR_GREATER +# endif + +#endif + +#if defined(CATCH_CPP17_OR_GREATER) +# define CATCH_INTERNAL_CONFIG_CPP17_UNCAUGHT_EXCEPTIONS +#endif + +#ifdef __clang__ + +# define CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + _Pragma( "clang diagnostic push" ) \ + _Pragma( "clang diagnostic ignored \"-Wexit-time-destructors\"" ) \ + _Pragma( "clang diagnostic ignored \"-Wglobal-constructors\"") +# define CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS \ + _Pragma( "clang diagnostic pop" ) + +# define CATCH_INTERNAL_SUPPRESS_PARENTHESES_WARNINGS \ + _Pragma( "clang diagnostic push" ) \ + _Pragma( "clang diagnostic ignored \"-Wparentheses\"" ) +# define CATCH_INTERNAL_UNSUPPRESS_PARENTHESES_WARNINGS \ + _Pragma( "clang diagnostic pop" ) + +# define CATCH_INTERNAL_SUPPRESS_UNUSED_WARNINGS \ + _Pragma( "clang diagnostic push" ) \ + _Pragma( "clang diagnostic ignored \"-Wunused-variable\"" ) +# define CATCH_INTERNAL_UNSUPPRESS_UNUSED_WARNINGS \ + _Pragma( "clang diagnostic pop" ) + +#endif // __clang__ + +//////////////////////////////////////////////////////////////////////////////// +// Assume that non-Windows platforms support posix signals by default +#if !defined(CATCH_PLATFORM_WINDOWS) + #define CATCH_INTERNAL_CONFIG_POSIX_SIGNALS +#endif + +//////////////////////////////////////////////////////////////////////////////// +// We know some environments not to support full POSIX signals +#if defined(__CYGWIN__) || defined(__QNX__) || defined(__EMSCRIPTEN__) || defined(__DJGPP__) + #define CATCH_INTERNAL_CONFIG_NO_POSIX_SIGNALS +#endif + +#ifdef __OS400__ +# define CATCH_INTERNAL_CONFIG_NO_POSIX_SIGNALS +# define CATCH_CONFIG_COLOUR_NONE +#endif + +//////////////////////////////////////////////////////////////////////////////// +// Android somehow still does not support std::to_string +#if defined(__ANDROID__) +# define CATCH_INTERNAL_CONFIG_NO_CPP11_TO_STRING +#endif + +//////////////////////////////////////////////////////////////////////////////// +// Not all Windows environments support SEH properly +#if defined(__MINGW32__) +# define CATCH_INTERNAL_CONFIG_NO_WINDOWS_SEH +#endif + +//////////////////////////////////////////////////////////////////////////////// +// PS4 +#if defined(__ORBIS__) +# define CATCH_INTERNAL_CONFIG_NO_NEW_CAPTURE +#endif + +//////////////////////////////////////////////////////////////////////////////// +// Cygwin +#ifdef __CYGWIN__ + +// Required for some versions of Cygwin to declare gettimeofday +// see: http://stackoverflow.com/questions/36901803/gettimeofday-not-declared-in-this-scope-cygwin +# define _BSD_SOURCE +// some versions of cygwin (most) do not support std::to_string. Use the libstd check. +// https://gcc.gnu.org/onlinedocs/gcc-4.8.2/libstdc++/api/a01053_source.html line 2812-2813 +# if !((__cplusplus >= 201103L) && defined(_GLIBCXX_USE_C99) \ + && !defined(_GLIBCXX_HAVE_BROKEN_VSWPRINTF)) + +# define CATCH_INTERNAL_CONFIG_NO_CPP11_TO_STRING + +# endif +#endif // __CYGWIN__ + +//////////////////////////////////////////////////////////////////////////////// +// Visual C++ +#ifdef _MSC_VER + +# if _MSC_VER >= 1900 // Visual Studio 2015 or newer +# define CATCH_INTERNAL_CONFIG_CPP17_UNCAUGHT_EXCEPTIONS +# endif + +// Universal Windows platform does not support SEH +// Or console colours (or console at all...) +# if defined(WINAPI_FAMILY) && (WINAPI_FAMILY == WINAPI_FAMILY_APP) +# define CATCH_CONFIG_COLOUR_NONE +# else +# define CATCH_INTERNAL_CONFIG_WINDOWS_SEH +# endif + +// MSVC traditional preprocessor needs some workaround for __VA_ARGS__ +// _MSVC_TRADITIONAL == 0 means new conformant preprocessor +// _MSVC_TRADITIONAL == 1 means old traditional non-conformant preprocessor +# if !defined(_MSVC_TRADITIONAL) || (defined(_MSVC_TRADITIONAL) && _MSVC_TRADITIONAL) +# define CATCH_INTERNAL_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +# endif + +#endif // _MSC_VER + +//////////////////////////////////////////////////////////////////////////////// +// Check if we are compiled with -fno-exceptions or equivalent +#if defined(__EXCEPTIONS) || defined(__cpp_exceptions) || defined(_CPPUNWIND) +# define CATCH_INTERNAL_CONFIG_EXCEPTIONS_ENABLED +#endif + +//////////////////////////////////////////////////////////////////////////////// +// DJGPP +#ifdef __DJGPP__ +# define CATCH_INTERNAL_CONFIG_NO_WCHAR +#endif // __DJGPP__ + +//////////////////////////////////////////////////////////////////////////////// +// Embarcadero C++Build +#if defined(__BORLANDC__) + #define CATCH_INTERNAL_CONFIG_POLYFILL_ISNAN +#endif + +//////////////////////////////////////////////////////////////////////////////// + +// Use of __COUNTER__ is suppressed during code analysis in +// CLion/AppCode 2017.2.x and former, because __COUNTER__ is not properly +// handled by it. +// Otherwise all supported compilers support COUNTER macro, +// but user still might want to turn it off +#if ( !defined(__JETBRAINS_IDE__) || __JETBRAINS_IDE__ >= 20170300L ) + #define CATCH_INTERNAL_CONFIG_COUNTER +#endif + +//////////////////////////////////////////////////////////////////////////////// +// Check if string_view is available and usable +// The check is split apart to work around v140 (VS2015) preprocessor issue... +#if defined(__has_include) +#if __has_include() && defined(CATCH_CPP17_OR_GREATER) +# define CATCH_INTERNAL_CONFIG_CPP17_STRING_VIEW +#endif +#endif + +//////////////////////////////////////////////////////////////////////////////// +// Check if optional is available and usable +#if defined(__has_include) +# if __has_include() && defined(CATCH_CPP17_OR_GREATER) +# define CATCH_INTERNAL_CONFIG_CPP17_OPTIONAL +# endif // __has_include() && defined(CATCH_CPP17_OR_GREATER) +#endif // __has_include + +//////////////////////////////////////////////////////////////////////////////// +// Check if variant is available and usable +#if defined(__has_include) +# if __has_include() && defined(CATCH_CPP17_OR_GREATER) +# if defined(__clang__) && (__clang_major__ < 8) + // work around clang bug with libstdc++ https://bugs.llvm.org/show_bug.cgi?id=31852 + // fix should be in clang 8, workaround in libstdc++ 8.2 +# include +# if defined(__GLIBCXX__) && defined(_GLIBCXX_RELEASE) && (_GLIBCXX_RELEASE < 9) +# define CATCH_CONFIG_NO_CPP17_VARIANT +# else +# define CATCH_INTERNAL_CONFIG_CPP17_VARIANT +# endif // defined(__GLIBCXX__) && defined(_GLIBCXX_RELEASE) && (_GLIBCXX_RELEASE < 9) +# else +# define CATCH_INTERNAL_CONFIG_CPP17_VARIANT +# endif // defined(__clang__) && (__clang_major__ < 8) +# endif // __has_include() && defined(CATCH_CPP17_OR_GREATER) +#endif // __has_include + +#if defined(CATCH_INTERNAL_CONFIG_COUNTER) && !defined(CATCH_CONFIG_NO_COUNTER) && !defined(CATCH_CONFIG_COUNTER) +# define CATCH_CONFIG_COUNTER +#endif +#if defined(CATCH_INTERNAL_CONFIG_WINDOWS_SEH) && !defined(CATCH_CONFIG_NO_WINDOWS_SEH) && !defined(CATCH_CONFIG_WINDOWS_SEH) && !defined(CATCH_INTERNAL_CONFIG_NO_WINDOWS_SEH) +# define CATCH_CONFIG_WINDOWS_SEH +#endif +// This is set by default, because we assume that unix compilers are posix-signal-compatible by default. +#if defined(CATCH_INTERNAL_CONFIG_POSIX_SIGNALS) && !defined(CATCH_INTERNAL_CONFIG_NO_POSIX_SIGNALS) && !defined(CATCH_CONFIG_NO_POSIX_SIGNALS) && !defined(CATCH_CONFIG_POSIX_SIGNALS) +# define CATCH_CONFIG_POSIX_SIGNALS +#endif +// This is set by default, because we assume that compilers with no wchar_t support are just rare exceptions. +#if !defined(CATCH_INTERNAL_CONFIG_NO_WCHAR) && !defined(CATCH_CONFIG_NO_WCHAR) && !defined(CATCH_CONFIG_WCHAR) +# define CATCH_CONFIG_WCHAR +#endif + +#if !defined(CATCH_INTERNAL_CONFIG_NO_CPP11_TO_STRING) && !defined(CATCH_CONFIG_NO_CPP11_TO_STRING) && !defined(CATCH_CONFIG_CPP11_TO_STRING) +# define CATCH_CONFIG_CPP11_TO_STRING +#endif + +#if defined(CATCH_INTERNAL_CONFIG_CPP17_OPTIONAL) && !defined(CATCH_CONFIG_NO_CPP17_OPTIONAL) && !defined(CATCH_CONFIG_CPP17_OPTIONAL) +# define CATCH_CONFIG_CPP17_OPTIONAL +#endif + +#if defined(CATCH_INTERNAL_CONFIG_CPP17_UNCAUGHT_EXCEPTIONS) && !defined(CATCH_CONFIG_NO_CPP17_UNCAUGHT_EXCEPTIONS) && !defined(CATCH_CONFIG_CPP17_UNCAUGHT_EXCEPTIONS) +# define CATCH_CONFIG_CPP17_UNCAUGHT_EXCEPTIONS +#endif + +#if defined(CATCH_INTERNAL_CONFIG_CPP17_STRING_VIEW) && !defined(CATCH_CONFIG_NO_CPP17_STRING_VIEW) && !defined(CATCH_CONFIG_CPP17_STRING_VIEW) +# define CATCH_CONFIG_CPP17_STRING_VIEW +#endif + +#if defined(CATCH_INTERNAL_CONFIG_CPP17_VARIANT) && !defined(CATCH_CONFIG_NO_CPP17_VARIANT) && !defined(CATCH_CONFIG_CPP17_VARIANT) +# define CATCH_CONFIG_CPP17_VARIANT +#endif + +#if defined(CATCH_CONFIG_EXPERIMENTAL_REDIRECT) +# define CATCH_INTERNAL_CONFIG_NEW_CAPTURE +#endif + +#if defined(CATCH_INTERNAL_CONFIG_NEW_CAPTURE) && !defined(CATCH_INTERNAL_CONFIG_NO_NEW_CAPTURE) && !defined(CATCH_CONFIG_NO_NEW_CAPTURE) && !defined(CATCH_CONFIG_NEW_CAPTURE) +# define CATCH_CONFIG_NEW_CAPTURE +#endif + +#if !defined(CATCH_INTERNAL_CONFIG_EXCEPTIONS_ENABLED) && !defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) +# define CATCH_CONFIG_DISABLE_EXCEPTIONS +#endif + +#if defined(CATCH_INTERNAL_CONFIG_POLYFILL_ISNAN) && !defined(CATCH_CONFIG_NO_POLYFILL_ISNAN) && !defined(CATCH_CONFIG_POLYFILL_ISNAN) +# define CATCH_CONFIG_POLYFILL_ISNAN +#endif + +#if !defined(CATCH_INTERNAL_SUPPRESS_PARENTHESES_WARNINGS) +# define CATCH_INTERNAL_SUPPRESS_PARENTHESES_WARNINGS +# define CATCH_INTERNAL_UNSUPPRESS_PARENTHESES_WARNINGS +#endif +#if !defined(CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS) +# define CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS +# define CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS +#endif +#if !defined(CATCH_INTERNAL_SUPPRESS_UNUSED_WARNINGS) +# define CATCH_INTERNAL_SUPPRESS_UNUSED_WARNINGS +# define CATCH_INTERNAL_UNSUPPRESS_UNUSED_WARNINGS +#endif + +#if defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) +#define CATCH_TRY if ((true)) +#define CATCH_CATCH_ALL if ((false)) +#define CATCH_CATCH_ANON(type) if ((false)) +#else +#define CATCH_TRY try +#define CATCH_CATCH_ALL catch (...) +#define CATCH_CATCH_ANON(type) catch (type) +#endif + +#if defined(CATCH_INTERNAL_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR) && !defined(CATCH_CONFIG_NO_TRADITIONAL_MSVC_PREPROCESSOR) && !defined(CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR) +#define CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#endif + +// end catch_compiler_capabilities.h +#define INTERNAL_CATCH_UNIQUE_NAME_LINE2( name, line ) name##line +#define INTERNAL_CATCH_UNIQUE_NAME_LINE( name, line ) INTERNAL_CATCH_UNIQUE_NAME_LINE2( name, line ) +#ifdef CATCH_CONFIG_COUNTER +# define INTERNAL_CATCH_UNIQUE_NAME( name ) INTERNAL_CATCH_UNIQUE_NAME_LINE( name, __COUNTER__ ) +#else +# define INTERNAL_CATCH_UNIQUE_NAME( name ) INTERNAL_CATCH_UNIQUE_NAME_LINE( name, __LINE__ ) +#endif + +#include +#include +#include + +// We need a dummy global operator<< so we can bring it into Catch namespace later +struct Catch_global_namespace_dummy {}; +std::ostream& operator<<(std::ostream&, Catch_global_namespace_dummy); + +namespace Catch { + + struct CaseSensitive { enum Choice { + Yes, + No + }; }; + + class NonCopyable { + NonCopyable( NonCopyable const& ) = delete; + NonCopyable( NonCopyable && ) = delete; + NonCopyable& operator = ( NonCopyable const& ) = delete; + NonCopyable& operator = ( NonCopyable && ) = delete; + + protected: + NonCopyable(); + virtual ~NonCopyable(); + }; + + struct SourceLineInfo { + + SourceLineInfo() = delete; + SourceLineInfo( char const* _file, std::size_t _line ) noexcept + : file( _file ), + line( _line ) + {} + + SourceLineInfo( SourceLineInfo const& other ) = default; + SourceLineInfo& operator = ( SourceLineInfo const& ) = default; + SourceLineInfo( SourceLineInfo&& ) noexcept = default; + SourceLineInfo& operator = ( SourceLineInfo&& ) noexcept = default; + + bool empty() const noexcept; + bool operator == ( SourceLineInfo const& other ) const noexcept; + bool operator < ( SourceLineInfo const& other ) const noexcept; + + char const* file; + std::size_t line; + }; + + std::ostream& operator << ( std::ostream& os, SourceLineInfo const& info ); + + // Bring in operator<< from global namespace into Catch namespace + // This is necessary because the overload of operator<< above makes + // lookup stop at namespace Catch + using ::operator<<; + + // Use this in variadic streaming macros to allow + // >> +StreamEndStop + // as well as + // >> stuff +StreamEndStop + struct StreamEndStop { + std::string operator+() const; + }; + template + T const& operator + ( T const& value, StreamEndStop ) { + return value; + } +} + +#define CATCH_INTERNAL_LINEINFO \ + ::Catch::SourceLineInfo( __FILE__, static_cast( __LINE__ ) ) + +// end catch_common.h +namespace Catch { + + struct RegistrarForTagAliases { + RegistrarForTagAliases( char const* alias, char const* tag, SourceLineInfo const& lineInfo ); + }; + +} // end namespace Catch + +#define CATCH_REGISTER_TAG_ALIAS( alias, spec ) \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ Catch::RegistrarForTagAliases INTERNAL_CATCH_UNIQUE_NAME( AutoRegisterTagAlias )( alias, spec, CATCH_INTERNAL_LINEINFO ); } \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS + +// end catch_tag_alias_autoregistrar.h +// start catch_test_registry.h + +// start catch_interfaces_testcase.h + +#include + +namespace Catch { + + class TestSpec; + + struct ITestInvoker { + virtual void invoke () const = 0; + virtual ~ITestInvoker(); + }; + + class TestCase; + struct IConfig; + + struct ITestCaseRegistry { + virtual ~ITestCaseRegistry(); + virtual std::vector const& getAllTests() const = 0; + virtual std::vector const& getAllTestsSorted( IConfig const& config ) const = 0; + }; + + bool matchTest( TestCase const& testCase, TestSpec const& testSpec, IConfig const& config ); + std::vector filterTests( std::vector const& testCases, TestSpec const& testSpec, IConfig const& config ); + std::vector const& getAllTestCasesSorted( IConfig const& config ); + +} + +// end catch_interfaces_testcase.h +// start catch_stringref.h + +#include +#include +#include + +namespace Catch { + + /// A non-owning string class (similar to the forthcoming std::string_view) + /// Note that, because a StringRef may be a substring of another string, + /// it may not be null terminated. c_str() must return a null terminated + /// string, however, and so the StringRef will internally take ownership + /// (taking a copy), if necessary. In theory this ownership is not externally + /// visible - but it does mean (substring) StringRefs should not be shared between + /// threads. + class StringRef { + public: + using size_type = std::size_t; + + private: + friend struct StringRefTestAccess; + + char const* m_start; + size_type m_size; + + char* m_data = nullptr; + + void takeOwnership(); + + static constexpr char const* const s_empty = ""; + + public: // construction/ assignment + StringRef() noexcept + : StringRef( s_empty, 0 ) + {} + + StringRef( StringRef const& other ) noexcept + : m_start( other.m_start ), + m_size( other.m_size ) + {} + + StringRef( StringRef&& other ) noexcept + : m_start( other.m_start ), + m_size( other.m_size ), + m_data( other.m_data ) + { + other.m_data = nullptr; + } + + StringRef( char const* rawChars ) noexcept; + + StringRef( char const* rawChars, size_type size ) noexcept + : m_start( rawChars ), + m_size( size ) + {} + + StringRef( std::string const& stdString ) noexcept + : m_start( stdString.c_str() ), + m_size( stdString.size() ) + {} + + ~StringRef() noexcept { + delete[] m_data; + } + + auto operator = ( StringRef const &other ) noexcept -> StringRef& { + delete[] m_data; + m_data = nullptr; + m_start = other.m_start; + m_size = other.m_size; + return *this; + } + + operator std::string() const; + + void swap( StringRef& other ) noexcept; + + public: // operators + auto operator == ( StringRef const& other ) const noexcept -> bool; + auto operator != ( StringRef const& other ) const noexcept -> bool; + + auto operator[] ( size_type index ) const noexcept -> char; + + public: // named queries + auto empty() const noexcept -> bool { + return m_size == 0; + } + auto size() const noexcept -> size_type { + return m_size; + } + + auto numberOfCharacters() const noexcept -> size_type; + auto c_str() const -> char const*; + + public: // substrings and searches + auto substr( size_type start, size_type size ) const noexcept -> StringRef; + + // Returns the current start pointer. + // Note that the pointer can change when if the StringRef is a substring + auto currentData() const noexcept -> char const*; + + private: // ownership queries - may not be consistent between calls + auto isOwned() const noexcept -> bool; + auto isSubstring() const noexcept -> bool; + }; + + auto operator + ( StringRef const& lhs, StringRef const& rhs ) -> std::string; + auto operator + ( StringRef const& lhs, char const* rhs ) -> std::string; + auto operator + ( char const* lhs, StringRef const& rhs ) -> std::string; + + auto operator += ( std::string& lhs, StringRef const& sr ) -> std::string&; + auto operator << ( std::ostream& os, StringRef const& sr ) -> std::ostream&; + + inline auto operator "" _sr( char const* rawChars, std::size_t size ) noexcept -> StringRef { + return StringRef( rawChars, size ); + } + +} // namespace Catch + +inline auto operator "" _catch_sr( char const* rawChars, std::size_t size ) noexcept -> Catch::StringRef { + return Catch::StringRef( rawChars, size ); +} + +// end catch_stringref.h +// start catch_type_traits.hpp + + +#include + +namespace Catch{ + +#ifdef CATCH_CPP17_OR_GREATER + template + inline constexpr auto is_unique = std::true_type{}; + + template + inline constexpr auto is_unique = std::bool_constant< + (!std::is_same_v && ...) && is_unique + >{}; +#else + +template +struct is_unique : std::true_type{}; + +template +struct is_unique : std::integral_constant +::value + && is_unique::value + && is_unique::value +>{}; + +#endif +} + +// end catch_type_traits.hpp +// start catch_preprocessor.hpp + + +#define CATCH_RECURSION_LEVEL0(...) __VA_ARGS__ +#define CATCH_RECURSION_LEVEL1(...) CATCH_RECURSION_LEVEL0(CATCH_RECURSION_LEVEL0(CATCH_RECURSION_LEVEL0(__VA_ARGS__))) +#define CATCH_RECURSION_LEVEL2(...) CATCH_RECURSION_LEVEL1(CATCH_RECURSION_LEVEL1(CATCH_RECURSION_LEVEL1(__VA_ARGS__))) +#define CATCH_RECURSION_LEVEL3(...) CATCH_RECURSION_LEVEL2(CATCH_RECURSION_LEVEL2(CATCH_RECURSION_LEVEL2(__VA_ARGS__))) +#define CATCH_RECURSION_LEVEL4(...) CATCH_RECURSION_LEVEL3(CATCH_RECURSION_LEVEL3(CATCH_RECURSION_LEVEL3(__VA_ARGS__))) +#define CATCH_RECURSION_LEVEL5(...) CATCH_RECURSION_LEVEL4(CATCH_RECURSION_LEVEL4(CATCH_RECURSION_LEVEL4(__VA_ARGS__))) + +#ifdef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define INTERNAL_CATCH_EXPAND_VARGS(...) __VA_ARGS__ +// MSVC needs more evaluations +#define CATCH_RECURSION_LEVEL6(...) CATCH_RECURSION_LEVEL5(CATCH_RECURSION_LEVEL5(CATCH_RECURSION_LEVEL5(__VA_ARGS__))) +#define CATCH_RECURSE(...) CATCH_RECURSION_LEVEL6(CATCH_RECURSION_LEVEL6(__VA_ARGS__)) +#else +#define CATCH_RECURSE(...) CATCH_RECURSION_LEVEL5(__VA_ARGS__) +#endif + +#define CATCH_REC_END(...) +#define CATCH_REC_OUT + +#define CATCH_EMPTY() +#define CATCH_DEFER(id) id CATCH_EMPTY() + +#define CATCH_REC_GET_END2() 0, CATCH_REC_END +#define CATCH_REC_GET_END1(...) CATCH_REC_GET_END2 +#define CATCH_REC_GET_END(...) CATCH_REC_GET_END1 +#define CATCH_REC_NEXT0(test, next, ...) next CATCH_REC_OUT +#define CATCH_REC_NEXT1(test, next) CATCH_DEFER ( CATCH_REC_NEXT0 ) ( test, next, 0) +#define CATCH_REC_NEXT(test, next) CATCH_REC_NEXT1(CATCH_REC_GET_END test, next) + +#define CATCH_REC_LIST0(f, x, peek, ...) , f(x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST1) ) ( f, peek, __VA_ARGS__ ) +#define CATCH_REC_LIST1(f, x, peek, ...) , f(x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST0) ) ( f, peek, __VA_ARGS__ ) +#define CATCH_REC_LIST2(f, x, peek, ...) f(x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST1) ) ( f, peek, __VA_ARGS__ ) + +#define CATCH_REC_LIST0_UD(f, userdata, x, peek, ...) , f(userdata, x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST1_UD) ) ( f, userdata, peek, __VA_ARGS__ ) +#define CATCH_REC_LIST1_UD(f, userdata, x, peek, ...) , f(userdata, x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST0_UD) ) ( f, userdata, peek, __VA_ARGS__ ) +#define CATCH_REC_LIST2_UD(f, userdata, x, peek, ...) f(userdata, x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST1_UD) ) ( f, userdata, peek, __VA_ARGS__ ) + +// Applies the function macro `f` to each of the remaining parameters, inserts commas between the results, +// and passes userdata as the first parameter to each invocation, +// e.g. CATCH_REC_LIST_UD(f, x, a, b, c) evaluates to f(x, a), f(x, b), f(x, c) +#define CATCH_REC_LIST_UD(f, userdata, ...) CATCH_RECURSE(CATCH_REC_LIST2_UD(f, userdata, __VA_ARGS__, ()()(), ()()(), ()()(), 0)) + +#define CATCH_REC_LIST(f, ...) CATCH_RECURSE(CATCH_REC_LIST2(f, __VA_ARGS__, ()()(), ()()(), ()()(), 0)) + +#define INTERNAL_CATCH_EXPAND1(param) INTERNAL_CATCH_EXPAND2(param) +#define INTERNAL_CATCH_EXPAND2(...) INTERNAL_CATCH_NO## __VA_ARGS__ +#define INTERNAL_CATCH_DEF(...) INTERNAL_CATCH_DEF __VA_ARGS__ +#define INTERNAL_CATCH_NOINTERNAL_CATCH_DEF +#define INTERNAL_CATCH_STRINGIZE(...) INTERNAL_CATCH_STRINGIZE2(__VA_ARGS__) +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define INTERNAL_CATCH_STRINGIZE2(...) #__VA_ARGS__ +#define INTERNAL_CATCH_STRINGIZE_WITHOUT_PARENS(param) INTERNAL_CATCH_STRINGIZE(INTERNAL_CATCH_REMOVE_PARENS(param)) +#else +// MSVC is adding extra space and needs another indirection to expand INTERNAL_CATCH_NOINTERNAL_CATCH_DEF +#define INTERNAL_CATCH_STRINGIZE2(...) INTERNAL_CATCH_STRINGIZE3(__VA_ARGS__) +#define INTERNAL_CATCH_STRINGIZE3(...) #__VA_ARGS__ +#define INTERNAL_CATCH_STRINGIZE_WITHOUT_PARENS(param) (INTERNAL_CATCH_STRINGIZE(INTERNAL_CATCH_REMOVE_PARENS(param)) + 1) +#endif + +#define INTERNAL_CATCH_REMOVE_PARENS(...) INTERNAL_CATCH_EXPAND1(INTERNAL_CATCH_DEF __VA_ARGS__) + +#define INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME2(Name, ...) INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME3(Name, __VA_ARGS__) +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME3(Name,...) Name " - " #__VA_ARGS__ +#define INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME(Name,...) INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME2(Name, INTERNAL_CATCH_REMOVE_PARENS(__VA_ARGS__)) +#else +// MSVC is adding extra space and needs more calls to properly remove () +#define INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME3(Name,...) Name " -" #__VA_ARGS__ +#define INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME1(Name, ...) INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME2(Name, __VA_ARGS__) +#define INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME(Name, ...) INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME1(Name, INTERNAL_CATCH_EXPAND_VARGS(INTERNAL_CATCH_REMOVE_PARENS(__VA_ARGS__))) +#endif + +#define INTERNAL_CATCH_MAKE_TYPE_LIST(types) Catch::TypeList + +#define INTERNAL_CATCH_MAKE_TYPE_LISTS_FROM_TYPES(types)\ + CATCH_REC_LIST(INTERNAL_CATCH_MAKE_TYPE_LIST,INTERNAL_CATCH_REMOVE_PARENS(types)) + +// end catch_preprocessor.hpp +// start catch_meta.hpp + + +#include + +namespace Catch { +template< typename... > +struct TypeList {}; + +template< typename... > +struct append; + +template< template class L1 + , typename...E1 + , template class L2 + , typename...E2 +> +struct append< L1, L2 > { + using type = L1; +}; + +template< template class L1 + , typename...E1 + , template class L2 + , typename...E2 + , typename...Rest +> +struct append< L1, L2, Rest...> { + using type = typename append< L1, Rest... >::type; +}; + +template< template class + , typename... +> +struct rewrap; + +template< template class Container + , template class List + , typename...elems +> +struct rewrap> { + using type = TypeList< Container< elems... > >; +}; + +template< template class Container + , template class List + , class...Elems + , typename...Elements> + struct rewrap, Elements...> { + using type = typename append>, typename rewrap::type>::type; +}; + +template< template class...Containers > +struct combine { + template< typename...Types > + struct with_types { + template< template class Final > + struct into { + using type = typename append, typename rewrap::type...>::type; + }; + }; +}; + +template +struct always_false : std::false_type {}; + +} // namespace Catch + +// end catch_meta.hpp +namespace Catch { + +template +class TestInvokerAsMethod : public ITestInvoker { + void (C::*m_testAsMethod)(); +public: + TestInvokerAsMethod( void (C::*testAsMethod)() ) noexcept : m_testAsMethod( testAsMethod ) {} + + void invoke() const override { + C obj; + (obj.*m_testAsMethod)(); + } +}; + +auto makeTestInvoker( void(*testAsFunction)() ) noexcept -> ITestInvoker*; + +template +auto makeTestInvoker( void (C::*testAsMethod)() ) noexcept -> ITestInvoker* { + return new(std::nothrow) TestInvokerAsMethod( testAsMethod ); +} + +struct NameAndTags { + NameAndTags( StringRef const& name_ = StringRef(), StringRef const& tags_ = StringRef() ) noexcept; + StringRef name; + StringRef tags; +}; + +struct AutoReg : NonCopyable { + AutoReg( ITestInvoker* invoker, SourceLineInfo const& lineInfo, StringRef const& classOrMethod, NameAndTags const& nameAndTags ) noexcept; + ~AutoReg(); +}; + +} // end namespace Catch + +#if defined(CATCH_CONFIG_DISABLE) + #define INTERNAL_CATCH_TESTCASE_NO_REGISTRATION( TestName, ... ) \ + static void TestName() + #define INTERNAL_CATCH_TESTCASE_METHOD_NO_REGISTRATION( TestName, ClassName, ... ) \ + namespace{ \ + struct TestName : INTERNAL_CATCH_REMOVE_PARENS(ClassName) { \ + void test(); \ + }; \ + } \ + void TestName::test() + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE_NO_REGISTRATION( TestName, ... ) \ + template \ + static void TestName() + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_NO_REGISTRATION( TestName, ClassName, ... ) \ + namespace{ \ + template \ + struct TestName : INTERNAL_CATCH_REMOVE_PARENS(ClassName ) { \ + void test(); \ + }; \ + } \ + template \ + void TestName::test() +#endif + + /////////////////////////////////////////////////////////////////////////////// + #define INTERNAL_CATCH_TESTCASE2( TestName, ... ) \ + static void TestName(); \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ Catch::AutoReg INTERNAL_CATCH_UNIQUE_NAME( autoRegistrar )( Catch::makeTestInvoker( &TestName ), CATCH_INTERNAL_LINEINFO, Catch::StringRef(), Catch::NameAndTags{ __VA_ARGS__ } ); } /* NOLINT */ \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS \ + static void TestName() + #define INTERNAL_CATCH_TESTCASE( ... ) \ + INTERNAL_CATCH_TESTCASE2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ ), __VA_ARGS__ ) + + /////////////////////////////////////////////////////////////////////////////// + #define INTERNAL_CATCH_METHOD_AS_TEST_CASE( QualifiedMethod, ... ) \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ Catch::AutoReg INTERNAL_CATCH_UNIQUE_NAME( autoRegistrar )( Catch::makeTestInvoker( &QualifiedMethod ), CATCH_INTERNAL_LINEINFO, "&" #QualifiedMethod, Catch::NameAndTags{ __VA_ARGS__ } ); } /* NOLINT */ \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS + + /////////////////////////////////////////////////////////////////////////////// + #define INTERNAL_CATCH_TEST_CASE_METHOD2( TestName, ClassName, ... )\ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ \ + struct TestName : INTERNAL_CATCH_REMOVE_PARENS(ClassName) { \ + void test(); \ + }; \ + Catch::AutoReg INTERNAL_CATCH_UNIQUE_NAME( autoRegistrar ) ( Catch::makeTestInvoker( &TestName::test ), CATCH_INTERNAL_LINEINFO, #ClassName, Catch::NameAndTags{ __VA_ARGS__ } ); /* NOLINT */ \ + } \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS \ + void TestName::test() + #define INTERNAL_CATCH_TEST_CASE_METHOD( ClassName, ... ) \ + INTERNAL_CATCH_TEST_CASE_METHOD2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ ), ClassName, __VA_ARGS__ ) + + /////////////////////////////////////////////////////////////////////////////// + #define INTERNAL_CATCH_REGISTER_TESTCASE( Function, ... ) \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + Catch::AutoReg INTERNAL_CATCH_UNIQUE_NAME( autoRegistrar )( Catch::makeTestInvoker( Function ), CATCH_INTERNAL_LINEINFO, Catch::StringRef(), Catch::NameAndTags{ __VA_ARGS__ } ); /* NOLINT */ \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS + + /////////////////////////////////////////////////////////////////////////////// + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE_2(TestName, TestFunc, Name, Tags, ... )\ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + template \ + static void TestFunc();\ + namespace {\ + template \ + struct TestName{\ + template \ + TestName(Ts...names){\ + CATCH_INTERNAL_CHECK_UNIQUE_TYPES(CATCH_REC_LIST(INTERNAL_CATCH_REMOVE_PARENS, __VA_ARGS__)) \ + using expander = int[];\ + (void)expander{(Catch::AutoReg( Catch::makeTestInvoker( &TestFunc ), CATCH_INTERNAL_LINEINFO, Catch::StringRef(), Catch::NameAndTags{ names, Tags } ), 0)... };/* NOLINT */ \ + }\ + };\ + INTERNAL_CATCH_TEMPLATE_REGISTRY_INITIATE(TestName, Name, __VA_ARGS__) \ + }\ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS \ + template \ + static void TestFunc() + +#if defined(CATCH_CPP17_OR_GREATER) +#define CATCH_INTERNAL_CHECK_UNIQUE_TYPES(...) static_assert(Catch::is_unique<__VA_ARGS__>,"Duplicate type detected in declaration of template test case"); +#else +#define CATCH_INTERNAL_CHECK_UNIQUE_TYPES(...) static_assert(Catch::is_unique<__VA_ARGS__>::value,"Duplicate type detected in declaration of template test case"); +#endif + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE(Name, Tags, ...) \ + INTERNAL_CATCH_TEMPLATE_TEST_CASE_2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____F_U_N_C____ ), Name, Tags, __VA_ARGS__ ) +#else + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE(Name, Tags, ...) \ + INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____F_U_N_C____ ), Name, Tags, __VA_ARGS__ ) ) +#endif + + #define INTERNAL_CATCH_TEMPLATE_REGISTRY_INITIATE(TestName, Name, ...)\ + static int INTERNAL_CATCH_UNIQUE_NAME( globalRegistrar ) = [](){\ + TestName(CATCH_REC_LIST_UD(INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME,Name, __VA_ARGS__));\ + return 0;\ + }(); + + #define INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE2(TestName, TestFuncName, Name, Tags, TmplTypes, TypesList) \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + template static void TestFuncName(); \ + namespace { \ + template \ + struct TestName { \ + TestName() { \ + CATCH_INTERNAL_CHECK_UNIQUE_TYPES(Types...) \ + int index = 0; \ + using expander = int[]; \ + constexpr char const* tmpl_types[] = {CATCH_REC_LIST(INTERNAL_CATCH_STRINGIZE_WITHOUT_PARENS, INTERNAL_CATCH_REMOVE_PARENS(TmplTypes))};\ + constexpr char const* types_list[] = {CATCH_REC_LIST(INTERNAL_CATCH_STRINGIZE_WITHOUT_PARENS, INTERNAL_CATCH_REMOVE_PARENS(TypesList))};\ + constexpr auto num_types = sizeof(types_list) / sizeof(types_list[0]);\ + (void)expander{(Catch::AutoReg( Catch::makeTestInvoker( &TestFuncName ), CATCH_INTERNAL_LINEINFO, Catch::StringRef(), Catch::NameAndTags{ Name " - " + std::string(tmpl_types[index / num_types]) + "<" + std::string(types_list[index % num_types]) + ">", Tags } ), index++, 0)... };/* NOLINT */\ + } \ + }; \ + static int INTERNAL_CATCH_UNIQUE_NAME( globalRegistrar ) = [](){ \ + using TestInit = Catch::combine \ + ::with_types::into::type; \ + TestInit(); \ + return 0; \ + }(); \ + } \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS \ + template \ + static void TestFuncName() + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR + #define INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE(Name, Tags, ...)\ + INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE2(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____F_U_N_C____ ),Name,Tags,__VA_ARGS__) +#else + #define INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE(Name, Tags, ...)\ + INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____F_U_N_C____ ), Name, Tags, __VA_ARGS__ ) ) +#endif + + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_2( TestNameClass, TestName, ClassName, Name, Tags, ... ) \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ \ + template \ + struct TestName : INTERNAL_CATCH_REMOVE_PARENS(ClassName ) { \ + void test();\ + };\ + template \ + struct TestNameClass{\ + template \ + TestNameClass(Ts...names){\ + CATCH_INTERNAL_CHECK_UNIQUE_TYPES(CATCH_REC_LIST(INTERNAL_CATCH_REMOVE_PARENS, __VA_ARGS__)) \ + using expander = int[];\ + (void)expander{(Catch::AutoReg( Catch::makeTestInvoker( &TestName::test ), CATCH_INTERNAL_LINEINFO, #ClassName, Catch::NameAndTags{ names, Tags } ), 0)... };/* NOLINT */ \ + }\ + };\ + INTERNAL_CATCH_TEMPLATE_REGISTRY_INITIATE(TestNameClass, Name, __VA_ARGS__)\ + }\ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS\ + template \ + void TestName::test() + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD( ClassName, Name, Tags,... ) \ + INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____C_L_A_S_S____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ) , ClassName, Name, Tags, __VA_ARGS__ ) +#else + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD( ClassName, Name, Tags,... ) \ + INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____C_L_A_S_S____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ) , ClassName, Name, Tags, __VA_ARGS__ ) ) +#endif + + #define INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD_2(TestNameClass, TestName, ClassName, Name, Tags, TmplTypes, TypesList)\ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + template \ + struct TestName : INTERNAL_CATCH_REMOVE_PARENS(ClassName ) { \ + void test();\ + };\ + namespace {\ + template\ + struct TestNameClass{\ + TestNameClass(){\ + CATCH_INTERNAL_CHECK_UNIQUE_TYPES(Types...)\ + int index = 0;\ + using expander = int[];\ + constexpr char const* tmpl_types[] = {CATCH_REC_LIST(INTERNAL_CATCH_STRINGIZE_WITHOUT_PARENS, INTERNAL_CATCH_REMOVE_PARENS(TmplTypes))};\ + constexpr char const* types_list[] = {CATCH_REC_LIST(INTERNAL_CATCH_STRINGIZE_WITHOUT_PARENS, INTERNAL_CATCH_REMOVE_PARENS(TypesList))};\ + constexpr auto num_types = sizeof(types_list) / sizeof(types_list[0]);\ + (void)expander{(Catch::AutoReg( Catch::makeTestInvoker( &TestName::test ), CATCH_INTERNAL_LINEINFO, #ClassName, Catch::NameAndTags{ Name " - " + std::string(tmpl_types[index / num_types]) + "<" + std::string(types_list[index % num_types]) + ">", Tags } ), index++, 0)... };/* NOLINT */ \ + }\ + };\ + static int INTERNAL_CATCH_UNIQUE_NAME( globalRegistrar ) = [](){\ + using TestInit = Catch::combine\ + ::with_types::into::type;\ + TestInit();\ + return 0;\ + }(); \ + }\ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS \ + template \ + void TestName::test() + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR + #define INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( ClassName, Name, Tags, ... )\ + INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD_2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____F_U_N_C____ ), ClassName, Name, Tags, __VA_ARGS__ ) +#else + #define INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( ClassName, Name, Tags, ... )\ + INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD_2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____F_U_N_C____ ), ClassName, Name, Tags, __VA_ARGS__ ) ) +#endif + +// end catch_test_registry.h +// start catch_capture.hpp + +// start catch_assertionhandler.h + +// start catch_assertioninfo.h + +// start catch_result_type.h + +namespace Catch { + + // ResultWas::OfType enum + struct ResultWas { enum OfType { + Unknown = -1, + Ok = 0, + Info = 1, + Warning = 2, + + FailureBit = 0x10, + + ExpressionFailed = FailureBit | 1, + ExplicitFailure = FailureBit | 2, + + Exception = 0x100 | FailureBit, + + ThrewException = Exception | 1, + DidntThrowException = Exception | 2, + + FatalErrorCondition = 0x200 | FailureBit + + }; }; + + bool isOk( ResultWas::OfType resultType ); + bool isJustInfo( int flags ); + + // ResultDisposition::Flags enum + struct ResultDisposition { enum Flags { + Normal = 0x01, + + ContinueOnFailure = 0x02, // Failures fail test, but execution continues + FalseTest = 0x04, // Prefix expression with ! + SuppressFail = 0x08 // Failures are reported but do not fail the test + }; }; + + ResultDisposition::Flags operator | ( ResultDisposition::Flags lhs, ResultDisposition::Flags rhs ); + + bool shouldContinueOnFailure( int flags ); + inline bool isFalseTest( int flags ) { return ( flags & ResultDisposition::FalseTest ) != 0; } + bool shouldSuppressFailure( int flags ); + +} // end namespace Catch + +// end catch_result_type.h +namespace Catch { + + struct AssertionInfo + { + StringRef macroName; + SourceLineInfo lineInfo; + StringRef capturedExpression; + ResultDisposition::Flags resultDisposition; + + // We want to delete this constructor but a compiler bug in 4.8 means + // the struct is then treated as non-aggregate + //AssertionInfo() = delete; + }; + +} // end namespace Catch + +// end catch_assertioninfo.h +// start catch_decomposer.h + +// start catch_tostring.h + +#include +#include +#include +#include +// start catch_stream.h + +#include +#include +#include + +namespace Catch { + + std::ostream& cout(); + std::ostream& cerr(); + std::ostream& clog(); + + class StringRef; + + struct IStream { + virtual ~IStream(); + virtual std::ostream& stream() const = 0; + }; + + auto makeStream( StringRef const &filename ) -> IStream const*; + + class ReusableStringStream { + std::size_t m_index; + std::ostream* m_oss; + public: + ReusableStringStream(); + ~ReusableStringStream(); + + auto str() const -> std::string; + + template + auto operator << ( T const& value ) -> ReusableStringStream& { + *m_oss << value; + return *this; + } + auto get() -> std::ostream& { return *m_oss; } + }; +} + +// end catch_stream.h + +#ifdef CATCH_CONFIG_CPP17_STRING_VIEW +#include +#endif + +#ifdef __OBJC__ +// start catch_objc_arc.hpp + +#import + +#ifdef __has_feature +#define CATCH_ARC_ENABLED __has_feature(objc_arc) +#else +#define CATCH_ARC_ENABLED 0 +#endif + +void arcSafeRelease( NSObject* obj ); +id performOptionalSelector( id obj, SEL sel ); + +#if !CATCH_ARC_ENABLED +inline void arcSafeRelease( NSObject* obj ) { + [obj release]; +} +inline id performOptionalSelector( id obj, SEL sel ) { + if( [obj respondsToSelector: sel] ) + return [obj performSelector: sel]; + return nil; +} +#define CATCH_UNSAFE_UNRETAINED +#define CATCH_ARC_STRONG +#else +inline void arcSafeRelease( NSObject* ){} +inline id performOptionalSelector( id obj, SEL sel ) { +#ifdef __clang__ +#pragma clang diagnostic push +#pragma clang diagnostic ignored "-Warc-performSelector-leaks" +#endif + if( [obj respondsToSelector: sel] ) + return [obj performSelector: sel]; +#ifdef __clang__ +#pragma clang diagnostic pop +#endif + return nil; +} +#define CATCH_UNSAFE_UNRETAINED __unsafe_unretained +#define CATCH_ARC_STRONG __strong +#endif + +// end catch_objc_arc.hpp +#endif + +#ifdef _MSC_VER +#pragma warning(push) +#pragma warning(disable:4180) // We attempt to stream a function (address) by const&, which MSVC complains about but is harmless +#endif + +namespace Catch { + namespace Detail { + + extern const std::string unprintableString; + + std::string rawMemoryToString( const void *object, std::size_t size ); + + template + std::string rawMemoryToString( const T& object ) { + return rawMemoryToString( &object, sizeof(object) ); + } + + template + class IsStreamInsertable { + template + static auto test(int) + -> decltype(std::declval() << std::declval(), std::true_type()); + + template + static auto test(...)->std::false_type; + + public: + static const bool value = decltype(test(0))::value; + }; + + template + std::string convertUnknownEnumToString( E e ); + + template + typename std::enable_if< + !std::is_enum::value && !std::is_base_of::value, + std::string>::type convertUnstreamable( T const& ) { + return Detail::unprintableString; + } + template + typename std::enable_if< + !std::is_enum::value && std::is_base_of::value, + std::string>::type convertUnstreamable(T const& ex) { + return ex.what(); + } + + template + typename std::enable_if< + std::is_enum::value + , std::string>::type convertUnstreamable( T const& value ) { + return convertUnknownEnumToString( value ); + } + +#if defined(_MANAGED) + //! Convert a CLR string to a utf8 std::string + template + std::string clrReferenceToString( T^ ref ) { + if (ref == nullptr) + return std::string("null"); + auto bytes = System::Text::Encoding::UTF8->GetBytes(ref->ToString()); + cli::pin_ptr p = &bytes[0]; + return std::string(reinterpret_cast(p), bytes->Length); + } +#endif + + } // namespace Detail + + // If we decide for C++14, change these to enable_if_ts + template + struct StringMaker { + template + static + typename std::enable_if<::Catch::Detail::IsStreamInsertable::value, std::string>::type + convert(const Fake& value) { + ReusableStringStream rss; + // NB: call using the function-like syntax to avoid ambiguity with + // user-defined templated operator<< under clang. + rss.operator<<(value); + return rss.str(); + } + + template + static + typename std::enable_if::value, std::string>::type + convert( const Fake& value ) { +#if !defined(CATCH_CONFIG_FALLBACK_STRINGIFIER) + return Detail::convertUnstreamable(value); +#else + return CATCH_CONFIG_FALLBACK_STRINGIFIER(value); +#endif + } + }; + + namespace Detail { + + // This function dispatches all stringification requests inside of Catch. + // Should be preferably called fully qualified, like ::Catch::Detail::stringify + template + std::string stringify(const T& e) { + return ::Catch::StringMaker::type>::type>::convert(e); + } + + template + std::string convertUnknownEnumToString( E e ) { + return ::Catch::Detail::stringify(static_cast::type>(e)); + } + +#if defined(_MANAGED) + template + std::string stringify( T^ e ) { + return ::Catch::StringMaker::convert(e); + } +#endif + + } // namespace Detail + + // Some predefined specializations + + template<> + struct StringMaker { + static std::string convert(const std::string& str); + }; + +#ifdef CATCH_CONFIG_CPP17_STRING_VIEW + template<> + struct StringMaker { + static std::string convert(std::string_view str); + }; +#endif + + template<> + struct StringMaker { + static std::string convert(char const * str); + }; + template<> + struct StringMaker { + static std::string convert(char * str); + }; + +#ifdef CATCH_CONFIG_WCHAR + template<> + struct StringMaker { + static std::string convert(const std::wstring& wstr); + }; + +# ifdef CATCH_CONFIG_CPP17_STRING_VIEW + template<> + struct StringMaker { + static std::string convert(std::wstring_view str); + }; +# endif + + template<> + struct StringMaker { + static std::string convert(wchar_t const * str); + }; + template<> + struct StringMaker { + static std::string convert(wchar_t * str); + }; +#endif + + // TBD: Should we use `strnlen` to ensure that we don't go out of the buffer, + // while keeping string semantics? + template + struct StringMaker { + static std::string convert(char const* str) { + return ::Catch::Detail::stringify(std::string{ str }); + } + }; + template + struct StringMaker { + static std::string convert(signed char const* str) { + return ::Catch::Detail::stringify(std::string{ reinterpret_cast(str) }); + } + }; + template + struct StringMaker { + static std::string convert(unsigned char const* str) { + return ::Catch::Detail::stringify(std::string{ reinterpret_cast(str) }); + } + }; + + template<> + struct StringMaker { + static std::string convert(int value); + }; + template<> + struct StringMaker { + static std::string convert(long value); + }; + template<> + struct StringMaker { + static std::string convert(long long value); + }; + template<> + struct StringMaker { + static std::string convert(unsigned int value); + }; + template<> + struct StringMaker { + static std::string convert(unsigned long value); + }; + template<> + struct StringMaker { + static std::string convert(unsigned long long value); + }; + + template<> + struct StringMaker { + static std::string convert(bool b); + }; + + template<> + struct StringMaker { + static std::string convert(char c); + }; + template<> + struct StringMaker { + static std::string convert(signed char c); + }; + template<> + struct StringMaker { + static std::string convert(unsigned char c); + }; + + template<> + struct StringMaker { + static std::string convert(std::nullptr_t); + }; + + template<> + struct StringMaker { + static std::string convert(float value); + }; + template<> + struct StringMaker { + static std::string convert(double value); + }; + + template + struct StringMaker { + template + static std::string convert(U* p) { + if (p) { + return ::Catch::Detail::rawMemoryToString(p); + } else { + return "nullptr"; + } + } + }; + + template + struct StringMaker { + static std::string convert(R C::* p) { + if (p) { + return ::Catch::Detail::rawMemoryToString(p); + } else { + return "nullptr"; + } + } + }; + +#if defined(_MANAGED) + template + struct StringMaker { + static std::string convert( T^ ref ) { + return ::Catch::Detail::clrReferenceToString(ref); + } + }; +#endif + + namespace Detail { + template + std::string rangeToString(InputIterator first, InputIterator last) { + ReusableStringStream rss; + rss << "{ "; + if (first != last) { + rss << ::Catch::Detail::stringify(*first); + for (++first; first != last; ++first) + rss << ", " << ::Catch::Detail::stringify(*first); + } + rss << " }"; + return rss.str(); + } + } + +#ifdef __OBJC__ + template<> + struct StringMaker { + static std::string convert(NSString * nsstring) { + if (!nsstring) + return "nil"; + return std::string("@") + [nsstring UTF8String]; + } + }; + template<> + struct StringMaker { + static std::string convert(NSObject* nsObject) { + return ::Catch::Detail::stringify([nsObject description]); + } + + }; + namespace Detail { + inline std::string stringify( NSString* nsstring ) { + return StringMaker::convert( nsstring ); + } + + } // namespace Detail +#endif // __OBJC__ + +} // namespace Catch + +////////////////////////////////////////////////////// +// Separate std-lib types stringification, so it can be selectively enabled +// This means that we do not bring in + +#if defined(CATCH_CONFIG_ENABLE_ALL_STRINGMAKERS) +# define CATCH_CONFIG_ENABLE_PAIR_STRINGMAKER +# define CATCH_CONFIG_ENABLE_TUPLE_STRINGMAKER +# define CATCH_CONFIG_ENABLE_VARIANT_STRINGMAKER +# define CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER +# define CATCH_CONFIG_ENABLE_OPTIONAL_STRINGMAKER +#endif + +// Separate std::pair specialization +#if defined(CATCH_CONFIG_ENABLE_PAIR_STRINGMAKER) +#include +namespace Catch { + template + struct StringMaker > { + static std::string convert(const std::pair& pair) { + ReusableStringStream rss; + rss << "{ " + << ::Catch::Detail::stringify(pair.first) + << ", " + << ::Catch::Detail::stringify(pair.second) + << " }"; + return rss.str(); + } + }; +} +#endif // CATCH_CONFIG_ENABLE_PAIR_STRINGMAKER + +#if defined(CATCH_CONFIG_ENABLE_OPTIONAL_STRINGMAKER) && defined(CATCH_CONFIG_CPP17_OPTIONAL) +#include +namespace Catch { + template + struct StringMaker > { + static std::string convert(const std::optional& optional) { + ReusableStringStream rss; + if (optional.has_value()) { + rss << ::Catch::Detail::stringify(*optional); + } else { + rss << "{ }"; + } + return rss.str(); + } + }; +} +#endif // CATCH_CONFIG_ENABLE_OPTIONAL_STRINGMAKER + +// Separate std::tuple specialization +#if defined(CATCH_CONFIG_ENABLE_TUPLE_STRINGMAKER) +#include +namespace Catch { + namespace Detail { + template< + typename Tuple, + std::size_t N = 0, + bool = (N < std::tuple_size::value) + > + struct TupleElementPrinter { + static void print(const Tuple& tuple, std::ostream& os) { + os << (N ? ", " : " ") + << ::Catch::Detail::stringify(std::get(tuple)); + TupleElementPrinter::print(tuple, os); + } + }; + + template< + typename Tuple, + std::size_t N + > + struct TupleElementPrinter { + static void print(const Tuple&, std::ostream&) {} + }; + + } + + template + struct StringMaker> { + static std::string convert(const std::tuple& tuple) { + ReusableStringStream rss; + rss << '{'; + Detail::TupleElementPrinter>::print(tuple, rss.get()); + rss << " }"; + return rss.str(); + } + }; +} +#endif // CATCH_CONFIG_ENABLE_TUPLE_STRINGMAKER + +#if defined(CATCH_CONFIG_ENABLE_VARIANT_STRINGMAKER) && defined(CATCH_CONFIG_CPP17_VARIANT) +#include +namespace Catch { + template<> + struct StringMaker { + static std::string convert(const std::monostate&) { + return "{ }"; + } + }; + + template + struct StringMaker> { + static std::string convert(const std::variant& variant) { + if (variant.valueless_by_exception()) { + return "{valueless variant}"; + } else { + return std::visit( + [](const auto& value) { + return ::Catch::Detail::stringify(value); + }, + variant + ); + } + } + }; +} +#endif // CATCH_CONFIG_ENABLE_VARIANT_STRINGMAKER + +namespace Catch { + struct not_this_one {}; // Tag type for detecting which begin/ end are being selected + + // Import begin/ end from std here so they are considered alongside the fallback (...) overloads in this namespace + using std::begin; + using std::end; + + not_this_one begin( ... ); + not_this_one end( ... ); + + template + struct is_range { + static const bool value = + !std::is_same())), not_this_one>::value && + !std::is_same())), not_this_one>::value; + }; + +#if defined(_MANAGED) // Managed types are never ranges + template + struct is_range { + static const bool value = false; + }; +#endif + + template + std::string rangeToString( Range const& range ) { + return ::Catch::Detail::rangeToString( begin( range ), end( range ) ); + } + + // Handle vector specially + template + std::string rangeToString( std::vector const& v ) { + ReusableStringStream rss; + rss << "{ "; + bool first = true; + for( bool b : v ) { + if( first ) + first = false; + else + rss << ", "; + rss << ::Catch::Detail::stringify( b ); + } + rss << " }"; + return rss.str(); + } + + template + struct StringMaker::value && !::Catch::Detail::IsStreamInsertable::value>::type> { + static std::string convert( R const& range ) { + return rangeToString( range ); + } + }; + + template + struct StringMaker { + static std::string convert(T const(&arr)[SZ]) { + return rangeToString(arr); + } + }; + +} // namespace Catch + +// Separate std::chrono::duration specialization +#if defined(CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER) +#include +#include +#include + +namespace Catch { + +template +struct ratio_string { + static std::string symbol(); +}; + +template +std::string ratio_string::symbol() { + Catch::ReusableStringStream rss; + rss << '[' << Ratio::num << '/' + << Ratio::den << ']'; + return rss.str(); +} +template <> +struct ratio_string { + static std::string symbol(); +}; +template <> +struct ratio_string { + static std::string symbol(); +}; +template <> +struct ratio_string { + static std::string symbol(); +}; +template <> +struct ratio_string { + static std::string symbol(); +}; +template <> +struct ratio_string { + static std::string symbol(); +}; +template <> +struct ratio_string { + static std::string symbol(); +}; + + //////////// + // std::chrono::duration specializations + template + struct StringMaker> { + static std::string convert(std::chrono::duration const& duration) { + ReusableStringStream rss; + rss << duration.count() << ' ' << ratio_string::symbol() << 's'; + return rss.str(); + } + }; + template + struct StringMaker>> { + static std::string convert(std::chrono::duration> const& duration) { + ReusableStringStream rss; + rss << duration.count() << " s"; + return rss.str(); + } + }; + template + struct StringMaker>> { + static std::string convert(std::chrono::duration> const& duration) { + ReusableStringStream rss; + rss << duration.count() << " m"; + return rss.str(); + } + }; + template + struct StringMaker>> { + static std::string convert(std::chrono::duration> const& duration) { + ReusableStringStream rss; + rss << duration.count() << " h"; + return rss.str(); + } + }; + + //////////// + // std::chrono::time_point specialization + // Generic time_point cannot be specialized, only std::chrono::time_point + template + struct StringMaker> { + static std::string convert(std::chrono::time_point const& time_point) { + return ::Catch::Detail::stringify(time_point.time_since_epoch()) + " since epoch"; + } + }; + // std::chrono::time_point specialization + template + struct StringMaker> { + static std::string convert(std::chrono::time_point const& time_point) { + auto converted = std::chrono::system_clock::to_time_t(time_point); + +#ifdef _MSC_VER + std::tm timeInfo = {}; + gmtime_s(&timeInfo, &converted); +#else + std::tm* timeInfo = std::gmtime(&converted); +#endif + + auto const timeStampSize = sizeof("2017-01-16T17:06:45Z"); + char timeStamp[timeStampSize]; + const char * const fmt = "%Y-%m-%dT%H:%M:%SZ"; + +#ifdef _MSC_VER + std::strftime(timeStamp, timeStampSize, fmt, &timeInfo); +#else + std::strftime(timeStamp, timeStampSize, fmt, timeInfo); +#endif + return std::string(timeStamp); + } + }; +} +#endif // CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER + +#ifdef _MSC_VER +#pragma warning(pop) +#endif + +// end catch_tostring.h +#include + +#ifdef _MSC_VER +#pragma warning(push) +#pragma warning(disable:4389) // '==' : signed/unsigned mismatch +#pragma warning(disable:4018) // more "signed/unsigned mismatch" +#pragma warning(disable:4312) // Converting int to T* using reinterpret_cast (issue on x64 platform) +#pragma warning(disable:4180) // qualifier applied to function type has no meaning +#pragma warning(disable:4800) // Forcing result to true or false +#endif + +namespace Catch { + + struct ITransientExpression { + auto isBinaryExpression() const -> bool { return m_isBinaryExpression; } + auto getResult() const -> bool { return m_result; } + virtual void streamReconstructedExpression( std::ostream &os ) const = 0; + + ITransientExpression( bool isBinaryExpression, bool result ) + : m_isBinaryExpression( isBinaryExpression ), + m_result( result ) + {} + + // We don't actually need a virtual destructor, but many static analysers + // complain if it's not here :-( + virtual ~ITransientExpression(); + + bool m_isBinaryExpression; + bool m_result; + + }; + + void formatReconstructedExpression( std::ostream &os, std::string const& lhs, StringRef op, std::string const& rhs ); + + template + class BinaryExpr : public ITransientExpression { + LhsT m_lhs; + StringRef m_op; + RhsT m_rhs; + + void streamReconstructedExpression( std::ostream &os ) const override { + formatReconstructedExpression + ( os, Catch::Detail::stringify( m_lhs ), m_op, Catch::Detail::stringify( m_rhs ) ); + } + + public: + BinaryExpr( bool comparisonResult, LhsT lhs, StringRef op, RhsT rhs ) + : ITransientExpression{ true, comparisonResult }, + m_lhs( lhs ), + m_op( op ), + m_rhs( rhs ) + {} + + template + auto operator && ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator || ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator == ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator != ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator > ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator < ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator >= ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator <= ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + }; + + template + class UnaryExpr : public ITransientExpression { + LhsT m_lhs; + + void streamReconstructedExpression( std::ostream &os ) const override { + os << Catch::Detail::stringify( m_lhs ); + } + + public: + explicit UnaryExpr( LhsT lhs ) + : ITransientExpression{ false, static_cast(lhs) }, + m_lhs( lhs ) + {} + }; + + // Specialised comparison functions to handle equality comparisons between ints and pointers (NULL deduces as an int) + template + auto compareEqual( LhsT const& lhs, RhsT const& rhs ) -> bool { return static_cast(lhs == rhs); } + template + auto compareEqual( T* const& lhs, int rhs ) -> bool { return lhs == reinterpret_cast( rhs ); } + template + auto compareEqual( T* const& lhs, long rhs ) -> bool { return lhs == reinterpret_cast( rhs ); } + template + auto compareEqual( int lhs, T* const& rhs ) -> bool { return reinterpret_cast( lhs ) == rhs; } + template + auto compareEqual( long lhs, T* const& rhs ) -> bool { return reinterpret_cast( lhs ) == rhs; } + + template + auto compareNotEqual( LhsT const& lhs, RhsT&& rhs ) -> bool { return static_cast(lhs != rhs); } + template + auto compareNotEqual( T* const& lhs, int rhs ) -> bool { return lhs != reinterpret_cast( rhs ); } + template + auto compareNotEqual( T* const& lhs, long rhs ) -> bool { return lhs != reinterpret_cast( rhs ); } + template + auto compareNotEqual( int lhs, T* const& rhs ) -> bool { return reinterpret_cast( lhs ) != rhs; } + template + auto compareNotEqual( long lhs, T* const& rhs ) -> bool { return reinterpret_cast( lhs ) != rhs; } + + template + class ExprLhs { + LhsT m_lhs; + public: + explicit ExprLhs( LhsT lhs ) : m_lhs( lhs ) {} + + template + auto operator == ( RhsT const& rhs ) -> BinaryExpr const { + return { compareEqual( m_lhs, rhs ), m_lhs, "==", rhs }; + } + auto operator == ( bool rhs ) -> BinaryExpr const { + return { m_lhs == rhs, m_lhs, "==", rhs }; + } + + template + auto operator != ( RhsT const& rhs ) -> BinaryExpr const { + return { compareNotEqual( m_lhs, rhs ), m_lhs, "!=", rhs }; + } + auto operator != ( bool rhs ) -> BinaryExpr const { + return { m_lhs != rhs, m_lhs, "!=", rhs }; + } + + template + auto operator > ( RhsT const& rhs ) -> BinaryExpr const { + return { static_cast(m_lhs > rhs), m_lhs, ">", rhs }; + } + template + auto operator < ( RhsT const& rhs ) -> BinaryExpr const { + return { static_cast(m_lhs < rhs), m_lhs, "<", rhs }; + } + template + auto operator >= ( RhsT const& rhs ) -> BinaryExpr const { + return { static_cast(m_lhs >= rhs), m_lhs, ">=", rhs }; + } + template + auto operator <= ( RhsT const& rhs ) -> BinaryExpr const { + return { static_cast(m_lhs <= rhs), m_lhs, "<=", rhs }; + } + + template + auto operator && ( RhsT const& ) -> BinaryExpr const { + static_assert(always_false::value, + "operator&& is not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator || ( RhsT const& ) -> BinaryExpr const { + static_assert(always_false::value, + "operator|| is not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + auto makeUnaryExpr() const -> UnaryExpr { + return UnaryExpr{ m_lhs }; + } + }; + + void handleExpression( ITransientExpression const& expr ); + + template + void handleExpression( ExprLhs const& expr ) { + handleExpression( expr.makeUnaryExpr() ); + } + + struct Decomposer { + template + auto operator <= ( T const& lhs ) -> ExprLhs { + return ExprLhs{ lhs }; + } + + auto operator <=( bool value ) -> ExprLhs { + return ExprLhs{ value }; + } + }; + +} // end namespace Catch + +#ifdef _MSC_VER +#pragma warning(pop) +#endif + +// end catch_decomposer.h +// start catch_interfaces_capture.h + +#include + +namespace Catch { + + class AssertionResult; + struct AssertionInfo; + struct SectionInfo; + struct SectionEndInfo; + struct MessageInfo; + struct MessageBuilder; + struct Counts; + struct BenchmarkInfo; + struct BenchmarkStats; + struct AssertionReaction; + struct SourceLineInfo; + + struct ITransientExpression; + struct IGeneratorTracker; + + struct IResultCapture { + + virtual ~IResultCapture(); + + virtual bool sectionStarted( SectionInfo const& sectionInfo, + Counts& assertions ) = 0; + virtual void sectionEnded( SectionEndInfo const& endInfo ) = 0; + virtual void sectionEndedEarly( SectionEndInfo const& endInfo ) = 0; + + virtual auto acquireGeneratorTracker( SourceLineInfo const& lineInfo ) -> IGeneratorTracker& = 0; + + virtual void benchmarkStarting( BenchmarkInfo const& info ) = 0; + virtual void benchmarkEnded( BenchmarkStats const& stats ) = 0; + + virtual void pushScopedMessage( MessageInfo const& message ) = 0; + virtual void popScopedMessage( MessageInfo const& message ) = 0; + + virtual void emplaceUnscopedMessage( MessageBuilder const& builder ) = 0; + + virtual void handleFatalErrorCondition( StringRef message ) = 0; + + virtual void handleExpr + ( AssertionInfo const& info, + ITransientExpression const& expr, + AssertionReaction& reaction ) = 0; + virtual void handleMessage + ( AssertionInfo const& info, + ResultWas::OfType resultType, + StringRef const& message, + AssertionReaction& reaction ) = 0; + virtual void handleUnexpectedExceptionNotThrown + ( AssertionInfo const& info, + AssertionReaction& reaction ) = 0; + virtual void handleUnexpectedInflightException + ( AssertionInfo const& info, + std::string const& message, + AssertionReaction& reaction ) = 0; + virtual void handleIncomplete + ( AssertionInfo const& info ) = 0; + virtual void handleNonExpr + ( AssertionInfo const &info, + ResultWas::OfType resultType, + AssertionReaction &reaction ) = 0; + + virtual bool lastAssertionPassed() = 0; + virtual void assertionPassed() = 0; + + // Deprecated, do not use: + virtual std::string getCurrentTestName() const = 0; + virtual const AssertionResult* getLastResult() const = 0; + virtual void exceptionEarlyReported() = 0; + }; + + IResultCapture& getResultCapture(); +} + +// end catch_interfaces_capture.h +namespace Catch { + + struct TestFailureException{}; + struct AssertionResultData; + struct IResultCapture; + class RunContext; + + class LazyExpression { + friend class AssertionHandler; + friend struct AssertionStats; + friend class RunContext; + + ITransientExpression const* m_transientExpression = nullptr; + bool m_isNegated; + public: + LazyExpression( bool isNegated ); + LazyExpression( LazyExpression const& other ); + LazyExpression& operator = ( LazyExpression const& ) = delete; + + explicit operator bool() const; + + friend auto operator << ( std::ostream& os, LazyExpression const& lazyExpr ) -> std::ostream&; + }; + + struct AssertionReaction { + bool shouldDebugBreak = false; + bool shouldThrow = false; + }; + + class AssertionHandler { + AssertionInfo m_assertionInfo; + AssertionReaction m_reaction; + bool m_completed = false; + IResultCapture& m_resultCapture; + + public: + AssertionHandler + ( StringRef const& macroName, + SourceLineInfo const& lineInfo, + StringRef capturedExpression, + ResultDisposition::Flags resultDisposition ); + ~AssertionHandler() { + if ( !m_completed ) { + m_resultCapture.handleIncomplete( m_assertionInfo ); + } + } + + template + void handleExpr( ExprLhs const& expr ) { + handleExpr( expr.makeUnaryExpr() ); + } + void handleExpr( ITransientExpression const& expr ); + + void handleMessage(ResultWas::OfType resultType, StringRef const& message); + + void handleExceptionThrownAsExpected(); + void handleUnexpectedExceptionNotThrown(); + void handleExceptionNotThrownAsExpected(); + void handleThrowingCallSkipped(); + void handleUnexpectedInflightException(); + + void complete(); + void setCompleted(); + + // query + auto allowThrows() const -> bool; + }; + + void handleExceptionMatchExpr( AssertionHandler& handler, std::string const& str, StringRef const& matcherString ); + +} // namespace Catch + +// end catch_assertionhandler.h +// start catch_message.h + +#include +#include + +namespace Catch { + + struct MessageInfo { + MessageInfo( StringRef const& _macroName, + SourceLineInfo const& _lineInfo, + ResultWas::OfType _type ); + + StringRef macroName; + std::string message; + SourceLineInfo lineInfo; + ResultWas::OfType type; + unsigned int sequence; + + bool operator == ( MessageInfo const& other ) const; + bool operator < ( MessageInfo const& other ) const; + private: + static unsigned int globalCount; + }; + + struct MessageStream { + + template + MessageStream& operator << ( T const& value ) { + m_stream << value; + return *this; + } + + ReusableStringStream m_stream; + }; + + struct MessageBuilder : MessageStream { + MessageBuilder( StringRef const& macroName, + SourceLineInfo const& lineInfo, + ResultWas::OfType type ); + + template + MessageBuilder& operator << ( T const& value ) { + m_stream << value; + return *this; + } + + MessageInfo m_info; + }; + + class ScopedMessage { + public: + explicit ScopedMessage( MessageBuilder const& builder ); + ScopedMessage( ScopedMessage& duplicate ) = delete; + ScopedMessage( ScopedMessage&& old ); + ~ScopedMessage(); + + MessageInfo m_info; + bool m_moved; + }; + + class Capturer { + std::vector m_messages; + IResultCapture& m_resultCapture = getResultCapture(); + size_t m_captured = 0; + public: + Capturer( StringRef macroName, SourceLineInfo const& lineInfo, ResultWas::OfType resultType, StringRef names ); + ~Capturer(); + + void captureValue( size_t index, std::string const& value ); + + template + void captureValues( size_t index, T const& value ) { + captureValue( index, Catch::Detail::stringify( value ) ); + } + + template + void captureValues( size_t index, T const& value, Ts const&... values ) { + captureValue( index, Catch::Detail::stringify(value) ); + captureValues( index+1, values... ); + } + }; + +} // end namespace Catch + +// end catch_message.h +#if !defined(CATCH_CONFIG_DISABLE) + +#if !defined(CATCH_CONFIG_DISABLE_STRINGIFICATION) + #define CATCH_INTERNAL_STRINGIFY(...) #__VA_ARGS__ +#else + #define CATCH_INTERNAL_STRINGIFY(...) "Disabled by CATCH_CONFIG_DISABLE_STRINGIFICATION" +#endif + +#if defined(CATCH_CONFIG_FAST_COMPILE) || defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) + +/////////////////////////////////////////////////////////////////////////////// +// Another way to speed-up compilation is to omit local try-catch for REQUIRE* +// macros. +#define INTERNAL_CATCH_TRY +#define INTERNAL_CATCH_CATCH( capturer ) + +#else // CATCH_CONFIG_FAST_COMPILE + +#define INTERNAL_CATCH_TRY try +#define INTERNAL_CATCH_CATCH( handler ) catch(...) { handler.handleUnexpectedInflightException(); } + +#endif + +#define INTERNAL_CATCH_REACT( handler ) handler.complete(); + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_TEST( macroName, resultDisposition, ... ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, CATCH_INTERNAL_STRINGIFY(__VA_ARGS__), resultDisposition ); \ + INTERNAL_CATCH_TRY { \ + CATCH_INTERNAL_SUPPRESS_PARENTHESES_WARNINGS \ + catchAssertionHandler.handleExpr( Catch::Decomposer() <= __VA_ARGS__ ); \ + CATCH_INTERNAL_UNSUPPRESS_PARENTHESES_WARNINGS \ + } INTERNAL_CATCH_CATCH( catchAssertionHandler ) \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( (void)0, (false) && static_cast( !!(__VA_ARGS__) ) ) // the expression here is never evaluated at runtime but it forces the compiler to give it a look + // The double negation silences MSVC's C4800 warning, the static_cast forces short-circuit evaluation if the type has overloaded &&. + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_IF( macroName, resultDisposition, ... ) \ + INTERNAL_CATCH_TEST( macroName, resultDisposition, __VA_ARGS__ ); \ + if( Catch::getResultCapture().lastAssertionPassed() ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_ELSE( macroName, resultDisposition, ... ) \ + INTERNAL_CATCH_TEST( macroName, resultDisposition, __VA_ARGS__ ); \ + if( !Catch::getResultCapture().lastAssertionPassed() ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_NO_THROW( macroName, resultDisposition, ... ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, CATCH_INTERNAL_STRINGIFY(__VA_ARGS__), resultDisposition ); \ + try { \ + static_cast(__VA_ARGS__); \ + catchAssertionHandler.handleExceptionNotThrownAsExpected(); \ + } \ + catch( ... ) { \ + catchAssertionHandler.handleUnexpectedInflightException(); \ + } \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( false ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_THROWS( macroName, resultDisposition, ... ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, CATCH_INTERNAL_STRINGIFY(__VA_ARGS__), resultDisposition); \ + if( catchAssertionHandler.allowThrows() ) \ + try { \ + static_cast(__VA_ARGS__); \ + catchAssertionHandler.handleUnexpectedExceptionNotThrown(); \ + } \ + catch( ... ) { \ + catchAssertionHandler.handleExceptionThrownAsExpected(); \ + } \ + else \ + catchAssertionHandler.handleThrowingCallSkipped(); \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( false ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_THROWS_AS( macroName, exceptionType, resultDisposition, expr ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, CATCH_INTERNAL_STRINGIFY(expr) ", " CATCH_INTERNAL_STRINGIFY(exceptionType), resultDisposition ); \ + if( catchAssertionHandler.allowThrows() ) \ + try { \ + static_cast(expr); \ + catchAssertionHandler.handleUnexpectedExceptionNotThrown(); \ + } \ + catch( exceptionType const& ) { \ + catchAssertionHandler.handleExceptionThrownAsExpected(); \ + } \ + catch( ... ) { \ + catchAssertionHandler.handleUnexpectedInflightException(); \ + } \ + else \ + catchAssertionHandler.handleThrowingCallSkipped(); \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( false ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_MSG( macroName, messageType, resultDisposition, ... ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, Catch::StringRef(), resultDisposition ); \ + catchAssertionHandler.handleMessage( messageType, ( Catch::MessageStream() << __VA_ARGS__ + ::Catch::StreamEndStop() ).m_stream.str() ); \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( false ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_CAPTURE( varName, macroName, ... ) \ + auto varName = Catch::Capturer( macroName, CATCH_INTERNAL_LINEINFO, Catch::ResultWas::Info, #__VA_ARGS__ ); \ + varName.captureValues( 0, __VA_ARGS__ ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_INFO( macroName, log ) \ + Catch::ScopedMessage INTERNAL_CATCH_UNIQUE_NAME( scopedMessage )( Catch::MessageBuilder( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, Catch::ResultWas::Info ) << log ); + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_UNSCOPED_INFO( macroName, log ) \ + Catch::getResultCapture().emplaceUnscopedMessage( Catch::MessageBuilder( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, Catch::ResultWas::Info ) << log ) + +/////////////////////////////////////////////////////////////////////////////// +// Although this is matcher-based, it can be used with just a string +#define INTERNAL_CATCH_THROWS_STR_MATCHES( macroName, resultDisposition, matcher, ... ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, CATCH_INTERNAL_STRINGIFY(__VA_ARGS__) ", " CATCH_INTERNAL_STRINGIFY(matcher), resultDisposition ); \ + if( catchAssertionHandler.allowThrows() ) \ + try { \ + static_cast(__VA_ARGS__); \ + catchAssertionHandler.handleUnexpectedExceptionNotThrown(); \ + } \ + catch( ... ) { \ + Catch::handleExceptionMatchExpr( catchAssertionHandler, matcher, #matcher##_catch_sr ); \ + } \ + else \ + catchAssertionHandler.handleThrowingCallSkipped(); \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( false ) + +#endif // CATCH_CONFIG_DISABLE + +// end catch_capture.hpp +// start catch_section.h + +// start catch_section_info.h + +// start catch_totals.h + +#include + +namespace Catch { + + struct Counts { + Counts operator - ( Counts const& other ) const; + Counts& operator += ( Counts const& other ); + + std::size_t total() const; + bool allPassed() const; + bool allOk() const; + + std::size_t passed = 0; + std::size_t failed = 0; + std::size_t failedButOk = 0; + }; + + struct Totals { + + Totals operator - ( Totals const& other ) const; + Totals& operator += ( Totals const& other ); + + Totals delta( Totals const& prevTotals ) const; + + int error = 0; + Counts assertions; + Counts testCases; + }; +} + +// end catch_totals.h +#include + +namespace Catch { + + struct SectionInfo { + SectionInfo + ( SourceLineInfo const& _lineInfo, + std::string const& _name ); + + // Deprecated + SectionInfo + ( SourceLineInfo const& _lineInfo, + std::string const& _name, + std::string const& ) : SectionInfo( _lineInfo, _name ) {} + + std::string name; + std::string description; // !Deprecated: this will always be empty + SourceLineInfo lineInfo; + }; + + struct SectionEndInfo { + SectionInfo sectionInfo; + Counts prevAssertions; + double durationInSeconds; + }; + +} // end namespace Catch + +// end catch_section_info.h +// start catch_timer.h + +#include + +namespace Catch { + + auto getCurrentNanosecondsSinceEpoch() -> uint64_t; + auto getEstimatedClockResolution() -> uint64_t; + + class Timer { + uint64_t m_nanoseconds = 0; + public: + void start(); + auto getElapsedNanoseconds() const -> uint64_t; + auto getElapsedMicroseconds() const -> uint64_t; + auto getElapsedMilliseconds() const -> unsigned int; + auto getElapsedSeconds() const -> double; + }; + +} // namespace Catch + +// end catch_timer.h +#include + +namespace Catch { + + class Section : NonCopyable { + public: + Section( SectionInfo const& info ); + ~Section(); + + // This indicates whether the section should be executed or not + explicit operator bool() const; + + private: + SectionInfo m_info; + + std::string m_name; + Counts m_assertions; + bool m_sectionIncluded; + Timer m_timer; + }; + +} // end namespace Catch + +#define INTERNAL_CATCH_SECTION( ... ) \ + CATCH_INTERNAL_SUPPRESS_UNUSED_WARNINGS \ + if( Catch::Section const& INTERNAL_CATCH_UNIQUE_NAME( catch_internal_Section ) = Catch::SectionInfo( CATCH_INTERNAL_LINEINFO, __VA_ARGS__ ) ) \ + CATCH_INTERNAL_UNSUPPRESS_UNUSED_WARNINGS + +#define INTERNAL_CATCH_DYNAMIC_SECTION( ... ) \ + CATCH_INTERNAL_SUPPRESS_UNUSED_WARNINGS \ + if( Catch::Section const& INTERNAL_CATCH_UNIQUE_NAME( catch_internal_Section ) = Catch::SectionInfo( CATCH_INTERNAL_LINEINFO, (Catch::ReusableStringStream() << __VA_ARGS__).str() ) ) \ + CATCH_INTERNAL_UNSUPPRESS_UNUSED_WARNINGS + +// end catch_section.h +// start catch_benchmark.h + +#include +#include + +namespace Catch { + + class BenchmarkLooper { + + std::string m_name; + std::size_t m_count = 0; + std::size_t m_iterationsToRun = 1; + uint64_t m_resolution; + Timer m_timer; + + static auto getResolution() -> uint64_t; + public: + // Keep most of this inline as it's on the code path that is being timed + BenchmarkLooper( StringRef name ) + : m_name( name ), + m_resolution( getResolution() ) + { + reportStart(); + m_timer.start(); + } + + explicit operator bool() { + if( m_count < m_iterationsToRun ) + return true; + return needsMoreIterations(); + } + + void increment() { + ++m_count; + } + + void reportStart(); + auto needsMoreIterations() -> bool; + }; + +} // end namespace Catch + +#define BENCHMARK( name ) \ + for( Catch::BenchmarkLooper looper( name ); looper; looper.increment() ) + +// end catch_benchmark.h +// start catch_interfaces_exception.h + +// start catch_interfaces_registry_hub.h + +#include +#include + +namespace Catch { + + class TestCase; + struct ITestCaseRegistry; + struct IExceptionTranslatorRegistry; + struct IExceptionTranslator; + struct IReporterRegistry; + struct IReporterFactory; + struct ITagAliasRegistry; + class StartupExceptionRegistry; + + using IReporterFactoryPtr = std::shared_ptr; + + struct IRegistryHub { + virtual ~IRegistryHub(); + + virtual IReporterRegistry const& getReporterRegistry() const = 0; + virtual ITestCaseRegistry const& getTestCaseRegistry() const = 0; + virtual ITagAliasRegistry const& getTagAliasRegistry() const = 0; + + virtual IExceptionTranslatorRegistry const& getExceptionTranslatorRegistry() const = 0; + + virtual StartupExceptionRegistry const& getStartupExceptionRegistry() const = 0; + }; + + struct IMutableRegistryHub { + virtual ~IMutableRegistryHub(); + virtual void registerReporter( std::string const& name, IReporterFactoryPtr const& factory ) = 0; + virtual void registerListener( IReporterFactoryPtr const& factory ) = 0; + virtual void registerTest( TestCase const& testInfo ) = 0; + virtual void registerTranslator( const IExceptionTranslator* translator ) = 0; + virtual void registerTagAlias( std::string const& alias, std::string const& tag, SourceLineInfo const& lineInfo ) = 0; + virtual void registerStartupException() noexcept = 0; + }; + + IRegistryHub const& getRegistryHub(); + IMutableRegistryHub& getMutableRegistryHub(); + void cleanUp(); + std::string translateActiveException(); + +} + +// end catch_interfaces_registry_hub.h +#if defined(CATCH_CONFIG_DISABLE) + #define INTERNAL_CATCH_TRANSLATE_EXCEPTION_NO_REG( translatorName, signature) \ + static std::string translatorName( signature ) +#endif + +#include +#include +#include + +namespace Catch { + using exceptionTranslateFunction = std::string(*)(); + + struct IExceptionTranslator; + using ExceptionTranslators = std::vector>; + + struct IExceptionTranslator { + virtual ~IExceptionTranslator(); + virtual std::string translate( ExceptionTranslators::const_iterator it, ExceptionTranslators::const_iterator itEnd ) const = 0; + }; + + struct IExceptionTranslatorRegistry { + virtual ~IExceptionTranslatorRegistry(); + + virtual std::string translateActiveException() const = 0; + }; + + class ExceptionTranslatorRegistrar { + template + class ExceptionTranslator : public IExceptionTranslator { + public: + + ExceptionTranslator( std::string(*translateFunction)( T& ) ) + : m_translateFunction( translateFunction ) + {} + + std::string translate( ExceptionTranslators::const_iterator it, ExceptionTranslators::const_iterator itEnd ) const override { + try { + if( it == itEnd ) + std::rethrow_exception(std::current_exception()); + else + return (*it)->translate( it+1, itEnd ); + } + catch( T& ex ) { + return m_translateFunction( ex ); + } + } + + protected: + std::string(*m_translateFunction)( T& ); + }; + + public: + template + ExceptionTranslatorRegistrar( std::string(*translateFunction)( T& ) ) { + getMutableRegistryHub().registerTranslator + ( new ExceptionTranslator( translateFunction ) ); + } + }; +} + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_TRANSLATE_EXCEPTION2( translatorName, signature ) \ + static std::string translatorName( signature ); \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ Catch::ExceptionTranslatorRegistrar INTERNAL_CATCH_UNIQUE_NAME( catch_internal_ExceptionRegistrar )( &translatorName ); } \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS \ + static std::string translatorName( signature ) + +#define INTERNAL_CATCH_TRANSLATE_EXCEPTION( signature ) INTERNAL_CATCH_TRANSLATE_EXCEPTION2( INTERNAL_CATCH_UNIQUE_NAME( catch_internal_ExceptionTranslator ), signature ) + +// end catch_interfaces_exception.h +// start catch_approx.h + +#include + +namespace Catch { +namespace Detail { + + class Approx { + private: + bool equalityComparisonImpl(double other) const; + // Validates the new margin (margin >= 0) + // out-of-line to avoid including stdexcept in the header + void setMargin(double margin); + // Validates the new epsilon (0 < epsilon < 1) + // out-of-line to avoid including stdexcept in the header + void setEpsilon(double epsilon); + + public: + explicit Approx ( double value ); + + static Approx custom(); + + Approx operator-() const; + + template ::value>::type> + Approx operator()( T const& value ) { + Approx approx( static_cast(value) ); + approx.m_epsilon = m_epsilon; + approx.m_margin = m_margin; + approx.m_scale = m_scale; + return approx; + } + + template ::value>::type> + explicit Approx( T const& value ): Approx(static_cast(value)) + {} + + template ::value>::type> + friend bool operator == ( const T& lhs, Approx const& rhs ) { + auto lhs_v = static_cast(lhs); + return rhs.equalityComparisonImpl(lhs_v); + } + + template ::value>::type> + friend bool operator == ( Approx const& lhs, const T& rhs ) { + return operator==( rhs, lhs ); + } + + template ::value>::type> + friend bool operator != ( T const& lhs, Approx const& rhs ) { + return !operator==( lhs, rhs ); + } + + template ::value>::type> + friend bool operator != ( Approx const& lhs, T const& rhs ) { + return !operator==( rhs, lhs ); + } + + template ::value>::type> + friend bool operator <= ( T const& lhs, Approx const& rhs ) { + return static_cast(lhs) < rhs.m_value || lhs == rhs; + } + + template ::value>::type> + friend bool operator <= ( Approx const& lhs, T const& rhs ) { + return lhs.m_value < static_cast(rhs) || lhs == rhs; + } + + template ::value>::type> + friend bool operator >= ( T const& lhs, Approx const& rhs ) { + return static_cast(lhs) > rhs.m_value || lhs == rhs; + } + + template ::value>::type> + friend bool operator >= ( Approx const& lhs, T const& rhs ) { + return lhs.m_value > static_cast(rhs) || lhs == rhs; + } + + template ::value>::type> + Approx& epsilon( T const& newEpsilon ) { + double epsilonAsDouble = static_cast(newEpsilon); + setEpsilon(epsilonAsDouble); + return *this; + } + + template ::value>::type> + Approx& margin( T const& newMargin ) { + double marginAsDouble = static_cast(newMargin); + setMargin(marginAsDouble); + return *this; + } + + template ::value>::type> + Approx& scale( T const& newScale ) { + m_scale = static_cast(newScale); + return *this; + } + + std::string toString() const; + + private: + double m_epsilon; + double m_margin; + double m_scale; + double m_value; + }; +} // end namespace Detail + +namespace literals { + Detail::Approx operator "" _a(long double val); + Detail::Approx operator "" _a(unsigned long long val); +} // end namespace literals + +template<> +struct StringMaker { + static std::string convert(Catch::Detail::Approx const& value); +}; + +} // end namespace Catch + +// end catch_approx.h +// start catch_string_manip.h + +#include +#include + +namespace Catch { + + bool startsWith( std::string const& s, std::string const& prefix ); + bool startsWith( std::string const& s, char prefix ); + bool endsWith( std::string const& s, std::string const& suffix ); + bool endsWith( std::string const& s, char suffix ); + bool contains( std::string const& s, std::string const& infix ); + void toLowerInPlace( std::string& s ); + std::string toLower( std::string const& s ); + std::string trim( std::string const& str ); + bool replaceInPlace( std::string& str, std::string const& replaceThis, std::string const& withThis ); + + struct pluralise { + pluralise( std::size_t count, std::string const& label ); + + friend std::ostream& operator << ( std::ostream& os, pluralise const& pluraliser ); + + std::size_t m_count; + std::string m_label; + }; +} + +// end catch_string_manip.h +#ifndef CATCH_CONFIG_DISABLE_MATCHERS +// start catch_capture_matchers.h + +// start catch_matchers.h + +#include +#include + +namespace Catch { +namespace Matchers { + namespace Impl { + + template struct MatchAllOf; + template struct MatchAnyOf; + template struct MatchNotOf; + + class MatcherUntypedBase { + public: + MatcherUntypedBase() = default; + MatcherUntypedBase ( MatcherUntypedBase const& ) = default; + MatcherUntypedBase& operator = ( MatcherUntypedBase const& ) = delete; + std::string toString() const; + + protected: + virtual ~MatcherUntypedBase(); + virtual std::string describe() const = 0; + mutable std::string m_cachedToString; + }; + +#ifdef __clang__ +# pragma clang diagnostic push +# pragma clang diagnostic ignored "-Wnon-virtual-dtor" +#endif + + template + struct MatcherMethod { + virtual bool match( ObjectT const& arg ) const = 0; + }; + +#ifdef __clang__ +# pragma clang diagnostic pop +#endif + + template + struct MatcherBase : MatcherUntypedBase, MatcherMethod { + + MatchAllOf operator && ( MatcherBase const& other ) const; + MatchAnyOf operator || ( MatcherBase const& other ) const; + MatchNotOf operator ! () const; + }; + + template + struct MatchAllOf : MatcherBase { + bool match( ArgT const& arg ) const override { + for( auto matcher : m_matchers ) { + if (!matcher->match(arg)) + return false; + } + return true; + } + std::string describe() const override { + std::string description; + description.reserve( 4 + m_matchers.size()*32 ); + description += "( "; + bool first = true; + for( auto matcher : m_matchers ) { + if( first ) + first = false; + else + description += " and "; + description += matcher->toString(); + } + description += " )"; + return description; + } + + MatchAllOf& operator && ( MatcherBase const& other ) { + m_matchers.push_back( &other ); + return *this; + } + + std::vector const*> m_matchers; + }; + template + struct MatchAnyOf : MatcherBase { + + bool match( ArgT const& arg ) const override { + for( auto matcher : m_matchers ) { + if (matcher->match(arg)) + return true; + } + return false; + } + std::string describe() const override { + std::string description; + description.reserve( 4 + m_matchers.size()*32 ); + description += "( "; + bool first = true; + for( auto matcher : m_matchers ) { + if( first ) + first = false; + else + description += " or "; + description += matcher->toString(); + } + description += " )"; + return description; + } + + MatchAnyOf& operator || ( MatcherBase const& other ) { + m_matchers.push_back( &other ); + return *this; + } + + std::vector const*> m_matchers; + }; + + template + struct MatchNotOf : MatcherBase { + + MatchNotOf( MatcherBase const& underlyingMatcher ) : m_underlyingMatcher( underlyingMatcher ) {} + + bool match( ArgT const& arg ) const override { + return !m_underlyingMatcher.match( arg ); + } + + std::string describe() const override { + return "not " + m_underlyingMatcher.toString(); + } + MatcherBase const& m_underlyingMatcher; + }; + + template + MatchAllOf MatcherBase::operator && ( MatcherBase const& other ) const { + return MatchAllOf() && *this && other; + } + template + MatchAnyOf MatcherBase::operator || ( MatcherBase const& other ) const { + return MatchAnyOf() || *this || other; + } + template + MatchNotOf MatcherBase::operator ! () const { + return MatchNotOf( *this ); + } + + } // namespace Impl + +} // namespace Matchers + +using namespace Matchers; +using Matchers::Impl::MatcherBase; + +} // namespace Catch + +// end catch_matchers.h +// start catch_matchers_floating.h + +#include +#include + +namespace Catch { +namespace Matchers { + + namespace Floating { + + enum class FloatingPointKind : uint8_t; + + struct WithinAbsMatcher : MatcherBase { + WithinAbsMatcher(double target, double margin); + bool match(double const& matchee) const override; + std::string describe() const override; + private: + double m_target; + double m_margin; + }; + + struct WithinUlpsMatcher : MatcherBase { + WithinUlpsMatcher(double target, int ulps, FloatingPointKind baseType); + bool match(double const& matchee) const override; + std::string describe() const override; + private: + double m_target; + int m_ulps; + FloatingPointKind m_type; + }; + + } // namespace Floating + + // The following functions create the actual matcher objects. + // This allows the types to be inferred + Floating::WithinUlpsMatcher WithinULP(double target, int maxUlpDiff); + Floating::WithinUlpsMatcher WithinULP(float target, int maxUlpDiff); + Floating::WithinAbsMatcher WithinAbs(double target, double margin); + +} // namespace Matchers +} // namespace Catch + +// end catch_matchers_floating.h +// start catch_matchers_generic.hpp + +#include +#include + +namespace Catch { +namespace Matchers { +namespace Generic { + +namespace Detail { + std::string finalizeDescription(const std::string& desc); +} + +template +class PredicateMatcher : public MatcherBase { + std::function m_predicate; + std::string m_description; +public: + + PredicateMatcher(std::function const& elem, std::string const& descr) + :m_predicate(std::move(elem)), + m_description(Detail::finalizeDescription(descr)) + {} + + bool match( T const& item ) const override { + return m_predicate(item); + } + + std::string describe() const override { + return m_description; + } +}; + +} // namespace Generic + + // The following functions create the actual matcher objects. + // The user has to explicitly specify type to the function, because + // infering std::function is hard (but possible) and + // requires a lot of TMP. + template + Generic::PredicateMatcher Predicate(std::function const& predicate, std::string const& description = "") { + return Generic::PredicateMatcher(predicate, description); + } + +} // namespace Matchers +} // namespace Catch + +// end catch_matchers_generic.hpp +// start catch_matchers_string.h + +#include + +namespace Catch { +namespace Matchers { + + namespace StdString { + + struct CasedString + { + CasedString( std::string const& str, CaseSensitive::Choice caseSensitivity ); + std::string adjustString( std::string const& str ) const; + std::string caseSensitivitySuffix() const; + + CaseSensitive::Choice m_caseSensitivity; + std::string m_str; + }; + + struct StringMatcherBase : MatcherBase { + StringMatcherBase( std::string const& operation, CasedString const& comparator ); + std::string describe() const override; + + CasedString m_comparator; + std::string m_operation; + }; + + struct EqualsMatcher : StringMatcherBase { + EqualsMatcher( CasedString const& comparator ); + bool match( std::string const& source ) const override; + }; + struct ContainsMatcher : StringMatcherBase { + ContainsMatcher( CasedString const& comparator ); + bool match( std::string const& source ) const override; + }; + struct StartsWithMatcher : StringMatcherBase { + StartsWithMatcher( CasedString const& comparator ); + bool match( std::string const& source ) const override; + }; + struct EndsWithMatcher : StringMatcherBase { + EndsWithMatcher( CasedString const& comparator ); + bool match( std::string const& source ) const override; + }; + + struct RegexMatcher : MatcherBase { + RegexMatcher( std::string regex, CaseSensitive::Choice caseSensitivity ); + bool match( std::string const& matchee ) const override; + std::string describe() const override; + + private: + std::string m_regex; + CaseSensitive::Choice m_caseSensitivity; + }; + + } // namespace StdString + + // The following functions create the actual matcher objects. + // This allows the types to be inferred + + StdString::EqualsMatcher Equals( std::string const& str, CaseSensitive::Choice caseSensitivity = CaseSensitive::Yes ); + StdString::ContainsMatcher Contains( std::string const& str, CaseSensitive::Choice caseSensitivity = CaseSensitive::Yes ); + StdString::EndsWithMatcher EndsWith( std::string const& str, CaseSensitive::Choice caseSensitivity = CaseSensitive::Yes ); + StdString::StartsWithMatcher StartsWith( std::string const& str, CaseSensitive::Choice caseSensitivity = CaseSensitive::Yes ); + StdString::RegexMatcher Matches( std::string const& regex, CaseSensitive::Choice caseSensitivity = CaseSensitive::Yes ); + +} // namespace Matchers +} // namespace Catch + +// end catch_matchers_string.h +// start catch_matchers_vector.h + +#include + +namespace Catch { +namespace Matchers { + + namespace Vector { + namespace Detail { + template + size_t count(InputIterator first, InputIterator last, T const& item) { + size_t cnt = 0; + for (; first != last; ++first) { + if (*first == item) { + ++cnt; + } + } + return cnt; + } + template + bool contains(InputIterator first, InputIterator last, T const& item) { + for (; first != last; ++first) { + if (*first == item) { + return true; + } + } + return false; + } + } + + template + struct ContainsElementMatcher : MatcherBase> { + + ContainsElementMatcher(T const &comparator) : m_comparator( comparator) {} + + bool match(std::vector const &v) const override { + for (auto const& el : v) { + if (el == m_comparator) { + return true; + } + } + return false; + } + + std::string describe() const override { + return "Contains: " + ::Catch::Detail::stringify( m_comparator ); + } + + T const& m_comparator; + }; + + template + struct ContainsMatcher : MatcherBase> { + + ContainsMatcher(std::vector const &comparator) : m_comparator( comparator ) {} + + bool match(std::vector const &v) const override { + // !TBD: see note in EqualsMatcher + if (m_comparator.size() > v.size()) + return false; + for (auto const& comparator : m_comparator) { + auto present = false; + for (const auto& el : v) { + if (el == comparator) { + present = true; + break; + } + } + if (!present) { + return false; + } + } + return true; + } + std::string describe() const override { + return "Contains: " + ::Catch::Detail::stringify( m_comparator ); + } + + std::vector const& m_comparator; + }; + + template + struct EqualsMatcher : MatcherBase> { + + EqualsMatcher(std::vector const &comparator) : m_comparator( comparator ) {} + + bool match(std::vector const &v) const override { + // !TBD: This currently works if all elements can be compared using != + // - a more general approach would be via a compare template that defaults + // to using !=. but could be specialised for, e.g. std::vector etc + // - then just call that directly + if (m_comparator.size() != v.size()) + return false; + for (std::size_t i = 0; i < v.size(); ++i) + if (m_comparator[i] != v[i]) + return false; + return true; + } + std::string describe() const override { + return "Equals: " + ::Catch::Detail::stringify( m_comparator ); + } + std::vector const& m_comparator; + }; + + template + struct UnorderedEqualsMatcher : MatcherBase> { + UnorderedEqualsMatcher(std::vector const& target) : m_target(target) {} + bool match(std::vector const& vec) const override { + // Note: This is a reimplementation of std::is_permutation, + // because I don't want to include inside the common path + if (m_target.size() != vec.size()) { + return false; + } + auto lfirst = m_target.begin(), llast = m_target.end(); + auto rfirst = vec.begin(), rlast = vec.end(); + // Cut common prefix to optimize checking of permuted parts + while (lfirst != llast && *lfirst == *rfirst) { + ++lfirst; ++rfirst; + } + if (lfirst == llast) { + return true; + } + + for (auto mid = lfirst; mid != llast; ++mid) { + // Skip already counted items + if (Detail::contains(lfirst, mid, *mid)) { + continue; + } + size_t num_vec = Detail::count(rfirst, rlast, *mid); + if (num_vec == 0 || Detail::count(lfirst, llast, *mid) != num_vec) { + return false; + } + } + + return true; + } + + std::string describe() const override { + return "UnorderedEquals: " + ::Catch::Detail::stringify(m_target); + } + private: + std::vector const& m_target; + }; + + } // namespace Vector + + // The following functions create the actual matcher objects. + // This allows the types to be inferred + + template + Vector::ContainsMatcher Contains( std::vector const& comparator ) { + return Vector::ContainsMatcher( comparator ); + } + + template + Vector::ContainsElementMatcher VectorContains( T const& comparator ) { + return Vector::ContainsElementMatcher( comparator ); + } + + template + Vector::EqualsMatcher Equals( std::vector const& comparator ) { + return Vector::EqualsMatcher( comparator ); + } + + template + Vector::UnorderedEqualsMatcher UnorderedEquals(std::vector const& target) { + return Vector::UnorderedEqualsMatcher(target); + } + +} // namespace Matchers +} // namespace Catch + +// end catch_matchers_vector.h +namespace Catch { + + template + class MatchExpr : public ITransientExpression { + ArgT const& m_arg; + MatcherT m_matcher; + StringRef m_matcherString; + public: + MatchExpr( ArgT const& arg, MatcherT const& matcher, StringRef const& matcherString ) + : ITransientExpression{ true, matcher.match( arg ) }, + m_arg( arg ), + m_matcher( matcher ), + m_matcherString( matcherString ) + {} + + void streamReconstructedExpression( std::ostream &os ) const override { + auto matcherAsString = m_matcher.toString(); + os << Catch::Detail::stringify( m_arg ) << ' '; + if( matcherAsString == Detail::unprintableString ) + os << m_matcherString; + else + os << matcherAsString; + } + }; + + using StringMatcher = Matchers::Impl::MatcherBase; + + void handleExceptionMatchExpr( AssertionHandler& handler, StringMatcher const& matcher, StringRef const& matcherString ); + + template + auto makeMatchExpr( ArgT const& arg, MatcherT const& matcher, StringRef const& matcherString ) -> MatchExpr { + return MatchExpr( arg, matcher, matcherString ); + } + +} // namespace Catch + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CHECK_THAT( macroName, matcher, resultDisposition, arg ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, CATCH_INTERNAL_STRINGIFY(arg) ", " CATCH_INTERNAL_STRINGIFY(matcher), resultDisposition ); \ + INTERNAL_CATCH_TRY { \ + catchAssertionHandler.handleExpr( Catch::makeMatchExpr( arg, matcher, #matcher##_catch_sr ) ); \ + } INTERNAL_CATCH_CATCH( catchAssertionHandler ) \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( false ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_THROWS_MATCHES( macroName, exceptionType, resultDisposition, matcher, ... ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, CATCH_INTERNAL_STRINGIFY(__VA_ARGS__) ", " CATCH_INTERNAL_STRINGIFY(exceptionType) ", " CATCH_INTERNAL_STRINGIFY(matcher), resultDisposition ); \ + if( catchAssertionHandler.allowThrows() ) \ + try { \ + static_cast(__VA_ARGS__ ); \ + catchAssertionHandler.handleUnexpectedExceptionNotThrown(); \ + } \ + catch( exceptionType const& ex ) { \ + catchAssertionHandler.handleExpr( Catch::makeMatchExpr( ex, matcher, #matcher##_catch_sr ) ); \ + } \ + catch( ... ) { \ + catchAssertionHandler.handleUnexpectedInflightException(); \ + } \ + else \ + catchAssertionHandler.handleThrowingCallSkipped(); \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( false ) + +// end catch_capture_matchers.h +#endif +// start catch_generators.hpp + +// start catch_interfaces_generatortracker.h + + +#include + +namespace Catch { + + namespace Generators { + class GeneratorUntypedBase { + public: + GeneratorUntypedBase() = default; + virtual ~GeneratorUntypedBase(); + // Attempts to move the generator to the next element + // + // Returns true iff the move succeeded (and a valid element + // can be retrieved). + virtual bool next() = 0; + }; + using GeneratorBasePtr = std::unique_ptr; + + } // namespace Generators + + struct IGeneratorTracker { + virtual ~IGeneratorTracker(); + virtual auto hasGenerator() const -> bool = 0; + virtual auto getGenerator() const -> Generators::GeneratorBasePtr const& = 0; + virtual void setGenerator( Generators::GeneratorBasePtr&& generator ) = 0; + }; + +} // namespace Catch + +// end catch_interfaces_generatortracker.h +// start catch_enforce.h + +#include + +namespace Catch { +#if !defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) + template + [[noreturn]] + void throw_exception(Ex const& e) { + throw e; + } +#else // ^^ Exceptions are enabled // Exceptions are disabled vv + [[noreturn]] + void throw_exception(std::exception const& e); +#endif +} // namespace Catch; + +#define CATCH_PREPARE_EXCEPTION( type, msg ) \ + type( ( Catch::ReusableStringStream() << msg ).str() ) +#define CATCH_INTERNAL_ERROR( msg ) \ + Catch::throw_exception(CATCH_PREPARE_EXCEPTION( std::logic_error, CATCH_INTERNAL_LINEINFO << ": Internal Catch error: " << msg)) +#define CATCH_ERROR( msg ) \ + Catch::throw_exception(CATCH_PREPARE_EXCEPTION( std::domain_error, msg )) +#define CATCH_RUNTIME_ERROR( msg ) \ + Catch::throw_exception(CATCH_PREPARE_EXCEPTION( std::runtime_error, msg )) +#define CATCH_ENFORCE( condition, msg ) \ + do{ if( !(condition) ) CATCH_ERROR( msg ); } while(false) + +// end catch_enforce.h +#include +#include +#include + +#include +#include + +namespace Catch { + +class GeneratorException : public std::exception { + const char* const m_msg = ""; + +public: + GeneratorException(const char* msg): + m_msg(msg) + {} + + const char* what() const noexcept override final; +}; + +namespace Generators { + + // !TBD move this into its own location? + namespace pf{ + template + std::unique_ptr make_unique( Args&&... args ) { + return std::unique_ptr(new T(std::forward(args)...)); + } + } + + template + struct IGenerator : GeneratorUntypedBase { + virtual ~IGenerator() = default; + + // Returns the current element of the generator + // + // \Precondition The generator is either freshly constructed, + // or the last call to `next()` returned true + virtual T const& get() const = 0; + using type = T; + }; + + template + class SingleValueGenerator final : public IGenerator { + T m_value; + public: + SingleValueGenerator(T const& value) : m_value( value ) {} + SingleValueGenerator(T&& value) : m_value(std::move(value)) {} + + T const& get() const override { + return m_value; + } + bool next() override { + return false; + } + }; + + template + class FixedValuesGenerator final : public IGenerator { + std::vector m_values; + size_t m_idx = 0; + public: + FixedValuesGenerator( std::initializer_list values ) : m_values( values ) {} + + T const& get() const override { + return m_values[m_idx]; + } + bool next() override { + ++m_idx; + return m_idx < m_values.size(); + } + }; + + template + class GeneratorWrapper final { + std::unique_ptr> m_generator; + public: + GeneratorWrapper(std::unique_ptr> generator): + m_generator(std::move(generator)) + {} + T const& get() const { + return m_generator->get(); + } + bool next() { + return m_generator->next(); + } + }; + + template + GeneratorWrapper value(T&& value) { + return GeneratorWrapper(pf::make_unique>(std::forward(value))); + } + template + GeneratorWrapper values(std::initializer_list values) { + return GeneratorWrapper(pf::make_unique>(values)); + } + + template + class Generators : public IGenerator { + std::vector> m_generators; + size_t m_current = 0; + + void populate(GeneratorWrapper&& generator) { + m_generators.emplace_back(std::move(generator)); + } + void populate(T&& val) { + m_generators.emplace_back(value(std::move(val))); + } + template + void populate(U&& val) { + populate(T(std::move(val))); + } + template + void populate(U&& valueOrGenerator, Gs... moreGenerators) { + populate(std::forward(valueOrGenerator)); + populate(std::forward(moreGenerators)...); + } + + public: + template + Generators(Gs... moreGenerators) { + m_generators.reserve(sizeof...(Gs)); + populate(std::forward(moreGenerators)...); + } + + T const& get() const override { + return m_generators[m_current].get(); + } + + bool next() override { + if (m_current >= m_generators.size()) { + return false; + } + const bool current_status = m_generators[m_current].next(); + if (!current_status) { + ++m_current; + } + return m_current < m_generators.size(); + } + }; + + template + GeneratorWrapper> table( std::initializer_list::type...>> tuples ) { + return values>( tuples ); + } + + // Tag type to signal that a generator sequence should convert arguments to a specific type + template + struct as {}; + + template + auto makeGenerators( GeneratorWrapper&& generator, Gs... moreGenerators ) -> Generators { + return Generators(std::move(generator), std::forward(moreGenerators)...); + } + template + auto makeGenerators( GeneratorWrapper&& generator ) -> Generators { + return Generators(std::move(generator)); + } + template + auto makeGenerators( T&& val, Gs... moreGenerators ) -> Generators { + return makeGenerators( value( std::forward( val ) ), std::forward( moreGenerators )... ); + } + template + auto makeGenerators( as, U&& val, Gs... moreGenerators ) -> Generators { + return makeGenerators( value( T( std::forward( val ) ) ), std::forward( moreGenerators )... ); + } + + auto acquireGeneratorTracker( SourceLineInfo const& lineInfo ) -> IGeneratorTracker&; + + template + // Note: The type after -> is weird, because VS2015 cannot parse + // the expression used in the typedef inside, when it is in + // return type. Yeah. + auto generate( SourceLineInfo const& lineInfo, L const& generatorExpression ) -> decltype(std::declval().get()) { + using UnderlyingType = typename decltype(generatorExpression())::type; + + IGeneratorTracker& tracker = acquireGeneratorTracker( lineInfo ); + if (!tracker.hasGenerator()) { + tracker.setGenerator(pf::make_unique>(generatorExpression())); + } + + auto const& generator = static_cast const&>( *tracker.getGenerator() ); + return generator.get(); + } + +} // namespace Generators +} // namespace Catch + +#define GENERATE( ... ) \ + Catch::Generators::generate( CATCH_INTERNAL_LINEINFO, []{ using namespace Catch::Generators; return makeGenerators( __VA_ARGS__ ); } ) + +// end catch_generators.hpp +// start catch_generators_generic.hpp + +namespace Catch { +namespace Generators { + + template + class TakeGenerator : public IGenerator { + GeneratorWrapper m_generator; + size_t m_returned = 0; + size_t m_target; + public: + TakeGenerator(size_t target, GeneratorWrapper&& generator): + m_generator(std::move(generator)), + m_target(target) + { + assert(target != 0 && "Empty generators are not allowed"); + } + T const& get() const override { + return m_generator.get(); + } + bool next() override { + ++m_returned; + if (m_returned >= m_target) { + return false; + } + + const auto success = m_generator.next(); + // If the underlying generator does not contain enough values + // then we cut short as well + if (!success) { + m_returned = m_target; + } + return success; + } + }; + + template + GeneratorWrapper take(size_t target, GeneratorWrapper&& generator) { + return GeneratorWrapper(pf::make_unique>(target, std::move(generator))); + } + + template + class FilterGenerator : public IGenerator { + GeneratorWrapper m_generator; + Predicate m_predicate; + public: + template + FilterGenerator(P&& pred, GeneratorWrapper&& generator): + m_generator(std::move(generator)), + m_predicate(std::forward

(pred)) + { + if (!m_predicate(m_generator.get())) { + // It might happen that there are no values that pass the + // filter. In that case we throw an exception. + auto has_initial_value = next(); + if (!has_initial_value) { + Catch::throw_exception(GeneratorException("No valid value found in filtered generator")); + } + } + } + + T const& get() const override { + return m_generator.get(); + } + + bool next() override { + bool success = m_generator.next(); + if (!success) { + return false; + } + while (!m_predicate(m_generator.get()) && (success = m_generator.next()) == true); + return success; + } + }; + + template + GeneratorWrapper filter(Predicate&& pred, GeneratorWrapper&& generator) { + return GeneratorWrapper(std::unique_ptr>(pf::make_unique>(std::forward(pred), std::move(generator)))); + } + + template + class RepeatGenerator : public IGenerator { + GeneratorWrapper m_generator; + mutable std::vector m_returned; + size_t m_target_repeats; + size_t m_current_repeat = 0; + size_t m_repeat_index = 0; + public: + RepeatGenerator(size_t repeats, GeneratorWrapper&& generator): + m_generator(std::move(generator)), + m_target_repeats(repeats) + { + assert(m_target_repeats > 0 && "Repeat generator must repeat at least once"); + } + + T const& get() const override { + if (m_current_repeat == 0) { + m_returned.push_back(m_generator.get()); + return m_returned.back(); + } + return m_returned[m_repeat_index]; + } + + bool next() override { + // There are 2 basic cases: + // 1) We are still reading the generator + // 2) We are reading our own cache + + // In the first case, we need to poke the underlying generator. + // If it happily moves, we are left in that state, otherwise it is time to start reading from our cache + if (m_current_repeat == 0) { + const auto success = m_generator.next(); + if (!success) { + ++m_current_repeat; + } + return m_current_repeat < m_target_repeats; + } + + // In the second case, we need to move indices forward and check that we haven't run up against the end + ++m_repeat_index; + if (m_repeat_index == m_returned.size()) { + m_repeat_index = 0; + ++m_current_repeat; + } + return m_current_repeat < m_target_repeats; + } + }; + + template + GeneratorWrapper repeat(size_t repeats, GeneratorWrapper&& generator) { + return GeneratorWrapper(pf::make_unique>(repeats, std::move(generator))); + } + + template + class MapGenerator : public IGenerator { + // TBD: provide static assert for mapping function, for friendly error message + GeneratorWrapper m_generator; + Func m_function; + // To avoid returning dangling reference, we have to save the values + T m_cache; + public: + template + MapGenerator(F2&& function, GeneratorWrapper&& generator) : + m_generator(std::move(generator)), + m_function(std::forward(function)), + m_cache(m_function(m_generator.get())) + {} + + T const& get() const override { + return m_cache; + } + bool next() override { + const auto success = m_generator.next(); + if (success) { + m_cache = m_function(m_generator.get()); + } + return success; + } + }; + + template + GeneratorWrapper map(Func&& function, GeneratorWrapper&& generator) { + return GeneratorWrapper( + pf::make_unique>(std::forward(function), std::move(generator)) + ); + } + template + GeneratorWrapper map(Func&& function, GeneratorWrapper&& generator) { + return GeneratorWrapper( + pf::make_unique>(std::forward(function), std::move(generator)) + ); + } + + template + class ChunkGenerator final : public IGenerator> { + std::vector m_chunk; + size_t m_chunk_size; + GeneratorWrapper m_generator; + bool m_used_up = false; + public: + ChunkGenerator(size_t size, GeneratorWrapper generator) : + m_chunk_size(size), m_generator(std::move(generator)) + { + m_chunk.reserve(m_chunk_size); + m_chunk.push_back(m_generator.get()); + for (size_t i = 1; i < m_chunk_size; ++i) { + if (!m_generator.next()) { + Catch::throw_exception(GeneratorException("Not enough values to initialize the first chunk")); + } + m_chunk.push_back(m_generator.get()); + } + } + std::vector const& get() const override { + return m_chunk; + } + bool next() override { + m_chunk.clear(); + for (size_t idx = 0; idx < m_chunk_size; ++idx) { + if (!m_generator.next()) { + return false; + } + m_chunk.push_back(m_generator.get()); + } + return true; + } + }; + + template + GeneratorWrapper> chunk(size_t size, GeneratorWrapper&& generator) { + return GeneratorWrapper>( + pf::make_unique>(size, std::move(generator)) + ); + } + +} // namespace Generators +} // namespace Catch + +// end catch_generators_generic.hpp +// start catch_generators_specific.hpp + +// start catch_context.h + +#include + +namespace Catch { + + struct IResultCapture; + struct IRunner; + struct IConfig; + struct IMutableContext; + + using IConfigPtr = std::shared_ptr; + + struct IContext + { + virtual ~IContext(); + + virtual IResultCapture* getResultCapture() = 0; + virtual IRunner* getRunner() = 0; + virtual IConfigPtr const& getConfig() const = 0; + }; + + struct IMutableContext : IContext + { + virtual ~IMutableContext(); + virtual void setResultCapture( IResultCapture* resultCapture ) = 0; + virtual void setRunner( IRunner* runner ) = 0; + virtual void setConfig( IConfigPtr const& config ) = 0; + + private: + static IMutableContext *currentContext; + friend IMutableContext& getCurrentMutableContext(); + friend void cleanUpContext(); + static void createContext(); + }; + + inline IMutableContext& getCurrentMutableContext() + { + if( !IMutableContext::currentContext ) + IMutableContext::createContext(); + return *IMutableContext::currentContext; + } + + inline IContext& getCurrentContext() + { + return getCurrentMutableContext(); + } + + void cleanUpContext(); +} + +// end catch_context.h +// start catch_interfaces_config.h + +#include +#include +#include +#include + +namespace Catch { + + enum class Verbosity { + Quiet = 0, + Normal, + High + }; + + struct WarnAbout { enum What { + Nothing = 0x00, + NoAssertions = 0x01, + NoTests = 0x02 + }; }; + + struct ShowDurations { enum OrNot { + DefaultForReporter, + Always, + Never + }; }; + struct RunTests { enum InWhatOrder { + InDeclarationOrder, + InLexicographicalOrder, + InRandomOrder + }; }; + struct UseColour { enum YesOrNo { + Auto, + Yes, + No + }; }; + struct WaitForKeypress { enum When { + Never, + BeforeStart = 1, + BeforeExit = 2, + BeforeStartAndExit = BeforeStart | BeforeExit + }; }; + + class TestSpec; + + struct IConfig : NonCopyable { + + virtual ~IConfig(); + + virtual bool allowThrows() const = 0; + virtual std::ostream& stream() const = 0; + virtual std::string name() const = 0; + virtual bool includeSuccessfulResults() const = 0; + virtual bool shouldDebugBreak() const = 0; + virtual bool warnAboutMissingAssertions() const = 0; + virtual bool warnAboutNoTests() const = 0; + virtual int abortAfter() const = 0; + virtual bool showInvisibles() const = 0; + virtual ShowDurations::OrNot showDurations() const = 0; + virtual TestSpec const& testSpec() const = 0; + virtual bool hasTestFilters() const = 0; + virtual RunTests::InWhatOrder runOrder() const = 0; + virtual unsigned int rngSeed() const = 0; + virtual int benchmarkResolutionMultiple() const = 0; + virtual UseColour::YesOrNo useColour() const = 0; + virtual std::vector const& getSectionsToRun() const = 0; + virtual Verbosity verbosity() const = 0; + }; + + using IConfigPtr = std::shared_ptr; +} + +// end catch_interfaces_config.h +#include + +namespace Catch { +namespace Generators { + +template +class RandomFloatingGenerator final : public IGenerator { + // FIXME: What is the right seed? + std::minstd_rand m_rand; + std::uniform_real_distribution m_dist; + Float m_current_number; +public: + + RandomFloatingGenerator(Float a, Float b): + m_rand(getCurrentContext().getConfig()->rngSeed()), + m_dist(a, b) { + static_cast(next()); + } + + Float const& get() const override { + return m_current_number; + } + bool next() override { + m_current_number = m_dist(m_rand); + return true; + } +}; + +template +class RandomIntegerGenerator final : public IGenerator { + std::minstd_rand m_rand; + std::uniform_int_distribution m_dist; + Integer m_current_number; +public: + + RandomIntegerGenerator(Integer a, Integer b): + m_rand(getCurrentContext().getConfig()->rngSeed()), + m_dist(a, b) { + static_cast(next()); + } + + Integer const& get() const override { + return m_current_number; + } + bool next() override { + m_current_number = m_dist(m_rand); + return true; + } +}; + +// TODO: Ideally this would be also constrained against the various char types, +// but I don't expect users to run into that in practice. +template +typename std::enable_if::value && !std::is_same::value, +GeneratorWrapper>::type +random(T a, T b) { + return GeneratorWrapper( + pf::make_unique>(a, b) + ); +} + +template +typename std::enable_if::value, +GeneratorWrapper>::type +random(T a, T b) { + return GeneratorWrapper( + pf::make_unique>(a, b) + ); +} + +template +class RangeGenerator final : public IGenerator { + T m_current; + T m_end; + T m_step; + bool m_positive; + +public: + RangeGenerator(T const& start, T const& end, T const& step): + m_current(start), + m_end(end), + m_step(step), + m_positive(m_step > T(0)) + { + assert(m_current != m_end && "Range start and end cannot be equal"); + assert(m_step != T(0) && "Step size cannot be zero"); + assert(((m_positive && m_current <= m_end) || (!m_positive && m_current >= m_end)) && "Step moves away from end"); + } + + RangeGenerator(T const& start, T const& end): + RangeGenerator(start, end, (start < end) ? T(1) : T(-1)) + {} + + T const& get() const override { + return m_current; + } + + bool next() override { + m_current += m_step; + return (m_positive) ? (m_current < m_end) : (m_current > m_end); + } +}; + +template +GeneratorWrapper range(T const& start, T const& end, T const& step) { + static_assert(std::is_integral::value && !std::is_same::value, "Type must be an integer"); + return GeneratorWrapper(pf::make_unique>(start, end, step)); +} + +template +GeneratorWrapper range(T const& start, T const& end) { + static_assert(std::is_integral::value && !std::is_same::value, "Type must be an integer"); + return GeneratorWrapper(pf::make_unique>(start, end)); +} + +} // namespace Generators +} // namespace Catch + +// end catch_generators_specific.hpp + +// These files are included here so the single_include script doesn't put them +// in the conditionally compiled sections +// start catch_test_case_info.h + +#include +#include +#include + +#ifdef __clang__ +#pragma clang diagnostic push +#pragma clang diagnostic ignored "-Wpadded" +#endif + +namespace Catch { + + struct ITestInvoker; + + struct TestCaseInfo { + enum SpecialProperties{ + None = 0, + IsHidden = 1 << 1, + ShouldFail = 1 << 2, + MayFail = 1 << 3, + Throws = 1 << 4, + NonPortable = 1 << 5, + Benchmark = 1 << 6 + }; + + TestCaseInfo( std::string const& _name, + std::string const& _className, + std::string const& _description, + std::vector const& _tags, + SourceLineInfo const& _lineInfo ); + + friend void setTags( TestCaseInfo& testCaseInfo, std::vector tags ); + + bool isHidden() const; + bool throws() const; + bool okToFail() const; + bool expectedToFail() const; + + std::string tagsAsString() const; + + std::string name; + std::string className; + std::string description; + std::vector tags; + std::vector lcaseTags; + SourceLineInfo lineInfo; + SpecialProperties properties; + }; + + class TestCase : public TestCaseInfo { + public: + + TestCase( ITestInvoker* testCase, TestCaseInfo&& info ); + + TestCase withName( std::string const& _newName ) const; + + void invoke() const; + + TestCaseInfo const& getTestCaseInfo() const; + + bool operator == ( TestCase const& other ) const; + bool operator < ( TestCase const& other ) const; + + private: + std::shared_ptr test; + }; + + TestCase makeTestCase( ITestInvoker* testCase, + std::string const& className, + NameAndTags const& nameAndTags, + SourceLineInfo const& lineInfo ); +} + +#ifdef __clang__ +#pragma clang diagnostic pop +#endif + +// end catch_test_case_info.h +// start catch_interfaces_runner.h + +namespace Catch { + + struct IRunner { + virtual ~IRunner(); + virtual bool aborting() const = 0; + }; +} + +// end catch_interfaces_runner.h + +#ifdef __OBJC__ +// start catch_objc.hpp + +#import + +#include + +// NB. Any general catch headers included here must be included +// in catch.hpp first to make sure they are included by the single +// header for non obj-usage + +/////////////////////////////////////////////////////////////////////////////// +// This protocol is really only here for (self) documenting purposes, since +// all its methods are optional. +@protocol OcFixture + +@optional + +-(void) setUp; +-(void) tearDown; + +@end + +namespace Catch { + + class OcMethod : public ITestInvoker { + + public: + OcMethod( Class cls, SEL sel ) : m_cls( cls ), m_sel( sel ) {} + + virtual void invoke() const { + id obj = [[m_cls alloc] init]; + + performOptionalSelector( obj, @selector(setUp) ); + performOptionalSelector( obj, m_sel ); + performOptionalSelector( obj, @selector(tearDown) ); + + arcSafeRelease( obj ); + } + private: + virtual ~OcMethod() {} + + Class m_cls; + SEL m_sel; + }; + + namespace Detail{ + + inline std::string getAnnotation( Class cls, + std::string const& annotationName, + std::string const& testCaseName ) { + NSString* selStr = [[NSString alloc] initWithFormat:@"Catch_%s_%s", annotationName.c_str(), testCaseName.c_str()]; + SEL sel = NSSelectorFromString( selStr ); + arcSafeRelease( selStr ); + id value = performOptionalSelector( cls, sel ); + if( value ) + return [(NSString*)value UTF8String]; + return ""; + } + } + + inline std::size_t registerTestMethods() { + std::size_t noTestMethods = 0; + int noClasses = objc_getClassList( nullptr, 0 ); + + Class* classes = (CATCH_UNSAFE_UNRETAINED Class *)malloc( sizeof(Class) * noClasses); + objc_getClassList( classes, noClasses ); + + for( int c = 0; c < noClasses; c++ ) { + Class cls = classes[c]; + { + u_int count; + Method* methods = class_copyMethodList( cls, &count ); + for( u_int m = 0; m < count ; m++ ) { + SEL selector = method_getName(methods[m]); + std::string methodName = sel_getName(selector); + if( startsWith( methodName, "Catch_TestCase_" ) ) { + std::string testCaseName = methodName.substr( 15 ); + std::string name = Detail::getAnnotation( cls, "Name", testCaseName ); + std::string desc = Detail::getAnnotation( cls, "Description", testCaseName ); + const char* className = class_getName( cls ); + + getMutableRegistryHub().registerTest( makeTestCase( new OcMethod( cls, selector ), className, NameAndTags( name.c_str(), desc.c_str() ), SourceLineInfo("",0) ) ); + noTestMethods++; + } + } + free(methods); + } + } + return noTestMethods; + } + +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) + + namespace Matchers { + namespace Impl { + namespace NSStringMatchers { + + struct StringHolder : MatcherBase{ + StringHolder( NSString* substr ) : m_substr( [substr copy] ){} + StringHolder( StringHolder const& other ) : m_substr( [other.m_substr copy] ){} + StringHolder() { + arcSafeRelease( m_substr ); + } + + bool match( NSString* arg ) const override { + return false; + } + + NSString* CATCH_ARC_STRONG m_substr; + }; + + struct Equals : StringHolder { + Equals( NSString* substr ) : StringHolder( substr ){} + + bool match( NSString* str ) const override { + return (str != nil || m_substr == nil ) && + [str isEqualToString:m_substr]; + } + + std::string describe() const override { + return "equals string: " + Catch::Detail::stringify( m_substr ); + } + }; + + struct Contains : StringHolder { + Contains( NSString* substr ) : StringHolder( substr ){} + + bool match( NSString* str ) const { + return (str != nil || m_substr == nil ) && + [str rangeOfString:m_substr].location != NSNotFound; + } + + std::string describe() const override { + return "contains string: " + Catch::Detail::stringify( m_substr ); + } + }; + + struct StartsWith : StringHolder { + StartsWith( NSString* substr ) : StringHolder( substr ){} + + bool match( NSString* str ) const override { + return (str != nil || m_substr == nil ) && + [str rangeOfString:m_substr].location == 0; + } + + std::string describe() const override { + return "starts with: " + Catch::Detail::stringify( m_substr ); + } + }; + struct EndsWith : StringHolder { + EndsWith( NSString* substr ) : StringHolder( substr ){} + + bool match( NSString* str ) const override { + return (str != nil || m_substr == nil ) && + [str rangeOfString:m_substr].location == [str length] - [m_substr length]; + } + + std::string describe() const override { + return "ends with: " + Catch::Detail::stringify( m_substr ); + } + }; + + } // namespace NSStringMatchers + } // namespace Impl + + inline Impl::NSStringMatchers::Equals + Equals( NSString* substr ){ return Impl::NSStringMatchers::Equals( substr ); } + + inline Impl::NSStringMatchers::Contains + Contains( NSString* substr ){ return Impl::NSStringMatchers::Contains( substr ); } + + inline Impl::NSStringMatchers::StartsWith + StartsWith( NSString* substr ){ return Impl::NSStringMatchers::StartsWith( substr ); } + + inline Impl::NSStringMatchers::EndsWith + EndsWith( NSString* substr ){ return Impl::NSStringMatchers::EndsWith( substr ); } + + } // namespace Matchers + + using namespace Matchers; + +#endif // CATCH_CONFIG_DISABLE_MATCHERS + +} // namespace Catch + +/////////////////////////////////////////////////////////////////////////////// +#define OC_MAKE_UNIQUE_NAME( root, uniqueSuffix ) root##uniqueSuffix +#define OC_TEST_CASE2( name, desc, uniqueSuffix ) \ ++(NSString*) OC_MAKE_UNIQUE_NAME( Catch_Name_test_, uniqueSuffix ) \ +{ \ +return @ name; \ +} \ ++(NSString*) OC_MAKE_UNIQUE_NAME( Catch_Description_test_, uniqueSuffix ) \ +{ \ +return @ desc; \ +} \ +-(void) OC_MAKE_UNIQUE_NAME( Catch_TestCase_test_, uniqueSuffix ) + +#define OC_TEST_CASE( name, desc ) OC_TEST_CASE2( name, desc, __LINE__ ) + +// end catch_objc.hpp +#endif + +#ifdef CATCH_CONFIG_EXTERNAL_INTERFACES +// start catch_external_interfaces.h + +// start catch_reporter_bases.hpp + +// start catch_interfaces_reporter.h + +// start catch_config.hpp + +// start catch_test_spec_parser.h + +#ifdef __clang__ +#pragma clang diagnostic push +#pragma clang diagnostic ignored "-Wpadded" +#endif + +// start catch_test_spec.h + +#ifdef __clang__ +#pragma clang diagnostic push +#pragma clang diagnostic ignored "-Wpadded" +#endif + +// start catch_wildcard_pattern.h + +namespace Catch +{ + class WildcardPattern { + enum WildcardPosition { + NoWildcard = 0, + WildcardAtStart = 1, + WildcardAtEnd = 2, + WildcardAtBothEnds = WildcardAtStart | WildcardAtEnd + }; + + public: + + WildcardPattern( std::string const& pattern, CaseSensitive::Choice caseSensitivity ); + virtual ~WildcardPattern() = default; + virtual bool matches( std::string const& str ) const; + + private: + std::string adjustCase( std::string const& str ) const; + CaseSensitive::Choice m_caseSensitivity; + WildcardPosition m_wildcard = NoWildcard; + std::string m_pattern; + }; +} + +// end catch_wildcard_pattern.h +#include +#include +#include + +namespace Catch { + + class TestSpec { + struct Pattern { + virtual ~Pattern(); + virtual bool matches( TestCaseInfo const& testCase ) const = 0; + }; + using PatternPtr = std::shared_ptr; + + class NamePattern : public Pattern { + public: + NamePattern( std::string const& name ); + virtual ~NamePattern(); + virtual bool matches( TestCaseInfo const& testCase ) const override; + private: + WildcardPattern m_wildcardPattern; + }; + + class TagPattern : public Pattern { + public: + TagPattern( std::string const& tag ); + virtual ~TagPattern(); + virtual bool matches( TestCaseInfo const& testCase ) const override; + private: + std::string m_tag; + }; + + class ExcludedPattern : public Pattern { + public: + ExcludedPattern( PatternPtr const& underlyingPattern ); + virtual ~ExcludedPattern(); + virtual bool matches( TestCaseInfo const& testCase ) const override; + private: + PatternPtr m_underlyingPattern; + }; + + struct Filter { + std::vector m_patterns; + + bool matches( TestCaseInfo const& testCase ) const; + }; + + public: + bool hasFilters() const; + bool matches( TestCaseInfo const& testCase ) const; + + private: + std::vector m_filters; + + friend class TestSpecParser; + }; +} + +#ifdef __clang__ +#pragma clang diagnostic pop +#endif + +// end catch_test_spec.h +// start catch_interfaces_tag_alias_registry.h + +#include + +namespace Catch { + + struct TagAlias; + + struct ITagAliasRegistry { + virtual ~ITagAliasRegistry(); + // Nullptr if not present + virtual TagAlias const* find( std::string const& alias ) const = 0; + virtual std::string expandAliases( std::string const& unexpandedTestSpec ) const = 0; + + static ITagAliasRegistry const& get(); + }; + +} // end namespace Catch + +// end catch_interfaces_tag_alias_registry.h +namespace Catch { + + class TestSpecParser { + enum Mode{ None, Name, QuotedName, Tag, EscapedName }; + Mode m_mode = None; + bool m_exclusion = false; + std::size_t m_start = std::string::npos, m_pos = 0; + std::string m_arg; + std::vector m_escapeChars; + TestSpec::Filter m_currentFilter; + TestSpec m_testSpec; + ITagAliasRegistry const* m_tagAliases = nullptr; + + public: + TestSpecParser( ITagAliasRegistry const& tagAliases ); + + TestSpecParser& parse( std::string const& arg ); + TestSpec testSpec(); + + private: + void visitChar( char c ); + void startNewMode( Mode mode, std::size_t start ); + void escape(); + std::string subString() const; + + template + void addPattern() { + std::string token = subString(); + for( std::size_t i = 0; i < m_escapeChars.size(); ++i ) + token = token.substr( 0, m_escapeChars[i]-m_start-i ) + token.substr( m_escapeChars[i]-m_start-i+1 ); + m_escapeChars.clear(); + if( startsWith( token, "exclude:" ) ) { + m_exclusion = true; + token = token.substr( 8 ); + } + if( !token.empty() ) { + TestSpec::PatternPtr pattern = std::make_shared( token ); + if( m_exclusion ) + pattern = std::make_shared( pattern ); + m_currentFilter.m_patterns.push_back( pattern ); + } + m_exclusion = false; + m_mode = None; + } + + void addFilter(); + }; + TestSpec parseTestSpec( std::string const& arg ); + +} // namespace Catch + +#ifdef __clang__ +#pragma clang diagnostic pop +#endif + +// end catch_test_spec_parser.h +// Libstdc++ doesn't like incomplete classes for unique_ptr + +#include +#include +#include + +#ifndef CATCH_CONFIG_CONSOLE_WIDTH +#define CATCH_CONFIG_CONSOLE_WIDTH 80 +#endif + +namespace Catch { + + struct IStream; + + struct ConfigData { + bool listTests = false; + bool listTags = false; + bool listReporters = false; + bool listTestNamesOnly = false; + + bool showSuccessfulTests = false; + bool shouldDebugBreak = false; + bool noThrow = false; + bool showHelp = false; + bool showInvisibles = false; + bool filenamesAsTags = false; + bool libIdentify = false; + + int abortAfter = -1; + unsigned int rngSeed = 0; + int benchmarkResolutionMultiple = 100; + + Verbosity verbosity = Verbosity::Normal; + WarnAbout::What warnings = WarnAbout::Nothing; + ShowDurations::OrNot showDurations = ShowDurations::DefaultForReporter; + RunTests::InWhatOrder runOrder = RunTests::InDeclarationOrder; + UseColour::YesOrNo useColour = UseColour::Auto; + WaitForKeypress::When waitForKeypress = WaitForKeypress::Never; + + std::string outputFilename; + std::string name; + std::string processName; +#ifndef CATCH_CONFIG_DEFAULT_REPORTER +#define CATCH_CONFIG_DEFAULT_REPORTER "console" +#endif + std::string reporterName = CATCH_CONFIG_DEFAULT_REPORTER; +#undef CATCH_CONFIG_DEFAULT_REPORTER + + std::vector testsOrTags; + std::vector sectionsToRun; + }; + + class Config : public IConfig { + public: + + Config() = default; + Config( ConfigData const& data ); + virtual ~Config() = default; + + std::string const& getFilename() const; + + bool listTests() const; + bool listTestNamesOnly() const; + bool listTags() const; + bool listReporters() const; + + std::string getProcessName() const; + std::string const& getReporterName() const; + + std::vector const& getTestsOrTags() const; + std::vector const& getSectionsToRun() const override; + + virtual TestSpec const& testSpec() const override; + bool hasTestFilters() const override; + + bool showHelp() const; + + // IConfig interface + bool allowThrows() const override; + std::ostream& stream() const override; + std::string name() const override; + bool includeSuccessfulResults() const override; + bool warnAboutMissingAssertions() const override; + bool warnAboutNoTests() const override; + ShowDurations::OrNot showDurations() const override; + RunTests::InWhatOrder runOrder() const override; + unsigned int rngSeed() const override; + int benchmarkResolutionMultiple() const override; + UseColour::YesOrNo useColour() const override; + bool shouldDebugBreak() const override; + int abortAfter() const override; + bool showInvisibles() const override; + Verbosity verbosity() const override; + + private: + + IStream const* openStream(); + ConfigData m_data; + + std::unique_ptr m_stream; + TestSpec m_testSpec; + bool m_hasTestFilters = false; + }; + +} // end namespace Catch + +// end catch_config.hpp +// start catch_assertionresult.h + +#include + +namespace Catch { + + struct AssertionResultData + { + AssertionResultData() = delete; + + AssertionResultData( ResultWas::OfType _resultType, LazyExpression const& _lazyExpression ); + + std::string message; + mutable std::string reconstructedExpression; + LazyExpression lazyExpression; + ResultWas::OfType resultType; + + std::string reconstructExpression() const; + }; + + class AssertionResult { + public: + AssertionResult() = delete; + AssertionResult( AssertionInfo const& info, AssertionResultData const& data ); + + bool isOk() const; + bool succeeded() const; + ResultWas::OfType getResultType() const; + bool hasExpression() const; + bool hasMessage() const; + std::string getExpression() const; + std::string getExpressionInMacro() const; + bool hasExpandedExpression() const; + std::string getExpandedExpression() const; + std::string getMessage() const; + SourceLineInfo getSourceInfo() const; + StringRef getTestMacroName() const; + + //protected: + AssertionInfo m_info; + AssertionResultData m_resultData; + }; + +} // end namespace Catch + +// end catch_assertionresult.h +// start catch_option.hpp + +namespace Catch { + + // An optional type + template + class Option { + public: + Option() : nullableValue( nullptr ) {} + Option( T const& _value ) + : nullableValue( new( storage ) T( _value ) ) + {} + Option( Option const& _other ) + : nullableValue( _other ? new( storage ) T( *_other ) : nullptr ) + {} + + ~Option() { + reset(); + } + + Option& operator= ( Option const& _other ) { + if( &_other != this ) { + reset(); + if( _other ) + nullableValue = new( storage ) T( *_other ); + } + return *this; + } + Option& operator = ( T const& _value ) { + reset(); + nullableValue = new( storage ) T( _value ); + return *this; + } + + void reset() { + if( nullableValue ) + nullableValue->~T(); + nullableValue = nullptr; + } + + T& operator*() { return *nullableValue; } + T const& operator*() const { return *nullableValue; } + T* operator->() { return nullableValue; } + const T* operator->() const { return nullableValue; } + + T valueOr( T const& defaultValue ) const { + return nullableValue ? *nullableValue : defaultValue; + } + + bool some() const { return nullableValue != nullptr; } + bool none() const { return nullableValue == nullptr; } + + bool operator !() const { return nullableValue == nullptr; } + explicit operator bool() const { + return some(); + } + + private: + T *nullableValue; + alignas(alignof(T)) char storage[sizeof(T)]; + }; + +} // end namespace Catch + +// end catch_option.hpp +#include +#include +#include +#include +#include + +namespace Catch { + + struct ReporterConfig { + explicit ReporterConfig( IConfigPtr const& _fullConfig ); + + ReporterConfig( IConfigPtr const& _fullConfig, std::ostream& _stream ); + + std::ostream& stream() const; + IConfigPtr fullConfig() const; + + private: + std::ostream* m_stream; + IConfigPtr m_fullConfig; + }; + + struct ReporterPreferences { + bool shouldRedirectStdOut = false; + bool shouldReportAllAssertions = false; + }; + + template + struct LazyStat : Option { + LazyStat& operator=( T const& _value ) { + Option::operator=( _value ); + used = false; + return *this; + } + void reset() { + Option::reset(); + used = false; + } + bool used = false; + }; + + struct TestRunInfo { + TestRunInfo( std::string const& _name ); + std::string name; + }; + struct GroupInfo { + GroupInfo( std::string const& _name, + std::size_t _groupIndex, + std::size_t _groupsCount ); + + std::string name; + std::size_t groupIndex; + std::size_t groupsCounts; + }; + + struct AssertionStats { + AssertionStats( AssertionResult const& _assertionResult, + std::vector const& _infoMessages, + Totals const& _totals ); + + AssertionStats( AssertionStats const& ) = default; + AssertionStats( AssertionStats && ) = default; + AssertionStats& operator = ( AssertionStats const& ) = delete; + AssertionStats& operator = ( AssertionStats && ) = delete; + virtual ~AssertionStats(); + + AssertionResult assertionResult; + std::vector infoMessages; + Totals totals; + }; + + struct SectionStats { + SectionStats( SectionInfo const& _sectionInfo, + Counts const& _assertions, + double _durationInSeconds, + bool _missingAssertions ); + SectionStats( SectionStats const& ) = default; + SectionStats( SectionStats && ) = default; + SectionStats& operator = ( SectionStats const& ) = default; + SectionStats& operator = ( SectionStats && ) = default; + virtual ~SectionStats(); + + SectionInfo sectionInfo; + Counts assertions; + double durationInSeconds; + bool missingAssertions; + }; + + struct TestCaseStats { + TestCaseStats( TestCaseInfo const& _testInfo, + Totals const& _totals, + std::string const& _stdOut, + std::string const& _stdErr, + bool _aborting ); + + TestCaseStats( TestCaseStats const& ) = default; + TestCaseStats( TestCaseStats && ) = default; + TestCaseStats& operator = ( TestCaseStats const& ) = default; + TestCaseStats& operator = ( TestCaseStats && ) = default; + virtual ~TestCaseStats(); + + TestCaseInfo testInfo; + Totals totals; + std::string stdOut; + std::string stdErr; + bool aborting; + }; + + struct TestGroupStats { + TestGroupStats( GroupInfo const& _groupInfo, + Totals const& _totals, + bool _aborting ); + TestGroupStats( GroupInfo const& _groupInfo ); + + TestGroupStats( TestGroupStats const& ) = default; + TestGroupStats( TestGroupStats && ) = default; + TestGroupStats& operator = ( TestGroupStats const& ) = default; + TestGroupStats& operator = ( TestGroupStats && ) = default; + virtual ~TestGroupStats(); + + GroupInfo groupInfo; + Totals totals; + bool aborting; + }; + + struct TestRunStats { + TestRunStats( TestRunInfo const& _runInfo, + Totals const& _totals, + bool _aborting ); + + TestRunStats( TestRunStats const& ) = default; + TestRunStats( TestRunStats && ) = default; + TestRunStats& operator = ( TestRunStats const& ) = default; + TestRunStats& operator = ( TestRunStats && ) = default; + virtual ~TestRunStats(); + + TestRunInfo runInfo; + Totals totals; + bool aborting; + }; + + struct BenchmarkInfo { + std::string name; + }; + struct BenchmarkStats { + BenchmarkInfo info; + std::size_t iterations; + uint64_t elapsedTimeInNanoseconds; + }; + + struct IStreamingReporter { + virtual ~IStreamingReporter() = default; + + // Implementing class must also provide the following static methods: + // static std::string getDescription(); + // static std::set getSupportedVerbosities() + + virtual ReporterPreferences getPreferences() const = 0; + + virtual void noMatchingTestCases( std::string const& spec ) = 0; + + virtual void testRunStarting( TestRunInfo const& testRunInfo ) = 0; + virtual void testGroupStarting( GroupInfo const& groupInfo ) = 0; + + virtual void testCaseStarting( TestCaseInfo const& testInfo ) = 0; + virtual void sectionStarting( SectionInfo const& sectionInfo ) = 0; + + // *** experimental *** + virtual void benchmarkStarting( BenchmarkInfo const& ) {} + + virtual void assertionStarting( AssertionInfo const& assertionInfo ) = 0; + + // The return value indicates if the messages buffer should be cleared: + virtual bool assertionEnded( AssertionStats const& assertionStats ) = 0; + + // *** experimental *** + virtual void benchmarkEnded( BenchmarkStats const& ) {} + + virtual void sectionEnded( SectionStats const& sectionStats ) = 0; + virtual void testCaseEnded( TestCaseStats const& testCaseStats ) = 0; + virtual void testGroupEnded( TestGroupStats const& testGroupStats ) = 0; + virtual void testRunEnded( TestRunStats const& testRunStats ) = 0; + + virtual void skipTest( TestCaseInfo const& testInfo ) = 0; + + // Default empty implementation provided + virtual void fatalErrorEncountered( StringRef name ); + + virtual bool isMulti() const; + }; + using IStreamingReporterPtr = std::unique_ptr; + + struct IReporterFactory { + virtual ~IReporterFactory(); + virtual IStreamingReporterPtr create( ReporterConfig const& config ) const = 0; + virtual std::string getDescription() const = 0; + }; + using IReporterFactoryPtr = std::shared_ptr; + + struct IReporterRegistry { + using FactoryMap = std::map; + using Listeners = std::vector; + + virtual ~IReporterRegistry(); + virtual IStreamingReporterPtr create( std::string const& name, IConfigPtr const& config ) const = 0; + virtual FactoryMap const& getFactories() const = 0; + virtual Listeners const& getListeners() const = 0; + }; + +} // end namespace Catch + +// end catch_interfaces_reporter.h +#include +#include +#include +#include +#include +#include +#include + +namespace Catch { + void prepareExpandedExpression(AssertionResult& result); + + // Returns double formatted as %.3f (format expected on output) + std::string getFormattedDuration( double duration ); + + template + struct StreamingReporterBase : IStreamingReporter { + + StreamingReporterBase( ReporterConfig const& _config ) + : m_config( _config.fullConfig() ), + stream( _config.stream() ) + { + m_reporterPrefs.shouldRedirectStdOut = false; + if( !DerivedT::getSupportedVerbosities().count( m_config->verbosity() ) ) + CATCH_ERROR( "Verbosity level not supported by this reporter" ); + } + + ReporterPreferences getPreferences() const override { + return m_reporterPrefs; + } + + static std::set getSupportedVerbosities() { + return { Verbosity::Normal }; + } + + ~StreamingReporterBase() override = default; + + void noMatchingTestCases(std::string const&) override {} + + void testRunStarting(TestRunInfo const& _testRunInfo) override { + currentTestRunInfo = _testRunInfo; + } + void testGroupStarting(GroupInfo const& _groupInfo) override { + currentGroupInfo = _groupInfo; + } + + void testCaseStarting(TestCaseInfo const& _testInfo) override { + currentTestCaseInfo = _testInfo; + } + void sectionStarting(SectionInfo const& _sectionInfo) override { + m_sectionStack.push_back(_sectionInfo); + } + + void sectionEnded(SectionStats const& /* _sectionStats */) override { + m_sectionStack.pop_back(); + } + void testCaseEnded(TestCaseStats const& /* _testCaseStats */) override { + currentTestCaseInfo.reset(); + } + void testGroupEnded(TestGroupStats const& /* _testGroupStats */) override { + currentGroupInfo.reset(); + } + void testRunEnded(TestRunStats const& /* _testRunStats */) override { + currentTestCaseInfo.reset(); + currentGroupInfo.reset(); + currentTestRunInfo.reset(); + } + + void skipTest(TestCaseInfo const&) override { + // Don't do anything with this by default. + // It can optionally be overridden in the derived class. + } + + IConfigPtr m_config; + std::ostream& stream; + + LazyStat currentTestRunInfo; + LazyStat currentGroupInfo; + LazyStat currentTestCaseInfo; + + std::vector m_sectionStack; + ReporterPreferences m_reporterPrefs; + }; + + template + struct CumulativeReporterBase : IStreamingReporter { + template + struct Node { + explicit Node( T const& _value ) : value( _value ) {} + virtual ~Node() {} + + using ChildNodes = std::vector>; + T value; + ChildNodes children; + }; + struct SectionNode { + explicit SectionNode(SectionStats const& _stats) : stats(_stats) {} + virtual ~SectionNode() = default; + + bool operator == (SectionNode const& other) const { + return stats.sectionInfo.lineInfo == other.stats.sectionInfo.lineInfo; + } + bool operator == (std::shared_ptr const& other) const { + return operator==(*other); + } + + SectionStats stats; + using ChildSections = std::vector>; + using Assertions = std::vector; + ChildSections childSections; + Assertions assertions; + std::string stdOut; + std::string stdErr; + }; + + struct BySectionInfo { + BySectionInfo( SectionInfo const& other ) : m_other( other ) {} + BySectionInfo( BySectionInfo const& other ) : m_other( other.m_other ) {} + bool operator() (std::shared_ptr const& node) const { + return ((node->stats.sectionInfo.name == m_other.name) && + (node->stats.sectionInfo.lineInfo == m_other.lineInfo)); + } + void operator=(BySectionInfo const&) = delete; + + private: + SectionInfo const& m_other; + }; + + using TestCaseNode = Node; + using TestGroupNode = Node; + using TestRunNode = Node; + + CumulativeReporterBase( ReporterConfig const& _config ) + : m_config( _config.fullConfig() ), + stream( _config.stream() ) + { + m_reporterPrefs.shouldRedirectStdOut = false; + if( !DerivedT::getSupportedVerbosities().count( m_config->verbosity() ) ) + CATCH_ERROR( "Verbosity level not supported by this reporter" ); + } + ~CumulativeReporterBase() override = default; + + ReporterPreferences getPreferences() const override { + return m_reporterPrefs; + } + + static std::set getSupportedVerbosities() { + return { Verbosity::Normal }; + } + + void testRunStarting( TestRunInfo const& ) override {} + void testGroupStarting( GroupInfo const& ) override {} + + void testCaseStarting( TestCaseInfo const& ) override {} + + void sectionStarting( SectionInfo const& sectionInfo ) override { + SectionStats incompleteStats( sectionInfo, Counts(), 0, false ); + std::shared_ptr node; + if( m_sectionStack.empty() ) { + if( !m_rootSection ) + m_rootSection = std::make_shared( incompleteStats ); + node = m_rootSection; + } + else { + SectionNode& parentNode = *m_sectionStack.back(); + auto it = + std::find_if( parentNode.childSections.begin(), + parentNode.childSections.end(), + BySectionInfo( sectionInfo ) ); + if( it == parentNode.childSections.end() ) { + node = std::make_shared( incompleteStats ); + parentNode.childSections.push_back( node ); + } + else + node = *it; + } + m_sectionStack.push_back( node ); + m_deepestSection = std::move(node); + } + + void assertionStarting(AssertionInfo const&) override {} + + bool assertionEnded(AssertionStats const& assertionStats) override { + assert(!m_sectionStack.empty()); + // AssertionResult holds a pointer to a temporary DecomposedExpression, + // which getExpandedExpression() calls to build the expression string. + // Our section stack copy of the assertionResult will likely outlive the + // temporary, so it must be expanded or discarded now to avoid calling + // a destroyed object later. + prepareExpandedExpression(const_cast( assertionStats.assertionResult ) ); + SectionNode& sectionNode = *m_sectionStack.back(); + sectionNode.assertions.push_back(assertionStats); + return true; + } + void sectionEnded(SectionStats const& sectionStats) override { + assert(!m_sectionStack.empty()); + SectionNode& node = *m_sectionStack.back(); + node.stats = sectionStats; + m_sectionStack.pop_back(); + } + void testCaseEnded(TestCaseStats const& testCaseStats) override { + auto node = std::make_shared(testCaseStats); + assert(m_sectionStack.size() == 0); + node->children.push_back(m_rootSection); + m_testCases.push_back(node); + m_rootSection.reset(); + + assert(m_deepestSection); + m_deepestSection->stdOut = testCaseStats.stdOut; + m_deepestSection->stdErr = testCaseStats.stdErr; + } + void testGroupEnded(TestGroupStats const& testGroupStats) override { + auto node = std::make_shared(testGroupStats); + node->children.swap(m_testCases); + m_testGroups.push_back(node); + } + void testRunEnded(TestRunStats const& testRunStats) override { + auto node = std::make_shared(testRunStats); + node->children.swap(m_testGroups); + m_testRuns.push_back(node); + testRunEndedCumulative(); + } + virtual void testRunEndedCumulative() = 0; + + void skipTest(TestCaseInfo const&) override {} + + IConfigPtr m_config; + std::ostream& stream; + std::vector m_assertions; + std::vector>> m_sections; + std::vector> m_testCases; + std::vector> m_testGroups; + + std::vector> m_testRuns; + + std::shared_ptr m_rootSection; + std::shared_ptr m_deepestSection; + std::vector> m_sectionStack; + ReporterPreferences m_reporterPrefs; + }; + + template + char const* getLineOfChars() { + static char line[CATCH_CONFIG_CONSOLE_WIDTH] = {0}; + if( !*line ) { + std::memset( line, C, CATCH_CONFIG_CONSOLE_WIDTH-1 ); + line[CATCH_CONFIG_CONSOLE_WIDTH-1] = 0; + } + return line; + } + + struct TestEventListenerBase : StreamingReporterBase { + TestEventListenerBase( ReporterConfig const& _config ); + + static std::set getSupportedVerbosities(); + + void assertionStarting(AssertionInfo const&) override; + bool assertionEnded(AssertionStats const&) override; + }; + +} // end namespace Catch + +// end catch_reporter_bases.hpp +// start catch_console_colour.h + +namespace Catch { + + struct Colour { + enum Code { + None = 0, + + White, + Red, + Green, + Blue, + Cyan, + Yellow, + Grey, + + Bright = 0x10, + + BrightRed = Bright | Red, + BrightGreen = Bright | Green, + LightGrey = Bright | Grey, + BrightWhite = Bright | White, + BrightYellow = Bright | Yellow, + + // By intention + FileName = LightGrey, + Warning = BrightYellow, + ResultError = BrightRed, + ResultSuccess = BrightGreen, + ResultExpectedFailure = Warning, + + Error = BrightRed, + Success = Green, + + OriginalExpression = Cyan, + ReconstructedExpression = BrightYellow, + + SecondaryText = LightGrey, + Headers = White + }; + + // Use constructed object for RAII guard + Colour( Code _colourCode ); + Colour( Colour&& other ) noexcept; + Colour& operator=( Colour&& other ) noexcept; + ~Colour(); + + // Use static method for one-shot changes + static void use( Code _colourCode ); + + private: + bool m_moved = false; + }; + + std::ostream& operator << ( std::ostream& os, Colour const& ); + +} // end namespace Catch + +// end catch_console_colour.h +// start catch_reporter_registrars.hpp + + +namespace Catch { + + template + class ReporterRegistrar { + + class ReporterFactory : public IReporterFactory { + + virtual IStreamingReporterPtr create( ReporterConfig const& config ) const override { + return std::unique_ptr( new T( config ) ); + } + + virtual std::string getDescription() const override { + return T::getDescription(); + } + }; + + public: + + explicit ReporterRegistrar( std::string const& name ) { + getMutableRegistryHub().registerReporter( name, std::make_shared() ); + } + }; + + template + class ListenerRegistrar { + + class ListenerFactory : public IReporterFactory { + + virtual IStreamingReporterPtr create( ReporterConfig const& config ) const override { + return std::unique_ptr( new T( config ) ); + } + virtual std::string getDescription() const override { + return std::string(); + } + }; + + public: + + ListenerRegistrar() { + getMutableRegistryHub().registerListener( std::make_shared() ); + } + }; +} + +#if !defined(CATCH_CONFIG_DISABLE) + +#define CATCH_REGISTER_REPORTER( name, reporterType ) \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ Catch::ReporterRegistrar catch_internal_RegistrarFor##reporterType( name ); } \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS + +#define CATCH_REGISTER_LISTENER( listenerType ) \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ Catch::ListenerRegistrar catch_internal_RegistrarFor##listenerType; } \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS +#else // CATCH_CONFIG_DISABLE + +#define CATCH_REGISTER_REPORTER(name, reporterType) +#define CATCH_REGISTER_LISTENER(listenerType) + +#endif // CATCH_CONFIG_DISABLE + +// end catch_reporter_registrars.hpp +// Allow users to base their work off existing reporters +// start catch_reporter_compact.h + +namespace Catch { + + struct CompactReporter : StreamingReporterBase { + + using StreamingReporterBase::StreamingReporterBase; + + ~CompactReporter() override; + + static std::string getDescription(); + + ReporterPreferences getPreferences() const override; + + void noMatchingTestCases(std::string const& spec) override; + + void assertionStarting(AssertionInfo const&) override; + + bool assertionEnded(AssertionStats const& _assertionStats) override; + + void sectionEnded(SectionStats const& _sectionStats) override; + + void testRunEnded(TestRunStats const& _testRunStats) override; + + }; + +} // end namespace Catch + +// end catch_reporter_compact.h +// start catch_reporter_console.h + +#if defined(_MSC_VER) +#pragma warning(push) +#pragma warning(disable:4061) // Not all labels are EXPLICITLY handled in switch + // Note that 4062 (not all labels are handled + // and default is missing) is enabled +#endif + +namespace Catch { + // Fwd decls + struct SummaryColumn; + class TablePrinter; + + struct ConsoleReporter : StreamingReporterBase { + std::unique_ptr m_tablePrinter; + + ConsoleReporter(ReporterConfig const& config); + ~ConsoleReporter() override; + static std::string getDescription(); + + void noMatchingTestCases(std::string const& spec) override; + + void assertionStarting(AssertionInfo const&) override; + + bool assertionEnded(AssertionStats const& _assertionStats) override; + + void sectionStarting(SectionInfo const& _sectionInfo) override; + void sectionEnded(SectionStats const& _sectionStats) override; + + void benchmarkStarting(BenchmarkInfo const& info) override; + void benchmarkEnded(BenchmarkStats const& stats) override; + + void testCaseEnded(TestCaseStats const& _testCaseStats) override; + void testGroupEnded(TestGroupStats const& _testGroupStats) override; + void testRunEnded(TestRunStats const& _testRunStats) override; + + private: + + void lazyPrint(); + + void lazyPrintWithoutClosingBenchmarkTable(); + void lazyPrintRunInfo(); + void lazyPrintGroupInfo(); + void printTestCaseAndSectionHeader(); + + void printClosedHeader(std::string const& _name); + void printOpenHeader(std::string const& _name); + + // if string has a : in first line will set indent to follow it on + // subsequent lines + void printHeaderString(std::string const& _string, std::size_t indent = 0); + + void printTotals(Totals const& totals); + void printSummaryRow(std::string const& label, std::vector const& cols, std::size_t row); + + void printTotalsDivider(Totals const& totals); + void printSummaryDivider(); + + private: + bool m_headerPrinted = false; + }; + +} // end namespace Catch + +#if defined(_MSC_VER) +#pragma warning(pop) +#endif + +// end catch_reporter_console.h +// start catch_reporter_junit.h + +// start catch_xmlwriter.h + +#include + +namespace Catch { + + class XmlEncode { + public: + enum ForWhat { ForTextNodes, ForAttributes }; + + XmlEncode( std::string const& str, ForWhat forWhat = ForTextNodes ); + + void encodeTo( std::ostream& os ) const; + + friend std::ostream& operator << ( std::ostream& os, XmlEncode const& xmlEncode ); + + private: + std::string m_str; + ForWhat m_forWhat; + }; + + class XmlWriter { + public: + + class ScopedElement { + public: + ScopedElement( XmlWriter* writer ); + + ScopedElement( ScopedElement&& other ) noexcept; + ScopedElement& operator=( ScopedElement&& other ) noexcept; + + ~ScopedElement(); + + ScopedElement& writeText( std::string const& text, bool indent = true ); + + template + ScopedElement& writeAttribute( std::string const& name, T const& attribute ) { + m_writer->writeAttribute( name, attribute ); + return *this; + } + + private: + mutable XmlWriter* m_writer = nullptr; + }; + + XmlWriter( std::ostream& os = Catch::cout() ); + ~XmlWriter(); + + XmlWriter( XmlWriter const& ) = delete; + XmlWriter& operator=( XmlWriter const& ) = delete; + + XmlWriter& startElement( std::string const& name ); + + ScopedElement scopedElement( std::string const& name ); + + XmlWriter& endElement(); + + XmlWriter& writeAttribute( std::string const& name, std::string const& attribute ); + + XmlWriter& writeAttribute( std::string const& name, bool attribute ); + + template + XmlWriter& writeAttribute( std::string const& name, T const& attribute ) { + ReusableStringStream rss; + rss << attribute; + return writeAttribute( name, rss.str() ); + } + + XmlWriter& writeText( std::string const& text, bool indent = true ); + + XmlWriter& writeComment( std::string const& text ); + + void writeStylesheetRef( std::string const& url ); + + XmlWriter& writeBlankLine(); + + void ensureTagClosed(); + + private: + + void writeDeclaration(); + + void newlineIfNecessary(); + + bool m_tagIsOpen = false; + bool m_needsNewline = false; + std::vector m_tags; + std::string m_indent; + std::ostream& m_os; + }; + +} + +// end catch_xmlwriter.h +namespace Catch { + + class JunitReporter : public CumulativeReporterBase { + public: + JunitReporter(ReporterConfig const& _config); + + ~JunitReporter() override; + + static std::string getDescription(); + + void noMatchingTestCases(std::string const& /*spec*/) override; + + void testRunStarting(TestRunInfo const& runInfo) override; + + void testGroupStarting(GroupInfo const& groupInfo) override; + + void testCaseStarting(TestCaseInfo const& testCaseInfo) override; + bool assertionEnded(AssertionStats const& assertionStats) override; + + void testCaseEnded(TestCaseStats const& testCaseStats) override; + + void testGroupEnded(TestGroupStats const& testGroupStats) override; + + void testRunEndedCumulative() override; + + void writeGroup(TestGroupNode const& groupNode, double suiteTime); + + void writeTestCase(TestCaseNode const& testCaseNode); + + void writeSection(std::string const& className, + std::string const& rootName, + SectionNode const& sectionNode); + + void writeAssertions(SectionNode const& sectionNode); + void writeAssertion(AssertionStats const& stats); + + XmlWriter xml; + Timer suiteTimer; + std::string stdOutForSuite; + std::string stdErrForSuite; + unsigned int unexpectedExceptions = 0; + bool m_okToFail = false; + }; + +} // end namespace Catch + +// end catch_reporter_junit.h +// start catch_reporter_xml.h + +namespace Catch { + class XmlReporter : public StreamingReporterBase { + public: + XmlReporter(ReporterConfig const& _config); + + ~XmlReporter() override; + + static std::string getDescription(); + + virtual std::string getStylesheetRef() const; + + void writeSourceInfo(SourceLineInfo const& sourceInfo); + + public: // StreamingReporterBase + + void noMatchingTestCases(std::string const& s) override; + + void testRunStarting(TestRunInfo const& testInfo) override; + + void testGroupStarting(GroupInfo const& groupInfo) override; + + void testCaseStarting(TestCaseInfo const& testInfo) override; + + void sectionStarting(SectionInfo const& sectionInfo) override; + + void assertionStarting(AssertionInfo const&) override; + + bool assertionEnded(AssertionStats const& assertionStats) override; + + void sectionEnded(SectionStats const& sectionStats) override; + + void testCaseEnded(TestCaseStats const& testCaseStats) override; + + void testGroupEnded(TestGroupStats const& testGroupStats) override; + + void testRunEnded(TestRunStats const& testRunStats) override; + + private: + Timer m_testCaseTimer; + XmlWriter m_xml; + int m_sectionDepth = 0; + }; + +} // end namespace Catch + +// end catch_reporter_xml.h + +// end catch_external_interfaces.h +#endif + +#endif // ! CATCH_CONFIG_IMPL_ONLY + +#ifdef CATCH_IMPL +// start catch_impl.hpp + +#ifdef __clang__ +#pragma clang diagnostic push +#pragma clang diagnostic ignored "-Wweak-vtables" +#endif + +// Keep these here for external reporters +// start catch_test_case_tracker.h + +#include +#include +#include + +namespace Catch { +namespace TestCaseTracking { + + struct NameAndLocation { + std::string name; + SourceLineInfo location; + + NameAndLocation( std::string const& _name, SourceLineInfo const& _location ); + }; + + struct ITracker; + + using ITrackerPtr = std::shared_ptr; + + struct ITracker { + virtual ~ITracker(); + + // static queries + virtual NameAndLocation const& nameAndLocation() const = 0; + + // dynamic queries + virtual bool isComplete() const = 0; // Successfully completed or failed + virtual bool isSuccessfullyCompleted() const = 0; + virtual bool isOpen() const = 0; // Started but not complete + virtual bool hasChildren() const = 0; + + virtual ITracker& parent() = 0; + + // actions + virtual void close() = 0; // Successfully complete + virtual void fail() = 0; + virtual void markAsNeedingAnotherRun() = 0; + + virtual void addChild( ITrackerPtr const& child ) = 0; + virtual ITrackerPtr findChild( NameAndLocation const& nameAndLocation ) = 0; + virtual void openChild() = 0; + + // Debug/ checking + virtual bool isSectionTracker() const = 0; + virtual bool isGeneratorTracker() const = 0; + }; + + class TrackerContext { + + enum RunState { + NotStarted, + Executing, + CompletedCycle + }; + + ITrackerPtr m_rootTracker; + ITracker* m_currentTracker = nullptr; + RunState m_runState = NotStarted; + + public: + + static TrackerContext& instance(); + + ITracker& startRun(); + void endRun(); + + void startCycle(); + void completeCycle(); + + bool completedCycle() const; + ITracker& currentTracker(); + void setCurrentTracker( ITracker* tracker ); + }; + + class TrackerBase : public ITracker { + protected: + enum CycleState { + NotStarted, + Executing, + ExecutingChildren, + NeedsAnotherRun, + CompletedSuccessfully, + Failed + }; + + using Children = std::vector; + NameAndLocation m_nameAndLocation; + TrackerContext& m_ctx; + ITracker* m_parent; + Children m_children; + CycleState m_runState = NotStarted; + + public: + TrackerBase( NameAndLocation const& nameAndLocation, TrackerContext& ctx, ITracker* parent ); + + NameAndLocation const& nameAndLocation() const override; + bool isComplete() const override; + bool isSuccessfullyCompleted() const override; + bool isOpen() const override; + bool hasChildren() const override; + + void addChild( ITrackerPtr const& child ) override; + + ITrackerPtr findChild( NameAndLocation const& nameAndLocation ) override; + ITracker& parent() override; + + void openChild() override; + + bool isSectionTracker() const override; + bool isGeneratorTracker() const override; + + void open(); + + void close() override; + void fail() override; + void markAsNeedingAnotherRun() override; + + private: + void moveToParent(); + void moveToThis(); + }; + + class SectionTracker : public TrackerBase { + std::vector m_filters; + public: + SectionTracker( NameAndLocation const& nameAndLocation, TrackerContext& ctx, ITracker* parent ); + + bool isSectionTracker() const override; + + bool isComplete() const override; + + static SectionTracker& acquire( TrackerContext& ctx, NameAndLocation const& nameAndLocation ); + + void tryOpen(); + + void addInitialFilters( std::vector const& filters ); + void addNextFilters( std::vector const& filters ); + }; + +} // namespace TestCaseTracking + +using TestCaseTracking::ITracker; +using TestCaseTracking::TrackerContext; +using TestCaseTracking::SectionTracker; + +} // namespace Catch + +// end catch_test_case_tracker.h + +// start catch_leak_detector.h + +namespace Catch { + + struct LeakDetector { + LeakDetector(); + ~LeakDetector(); + }; + +} +// end catch_leak_detector.h +// Cpp files will be included in the single-header file here +// start catch_approx.cpp + +#include +#include + +namespace { + +// Performs equivalent check of std::fabs(lhs - rhs) <= margin +// But without the subtraction to allow for INFINITY in comparison +bool marginComparison(double lhs, double rhs, double margin) { + return (lhs + margin >= rhs) && (rhs + margin >= lhs); +} + +} + +namespace Catch { +namespace Detail { + + Approx::Approx ( double value ) + : m_epsilon( std::numeric_limits::epsilon()*100 ), + m_margin( 0.0 ), + m_scale( 0.0 ), + m_value( value ) + {} + + Approx Approx::custom() { + return Approx( 0 ); + } + + Approx Approx::operator-() const { + auto temp(*this); + temp.m_value = -temp.m_value; + return temp; + } + + std::string Approx::toString() const { + ReusableStringStream rss; + rss << "Approx( " << ::Catch::Detail::stringify( m_value ) << " )"; + return rss.str(); + } + + bool Approx::equalityComparisonImpl(const double other) const { + // First try with fixed margin, then compute margin based on epsilon, scale and Approx's value + // Thanks to Richard Harris for his help refining the scaled margin value + return marginComparison(m_value, other, m_margin) || marginComparison(m_value, other, m_epsilon * (m_scale + std::fabs(m_value))); + } + + void Approx::setMargin(double margin) { + CATCH_ENFORCE(margin >= 0, + "Invalid Approx::margin: " << margin << '.' + << " Approx::Margin has to be non-negative."); + m_margin = margin; + } + + void Approx::setEpsilon(double epsilon) { + CATCH_ENFORCE(epsilon >= 0 && epsilon <= 1.0, + "Invalid Approx::epsilon: " << epsilon << '.' + << " Approx::epsilon has to be in [0, 1]"); + m_epsilon = epsilon; + } + +} // end namespace Detail + +namespace literals { + Detail::Approx operator "" _a(long double val) { + return Detail::Approx(val); + } + Detail::Approx operator "" _a(unsigned long long val) { + return Detail::Approx(val); + } +} // end namespace literals + +std::string StringMaker::convert(Catch::Detail::Approx const& value) { + return value.toString(); +} + +} // end namespace Catch +// end catch_approx.cpp +// start catch_assertionhandler.cpp + +// start catch_debugger.h + +namespace Catch { + bool isDebuggerActive(); +} + +#ifdef CATCH_PLATFORM_MAC + + #define CATCH_TRAP() __asm__("int $3\n" : : ) /* NOLINT */ + +#elif defined(CATCH_PLATFORM_LINUX) + // If we can use inline assembler, do it because this allows us to break + // directly at the location of the failing check instead of breaking inside + // raise() called from it, i.e. one stack frame below. + #if defined(__GNUC__) && (defined(__i386) || defined(__x86_64)) + #define CATCH_TRAP() asm volatile ("int $3") /* NOLINT */ + #else // Fall back to the generic way. + #include + + #define CATCH_TRAP() raise(SIGTRAP) + #endif +#elif defined(_MSC_VER) + #define CATCH_TRAP() __debugbreak() +#elif defined(__MINGW32__) + extern "C" __declspec(dllimport) void __stdcall DebugBreak(); + #define CATCH_TRAP() DebugBreak() +#endif + +#ifdef CATCH_TRAP + #define CATCH_BREAK_INTO_DEBUGGER() []{ if( Catch::isDebuggerActive() ) { CATCH_TRAP(); } }() +#else + #define CATCH_BREAK_INTO_DEBUGGER() []{}() +#endif + +// end catch_debugger.h +// start catch_run_context.h + +// start catch_fatal_condition.h + +// start catch_windows_h_proxy.h + + +#if defined(CATCH_PLATFORM_WINDOWS) + +#if !defined(NOMINMAX) && !defined(CATCH_CONFIG_NO_NOMINMAX) +# define CATCH_DEFINED_NOMINMAX +# define NOMINMAX +#endif +#if !defined(WIN32_LEAN_AND_MEAN) && !defined(CATCH_CONFIG_NO_WIN32_LEAN_AND_MEAN) +# define CATCH_DEFINED_WIN32_LEAN_AND_MEAN +# define WIN32_LEAN_AND_MEAN +#endif + +#ifdef __AFXDLL +#include +#else +#include +#endif + +#ifdef CATCH_DEFINED_NOMINMAX +# undef NOMINMAX +#endif +#ifdef CATCH_DEFINED_WIN32_LEAN_AND_MEAN +# undef WIN32_LEAN_AND_MEAN +#endif + +#endif // defined(CATCH_PLATFORM_WINDOWS) + +// end catch_windows_h_proxy.h +#if defined( CATCH_CONFIG_WINDOWS_SEH ) + +namespace Catch { + + struct FatalConditionHandler { + + static LONG CALLBACK handleVectoredException(PEXCEPTION_POINTERS ExceptionInfo); + FatalConditionHandler(); + static void reset(); + ~FatalConditionHandler(); + + private: + static bool isSet; + static ULONG guaranteeSize; + static PVOID exceptionHandlerHandle; + }; + +} // namespace Catch + +#elif defined ( CATCH_CONFIG_POSIX_SIGNALS ) + +#include + +namespace Catch { + + struct FatalConditionHandler { + + static bool isSet; + static struct sigaction oldSigActions[]; + static stack_t oldSigStack; + static char altStackMem[]; + + static void handleSignal( int sig ); + + FatalConditionHandler(); + ~FatalConditionHandler(); + static void reset(); + }; + +} // namespace Catch + +#else + +namespace Catch { + struct FatalConditionHandler { + void reset(); + }; +} + +#endif + +// end catch_fatal_condition.h +#include + +namespace Catch { + + struct IMutableContext; + + /////////////////////////////////////////////////////////////////////////// + + class RunContext : public IResultCapture, public IRunner { + + public: + RunContext( RunContext const& ) = delete; + RunContext& operator =( RunContext const& ) = delete; + + explicit RunContext( IConfigPtr const& _config, IStreamingReporterPtr&& reporter ); + + ~RunContext() override; + + void testGroupStarting( std::string const& testSpec, std::size_t groupIndex, std::size_t groupsCount ); + void testGroupEnded( std::string const& testSpec, Totals const& totals, std::size_t groupIndex, std::size_t groupsCount ); + + Totals runTest(TestCase const& testCase); + + IConfigPtr config() const; + IStreamingReporter& reporter() const; + + public: // IResultCapture + + // Assertion handlers + void handleExpr + ( AssertionInfo const& info, + ITransientExpression const& expr, + AssertionReaction& reaction ) override; + void handleMessage + ( AssertionInfo const& info, + ResultWas::OfType resultType, + StringRef const& message, + AssertionReaction& reaction ) override; + void handleUnexpectedExceptionNotThrown + ( AssertionInfo const& info, + AssertionReaction& reaction ) override; + void handleUnexpectedInflightException + ( AssertionInfo const& info, + std::string const& message, + AssertionReaction& reaction ) override; + void handleIncomplete + ( AssertionInfo const& info ) override; + void handleNonExpr + ( AssertionInfo const &info, + ResultWas::OfType resultType, + AssertionReaction &reaction ) override; + + bool sectionStarted( SectionInfo const& sectionInfo, Counts& assertions ) override; + + void sectionEnded( SectionEndInfo const& endInfo ) override; + void sectionEndedEarly( SectionEndInfo const& endInfo ) override; + + auto acquireGeneratorTracker( SourceLineInfo const& lineInfo ) -> IGeneratorTracker& override; + + void benchmarkStarting( BenchmarkInfo const& info ) override; + void benchmarkEnded( BenchmarkStats const& stats ) override; + + void pushScopedMessage( MessageInfo const& message ) override; + void popScopedMessage( MessageInfo const& message ) override; + + void emplaceUnscopedMessage( MessageBuilder const& builder ) override; + + std::string getCurrentTestName() const override; + + const AssertionResult* getLastResult() const override; + + void exceptionEarlyReported() override; + + void handleFatalErrorCondition( StringRef message ) override; + + bool lastAssertionPassed() override; + + void assertionPassed() override; + + public: + // !TBD We need to do this another way! + bool aborting() const final; + + private: + + void runCurrentTest( std::string& redirectedCout, std::string& redirectedCerr ); + void invokeActiveTestCase(); + + void resetAssertionInfo(); + bool testForMissingAssertions( Counts& assertions ); + + void assertionEnded( AssertionResult const& result ); + void reportExpr + ( AssertionInfo const &info, + ResultWas::OfType resultType, + ITransientExpression const *expr, + bool negated ); + + void populateReaction( AssertionReaction& reaction ); + + private: + + void handleUnfinishedSections(); + + TestRunInfo m_runInfo; + IMutableContext& m_context; + TestCase const* m_activeTestCase = nullptr; + ITracker* m_testCaseTracker = nullptr; + Option m_lastResult; + + IConfigPtr m_config; + Totals m_totals; + IStreamingReporterPtr m_reporter; + std::vector m_messages; + std::vector m_messageScopes; /* Keeps owners of so-called unscoped messages. */ + AssertionInfo m_lastAssertionInfo; + std::vector m_unfinishedSections; + std::vector m_activeSections; + TrackerContext m_trackerContext; + bool m_lastAssertionPassed = false; + bool m_shouldReportUnexpected = true; + bool m_includeSuccessfulResults; + }; + +} // end namespace Catch + +// end catch_run_context.h +namespace Catch { + + namespace { + auto operator <<( std::ostream& os, ITransientExpression const& expr ) -> std::ostream& { + expr.streamReconstructedExpression( os ); + return os; + } + } + + LazyExpression::LazyExpression( bool isNegated ) + : m_isNegated( isNegated ) + {} + + LazyExpression::LazyExpression( LazyExpression const& other ) : m_isNegated( other.m_isNegated ) {} + + LazyExpression::operator bool() const { + return m_transientExpression != nullptr; + } + + auto operator << ( std::ostream& os, LazyExpression const& lazyExpr ) -> std::ostream& { + if( lazyExpr.m_isNegated ) + os << "!"; + + if( lazyExpr ) { + if( lazyExpr.m_isNegated && lazyExpr.m_transientExpression->isBinaryExpression() ) + os << "(" << *lazyExpr.m_transientExpression << ")"; + else + os << *lazyExpr.m_transientExpression; + } + else { + os << "{** error - unchecked empty expression requested **}"; + } + return os; + } + + AssertionHandler::AssertionHandler + ( StringRef const& macroName, + SourceLineInfo const& lineInfo, + StringRef capturedExpression, + ResultDisposition::Flags resultDisposition ) + : m_assertionInfo{ macroName, lineInfo, capturedExpression, resultDisposition }, + m_resultCapture( getResultCapture() ) + {} + + void AssertionHandler::handleExpr( ITransientExpression const& expr ) { + m_resultCapture.handleExpr( m_assertionInfo, expr, m_reaction ); + } + void AssertionHandler::handleMessage(ResultWas::OfType resultType, StringRef const& message) { + m_resultCapture.handleMessage( m_assertionInfo, resultType, message, m_reaction ); + } + + auto AssertionHandler::allowThrows() const -> bool { + return getCurrentContext().getConfig()->allowThrows(); + } + + void AssertionHandler::complete() { + setCompleted(); + if( m_reaction.shouldDebugBreak ) { + + // If you find your debugger stopping you here then go one level up on the + // call-stack for the code that caused it (typically a failed assertion) + + // (To go back to the test and change execution, jump over the throw, next) + CATCH_BREAK_INTO_DEBUGGER(); + } + if (m_reaction.shouldThrow) { +#if !defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) + throw Catch::TestFailureException(); +#else + CATCH_ERROR( "Test failure requires aborting test!" ); +#endif + } + } + void AssertionHandler::setCompleted() { + m_completed = true; + } + + void AssertionHandler::handleUnexpectedInflightException() { + m_resultCapture.handleUnexpectedInflightException( m_assertionInfo, Catch::translateActiveException(), m_reaction ); + } + + void AssertionHandler::handleExceptionThrownAsExpected() { + m_resultCapture.handleNonExpr(m_assertionInfo, ResultWas::Ok, m_reaction); + } + void AssertionHandler::handleExceptionNotThrownAsExpected() { + m_resultCapture.handleNonExpr(m_assertionInfo, ResultWas::Ok, m_reaction); + } + + void AssertionHandler::handleUnexpectedExceptionNotThrown() { + m_resultCapture.handleUnexpectedExceptionNotThrown( m_assertionInfo, m_reaction ); + } + + void AssertionHandler::handleThrowingCallSkipped() { + m_resultCapture.handleNonExpr(m_assertionInfo, ResultWas::Ok, m_reaction); + } + + // This is the overload that takes a string and infers the Equals matcher from it + // The more general overload, that takes any string matcher, is in catch_capture_matchers.cpp + void handleExceptionMatchExpr( AssertionHandler& handler, std::string const& str, StringRef const& matcherString ) { + handleExceptionMatchExpr( handler, Matchers::Equals( str ), matcherString ); + } + +} // namespace Catch +// end catch_assertionhandler.cpp +// start catch_assertionresult.cpp + +namespace Catch { + AssertionResultData::AssertionResultData(ResultWas::OfType _resultType, LazyExpression const & _lazyExpression): + lazyExpression(_lazyExpression), + resultType(_resultType) {} + + std::string AssertionResultData::reconstructExpression() const { + + if( reconstructedExpression.empty() ) { + if( lazyExpression ) { + ReusableStringStream rss; + rss << lazyExpression; + reconstructedExpression = rss.str(); + } + } + return reconstructedExpression; + } + + AssertionResult::AssertionResult( AssertionInfo const& info, AssertionResultData const& data ) + : m_info( info ), + m_resultData( data ) + {} + + // Result was a success + bool AssertionResult::succeeded() const { + return Catch::isOk( m_resultData.resultType ); + } + + // Result was a success, or failure is suppressed + bool AssertionResult::isOk() const { + return Catch::isOk( m_resultData.resultType ) || shouldSuppressFailure( m_info.resultDisposition ); + } + + ResultWas::OfType AssertionResult::getResultType() const { + return m_resultData.resultType; + } + + bool AssertionResult::hasExpression() const { + return m_info.capturedExpression[0] != 0; + } + + bool AssertionResult::hasMessage() const { + return !m_resultData.message.empty(); + } + + std::string AssertionResult::getExpression() const { + if( isFalseTest( m_info.resultDisposition ) ) + return "!(" + m_info.capturedExpression + ")"; + else + return m_info.capturedExpression; + } + + std::string AssertionResult::getExpressionInMacro() const { + std::string expr; + if( m_info.macroName[0] == 0 ) + expr = m_info.capturedExpression; + else { + expr.reserve( m_info.macroName.size() + m_info.capturedExpression.size() + 4 ); + expr += m_info.macroName; + expr += "( "; + expr += m_info.capturedExpression; + expr += " )"; + } + return expr; + } + + bool AssertionResult::hasExpandedExpression() const { + return hasExpression() && getExpandedExpression() != getExpression(); + } + + std::string AssertionResult::getExpandedExpression() const { + std::string expr = m_resultData.reconstructExpression(); + return expr.empty() + ? getExpression() + : expr; + } + + std::string AssertionResult::getMessage() const { + return m_resultData.message; + } + SourceLineInfo AssertionResult::getSourceInfo() const { + return m_info.lineInfo; + } + + StringRef AssertionResult::getTestMacroName() const { + return m_info.macroName; + } + +} // end namespace Catch +// end catch_assertionresult.cpp +// start catch_benchmark.cpp + +namespace Catch { + + auto BenchmarkLooper::getResolution() -> uint64_t { + return getEstimatedClockResolution() * getCurrentContext().getConfig()->benchmarkResolutionMultiple(); + } + + void BenchmarkLooper::reportStart() { + getResultCapture().benchmarkStarting( { m_name } ); + } + auto BenchmarkLooper::needsMoreIterations() -> bool { + auto elapsed = m_timer.getElapsedNanoseconds(); + + // Exponentially increasing iterations until we're confident in our timer resolution + if( elapsed < m_resolution ) { + m_iterationsToRun *= 10; + return true; + } + + getResultCapture().benchmarkEnded( { { m_name }, m_count, elapsed } ); + return false; + } + +} // end namespace Catch +// end catch_benchmark.cpp +// start catch_capture_matchers.cpp + +namespace Catch { + + using StringMatcher = Matchers::Impl::MatcherBase; + + // This is the general overload that takes a any string matcher + // There is another overload, in catch_assertionhandler.h/.cpp, that only takes a string and infers + // the Equals matcher (so the header does not mention matchers) + void handleExceptionMatchExpr( AssertionHandler& handler, StringMatcher const& matcher, StringRef const& matcherString ) { + std::string exceptionMessage = Catch::translateActiveException(); + MatchExpr expr( exceptionMessage, matcher, matcherString ); + handler.handleExpr( expr ); + } + +} // namespace Catch +// end catch_capture_matchers.cpp +// start catch_commandline.cpp + +// start catch_commandline.h + +// start catch_clara.h + +// Use Catch's value for console width (store Clara's off to the side, if present) +#ifdef CLARA_CONFIG_CONSOLE_WIDTH +#define CATCH_TEMP_CLARA_CONFIG_CONSOLE_WIDTH CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH +#undef CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH +#endif +#define CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH CATCH_CONFIG_CONSOLE_WIDTH-1 + +#ifdef __clang__ +#pragma clang diagnostic push +#pragma clang diagnostic ignored "-Wweak-vtables" +#pragma clang diagnostic ignored "-Wexit-time-destructors" +#pragma clang diagnostic ignored "-Wshadow" +#endif + +// start clara.hpp +// Copyright 2017 Two Blue Cubes Ltd. All rights reserved. +// +// Distributed under the Boost Software License, Version 1.0. (See accompanying +// file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt) +// +// See https://github.com/philsquared/Clara for more details + +// Clara v1.1.5 + + +#ifndef CATCH_CLARA_CONFIG_CONSOLE_WIDTH +#define CATCH_CLARA_CONFIG_CONSOLE_WIDTH 80 +#endif + +#ifndef CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH +#define CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH CATCH_CLARA_CONFIG_CONSOLE_WIDTH +#endif + +#ifndef CLARA_CONFIG_OPTIONAL_TYPE +#ifdef __has_include +#if __has_include() && __cplusplus >= 201703L +#include +#define CLARA_CONFIG_OPTIONAL_TYPE std::optional +#endif +#endif +#endif + +// ----------- #included from clara_textflow.hpp ----------- + +// TextFlowCpp +// +// A single-header library for wrapping and laying out basic text, by Phil Nash +// +// Distributed under the Boost Software License, Version 1.0. (See accompanying +// file LICENSE.txt or copy at http://www.boost.org/LICENSE_1_0.txt) +// +// This project is hosted at https://github.com/philsquared/textflowcpp + + +#include +#include +#include +#include + +#ifndef CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH +#define CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH 80 +#endif + +namespace Catch { +namespace clara { +namespace TextFlow { + +inline auto isWhitespace(char c) -> bool { + static std::string chars = " \t\n\r"; + return chars.find(c) != std::string::npos; +} +inline auto isBreakableBefore(char c) -> bool { + static std::string chars = "[({<|"; + return chars.find(c) != std::string::npos; +} +inline auto isBreakableAfter(char c) -> bool { + static std::string chars = "])}>.,:;*+-=&/\\"; + return chars.find(c) != std::string::npos; +} + +class Columns; + +class Column { + std::vector m_strings; + size_t m_width = CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH; + size_t m_indent = 0; + size_t m_initialIndent = std::string::npos; + +public: + class iterator { + friend Column; + + Column const& m_column; + size_t m_stringIndex = 0; + size_t m_pos = 0; + + size_t m_len = 0; + size_t m_end = 0; + bool m_suffix = false; + + iterator(Column const& column, size_t stringIndex) + : m_column(column), + m_stringIndex(stringIndex) {} + + auto line() const -> std::string const& { return m_column.m_strings[m_stringIndex]; } + + auto isBoundary(size_t at) const -> bool { + assert(at > 0); + assert(at <= line().size()); + + return at == line().size() || + (isWhitespace(line()[at]) && !isWhitespace(line()[at - 1])) || + isBreakableBefore(line()[at]) || + isBreakableAfter(line()[at - 1]); + } + + void calcLength() { + assert(m_stringIndex < m_column.m_strings.size()); + + m_suffix = false; + auto width = m_column.m_width - indent(); + m_end = m_pos; + while (m_end < line().size() && line()[m_end] != '\n') + ++m_end; + + if (m_end < m_pos + width) { + m_len = m_end - m_pos; + } else { + size_t len = width; + while (len > 0 && !isBoundary(m_pos + len)) + --len; + while (len > 0 && isWhitespace(line()[m_pos + len - 1])) + --len; + + if (len > 0) { + m_len = len; + } else { + m_suffix = true; + m_len = width - 1; + } + } + } + + auto indent() const -> size_t { + auto initial = m_pos == 0 && m_stringIndex == 0 ? m_column.m_initialIndent : std::string::npos; + return initial == std::string::npos ? m_column.m_indent : initial; + } + + auto addIndentAndSuffix(std::string const &plain) const -> std::string { + return std::string(indent(), ' ') + (m_suffix ? plain + "-" : plain); + } + + public: + using difference_type = std::ptrdiff_t; + using value_type = std::string; + using pointer = value_type * ; + using reference = value_type & ; + using iterator_category = std::forward_iterator_tag; + + explicit iterator(Column const& column) : m_column(column) { + assert(m_column.m_width > m_column.m_indent); + assert(m_column.m_initialIndent == std::string::npos || m_column.m_width > m_column.m_initialIndent); + calcLength(); + if (m_len == 0) + m_stringIndex++; // Empty string + } + + auto operator *() const -> std::string { + assert(m_stringIndex < m_column.m_strings.size()); + assert(m_pos <= m_end); + return addIndentAndSuffix(line().substr(m_pos, m_len)); + } + + auto operator ++() -> iterator& { + m_pos += m_len; + if (m_pos < line().size() && line()[m_pos] == '\n') + m_pos += 1; + else + while (m_pos < line().size() && isWhitespace(line()[m_pos])) + ++m_pos; + + if (m_pos == line().size()) { + m_pos = 0; + ++m_stringIndex; + } + if (m_stringIndex < m_column.m_strings.size()) + calcLength(); + return *this; + } + auto operator ++(int) -> iterator { + iterator prev(*this); + operator++(); + return prev; + } + + auto operator ==(iterator const& other) const -> bool { + return + m_pos == other.m_pos && + m_stringIndex == other.m_stringIndex && + &m_column == &other.m_column; + } + auto operator !=(iterator const& other) const -> bool { + return !operator==(other); + } + }; + using const_iterator = iterator; + + explicit Column(std::string const& text) { m_strings.push_back(text); } + + auto width(size_t newWidth) -> Column& { + assert(newWidth > 0); + m_width = newWidth; + return *this; + } + auto indent(size_t newIndent) -> Column& { + m_indent = newIndent; + return *this; + } + auto initialIndent(size_t newIndent) -> Column& { + m_initialIndent = newIndent; + return *this; + } + + auto width() const -> size_t { return m_width; } + auto begin() const -> iterator { return iterator(*this); } + auto end() const -> iterator { return { *this, m_strings.size() }; } + + inline friend std::ostream& operator << (std::ostream& os, Column const& col) { + bool first = true; + for (auto line : col) { + if (first) + first = false; + else + os << "\n"; + os << line; + } + return os; + } + + auto operator + (Column const& other)->Columns; + + auto toString() const -> std::string { + std::ostringstream oss; + oss << *this; + return oss.str(); + } +}; + +class Spacer : public Column { + +public: + explicit Spacer(size_t spaceWidth) : Column("") { + width(spaceWidth); + } +}; + +class Columns { + std::vector m_columns; + +public: + + class iterator { + friend Columns; + struct EndTag {}; + + std::vector const& m_columns; + std::vector m_iterators; + size_t m_activeIterators; + + iterator(Columns const& columns, EndTag) + : m_columns(columns.m_columns), + m_activeIterators(0) { + m_iterators.reserve(m_columns.size()); + + for (auto const& col : m_columns) + m_iterators.push_back(col.end()); + } + + public: + using difference_type = std::ptrdiff_t; + using value_type = std::string; + using pointer = value_type * ; + using reference = value_type & ; + using iterator_category = std::forward_iterator_tag; + + explicit iterator(Columns const& columns) + : m_columns(columns.m_columns), + m_activeIterators(m_columns.size()) { + m_iterators.reserve(m_columns.size()); + + for (auto const& col : m_columns) + m_iterators.push_back(col.begin()); + } + + auto operator ==(iterator const& other) const -> bool { + return m_iterators == other.m_iterators; + } + auto operator !=(iterator const& other) const -> bool { + return m_iterators != other.m_iterators; + } + auto operator *() const -> std::string { + std::string row, padding; + + for (size_t i = 0; i < m_columns.size(); ++i) { + auto width = m_columns[i].width(); + if (m_iterators[i] != m_columns[i].end()) { + std::string col = *m_iterators[i]; + row += padding + col; + if (col.size() < width) + padding = std::string(width - col.size(), ' '); + else + padding = ""; + } else { + padding += std::string(width, ' '); + } + } + return row; + } + auto operator ++() -> iterator& { + for (size_t i = 0; i < m_columns.size(); ++i) { + if (m_iterators[i] != m_columns[i].end()) + ++m_iterators[i]; + } + return *this; + } + auto operator ++(int) -> iterator { + iterator prev(*this); + operator++(); + return prev; + } + }; + using const_iterator = iterator; + + auto begin() const -> iterator { return iterator(*this); } + auto end() const -> iterator { return { *this, iterator::EndTag() }; } + + auto operator += (Column const& col) -> Columns& { + m_columns.push_back(col); + return *this; + } + auto operator + (Column const& col) -> Columns { + Columns combined = *this; + combined += col; + return combined; + } + + inline friend std::ostream& operator << (std::ostream& os, Columns const& cols) { + + bool first = true; + for (auto line : cols) { + if (first) + first = false; + else + os << "\n"; + os << line; + } + return os; + } + + auto toString() const -> std::string { + std::ostringstream oss; + oss << *this; + return oss.str(); + } +}; + +inline auto Column::operator + (Column const& other) -> Columns { + Columns cols; + cols += *this; + cols += other; + return cols; +} +} + +} +} + +// ----------- end of #include from clara_textflow.hpp ----------- +// ........... back in clara.hpp + +#include +#include +#include +#include +#include + +#if !defined(CATCH_PLATFORM_WINDOWS) && ( defined(WIN32) || defined(__WIN32__) || defined(_WIN32) || defined(_MSC_VER) ) +#define CATCH_PLATFORM_WINDOWS +#endif + +namespace Catch { namespace clara { +namespace detail { + + // Traits for extracting arg and return type of lambdas (for single argument lambdas) + template + struct UnaryLambdaTraits : UnaryLambdaTraits {}; + + template + struct UnaryLambdaTraits { + static const bool isValid = false; + }; + + template + struct UnaryLambdaTraits { + static const bool isValid = true; + using ArgType = typename std::remove_const::type>::type; + using ReturnType = ReturnT; + }; + + class TokenStream; + + // Transport for raw args (copied from main args, or supplied via init list for testing) + class Args { + friend TokenStream; + std::string m_exeName; + std::vector m_args; + + public: + Args( int argc, char const* const* argv ) + : m_exeName(argv[0]), + m_args(argv + 1, argv + argc) {} + + Args( std::initializer_list args ) + : m_exeName( *args.begin() ), + m_args( args.begin()+1, args.end() ) + {} + + auto exeName() const -> std::string { + return m_exeName; + } + }; + + // Wraps a token coming from a token stream. These may not directly correspond to strings as a single string + // may encode an option + its argument if the : or = form is used + enum class TokenType { + Option, Argument + }; + struct Token { + TokenType type; + std::string token; + }; + + inline auto isOptPrefix( char c ) -> bool { + return c == '-' +#ifdef CATCH_PLATFORM_WINDOWS + || c == '/' +#endif + ; + } + + // Abstracts iterators into args as a stream of tokens, with option arguments uniformly handled + class TokenStream { + using Iterator = std::vector::const_iterator; + Iterator it; + Iterator itEnd; + std::vector m_tokenBuffer; + + void loadBuffer() { + m_tokenBuffer.resize( 0 ); + + // Skip any empty strings + while( it != itEnd && it->empty() ) + ++it; + + if( it != itEnd ) { + auto const &next = *it; + if( isOptPrefix( next[0] ) ) { + auto delimiterPos = next.find_first_of( " :=" ); + if( delimiterPos != std::string::npos ) { + m_tokenBuffer.push_back( { TokenType::Option, next.substr( 0, delimiterPos ) } ); + m_tokenBuffer.push_back( { TokenType::Argument, next.substr( delimiterPos + 1 ) } ); + } else { + if( next[1] != '-' && next.size() > 2 ) { + std::string opt = "- "; + for( size_t i = 1; i < next.size(); ++i ) { + opt[1] = next[i]; + m_tokenBuffer.push_back( { TokenType::Option, opt } ); + } + } else { + m_tokenBuffer.push_back( { TokenType::Option, next } ); + } + } + } else { + m_tokenBuffer.push_back( { TokenType::Argument, next } ); + } + } + } + + public: + explicit TokenStream( Args const &args ) : TokenStream( args.m_args.begin(), args.m_args.end() ) {} + + TokenStream( Iterator it, Iterator itEnd ) : it( it ), itEnd( itEnd ) { + loadBuffer(); + } + + explicit operator bool() const { + return !m_tokenBuffer.empty() || it != itEnd; + } + + auto count() const -> size_t { return m_tokenBuffer.size() + (itEnd - it); } + + auto operator*() const -> Token { + assert( !m_tokenBuffer.empty() ); + return m_tokenBuffer.front(); + } + + auto operator->() const -> Token const * { + assert( !m_tokenBuffer.empty() ); + return &m_tokenBuffer.front(); + } + + auto operator++() -> TokenStream & { + if( m_tokenBuffer.size() >= 2 ) { + m_tokenBuffer.erase( m_tokenBuffer.begin() ); + } else { + if( it != itEnd ) + ++it; + loadBuffer(); + } + return *this; + } + }; + + class ResultBase { + public: + enum Type { + Ok, LogicError, RuntimeError + }; + + protected: + ResultBase( Type type ) : m_type( type ) {} + virtual ~ResultBase() = default; + + virtual void enforceOk() const = 0; + + Type m_type; + }; + + template + class ResultValueBase : public ResultBase { + public: + auto value() const -> T const & { + enforceOk(); + return m_value; + } + + protected: + ResultValueBase( Type type ) : ResultBase( type ) {} + + ResultValueBase( ResultValueBase const &other ) : ResultBase( other ) { + if( m_type == ResultBase::Ok ) + new( &m_value ) T( other.m_value ); + } + + ResultValueBase( Type, T const &value ) : ResultBase( Ok ) { + new( &m_value ) T( value ); + } + + auto operator=( ResultValueBase const &other ) -> ResultValueBase & { + if( m_type == ResultBase::Ok ) + m_value.~T(); + ResultBase::operator=(other); + if( m_type == ResultBase::Ok ) + new( &m_value ) T( other.m_value ); + return *this; + } + + ~ResultValueBase() override { + if( m_type == Ok ) + m_value.~T(); + } + + union { + T m_value; + }; + }; + + template<> + class ResultValueBase : public ResultBase { + protected: + using ResultBase::ResultBase; + }; + + template + class BasicResult : public ResultValueBase { + public: + template + explicit BasicResult( BasicResult const &other ) + : ResultValueBase( other.type() ), + m_errorMessage( other.errorMessage() ) + { + assert( type() != ResultBase::Ok ); + } + + template + static auto ok( U const &value ) -> BasicResult { return { ResultBase::Ok, value }; } + static auto ok() -> BasicResult { return { ResultBase::Ok }; } + static auto logicError( std::string const &message ) -> BasicResult { return { ResultBase::LogicError, message }; } + static auto runtimeError( std::string const &message ) -> BasicResult { return { ResultBase::RuntimeError, message }; } + + explicit operator bool() const { return m_type == ResultBase::Ok; } + auto type() const -> ResultBase::Type { return m_type; } + auto errorMessage() const -> std::string { return m_errorMessage; } + + protected: + void enforceOk() const override { + + // Errors shouldn't reach this point, but if they do + // the actual error message will be in m_errorMessage + assert( m_type != ResultBase::LogicError ); + assert( m_type != ResultBase::RuntimeError ); + if( m_type != ResultBase::Ok ) + std::abort(); + } + + std::string m_errorMessage; // Only populated if resultType is an error + + BasicResult( ResultBase::Type type, std::string const &message ) + : ResultValueBase(type), + m_errorMessage(message) + { + assert( m_type != ResultBase::Ok ); + } + + using ResultValueBase::ResultValueBase; + using ResultBase::m_type; + }; + + enum class ParseResultType { + Matched, NoMatch, ShortCircuitAll, ShortCircuitSame + }; + + class ParseState { + public: + + ParseState( ParseResultType type, TokenStream const &remainingTokens ) + : m_type(type), + m_remainingTokens( remainingTokens ) + {} + + auto type() const -> ParseResultType { return m_type; } + auto remainingTokens() const -> TokenStream { return m_remainingTokens; } + + private: + ParseResultType m_type; + TokenStream m_remainingTokens; + }; + + using Result = BasicResult; + using ParserResult = BasicResult; + using InternalParseResult = BasicResult; + + struct HelpColumns { + std::string left; + std::string right; + }; + + template + inline auto convertInto( std::string const &source, T& target ) -> ParserResult { + std::stringstream ss; + ss << source; + ss >> target; + if( ss.fail() ) + return ParserResult::runtimeError( "Unable to convert '" + source + "' to destination type" ); + else + return ParserResult::ok( ParseResultType::Matched ); + } + inline auto convertInto( std::string const &source, std::string& target ) -> ParserResult { + target = source; + return ParserResult::ok( ParseResultType::Matched ); + } + inline auto convertInto( std::string const &source, bool &target ) -> ParserResult { + std::string srcLC = source; + std::transform( srcLC.begin(), srcLC.end(), srcLC.begin(), []( char c ) { return static_cast( std::tolower(c) ); } ); + if (srcLC == "y" || srcLC == "1" || srcLC == "true" || srcLC == "yes" || srcLC == "on") + target = true; + else if (srcLC == "n" || srcLC == "0" || srcLC == "false" || srcLC == "no" || srcLC == "off") + target = false; + else + return ParserResult::runtimeError( "Expected a boolean value but did not recognise: '" + source + "'" ); + return ParserResult::ok( ParseResultType::Matched ); + } +#ifdef CLARA_CONFIG_OPTIONAL_TYPE + template + inline auto convertInto( std::string const &source, CLARA_CONFIG_OPTIONAL_TYPE& target ) -> ParserResult { + T temp; + auto result = convertInto( source, temp ); + if( result ) + target = std::move(temp); + return result; + } +#endif // CLARA_CONFIG_OPTIONAL_TYPE + + struct NonCopyable { + NonCopyable() = default; + NonCopyable( NonCopyable const & ) = delete; + NonCopyable( NonCopyable && ) = delete; + NonCopyable &operator=( NonCopyable const & ) = delete; + NonCopyable &operator=( NonCopyable && ) = delete; + }; + + struct BoundRef : NonCopyable { + virtual ~BoundRef() = default; + virtual auto isContainer() const -> bool { return false; } + virtual auto isFlag() const -> bool { return false; } + }; + struct BoundValueRefBase : BoundRef { + virtual auto setValue( std::string const &arg ) -> ParserResult = 0; + }; + struct BoundFlagRefBase : BoundRef { + virtual auto setFlag( bool flag ) -> ParserResult = 0; + virtual auto isFlag() const -> bool { return true; } + }; + + template + struct BoundValueRef : BoundValueRefBase { + T &m_ref; + + explicit BoundValueRef( T &ref ) : m_ref( ref ) {} + + auto setValue( std::string const &arg ) -> ParserResult override { + return convertInto( arg, m_ref ); + } + }; + + template + struct BoundValueRef> : BoundValueRefBase { + std::vector &m_ref; + + explicit BoundValueRef( std::vector &ref ) : m_ref( ref ) {} + + auto isContainer() const -> bool override { return true; } + + auto setValue( std::string const &arg ) -> ParserResult override { + T temp; + auto result = convertInto( arg, temp ); + if( result ) + m_ref.push_back( temp ); + return result; + } + }; + + struct BoundFlagRef : BoundFlagRefBase { + bool &m_ref; + + explicit BoundFlagRef( bool &ref ) : m_ref( ref ) {} + + auto setFlag( bool flag ) -> ParserResult override { + m_ref = flag; + return ParserResult::ok( ParseResultType::Matched ); + } + }; + + template + struct LambdaInvoker { + static_assert( std::is_same::value, "Lambda must return void or clara::ParserResult" ); + + template + static auto invoke( L const &lambda, ArgType const &arg ) -> ParserResult { + return lambda( arg ); + } + }; + + template<> + struct LambdaInvoker { + template + static auto invoke( L const &lambda, ArgType const &arg ) -> ParserResult { + lambda( arg ); + return ParserResult::ok( ParseResultType::Matched ); + } + }; + + template + inline auto invokeLambda( L const &lambda, std::string const &arg ) -> ParserResult { + ArgType temp{}; + auto result = convertInto( arg, temp ); + return !result + ? result + : LambdaInvoker::ReturnType>::invoke( lambda, temp ); + } + + template + struct BoundLambda : BoundValueRefBase { + L m_lambda; + + static_assert( UnaryLambdaTraits::isValid, "Supplied lambda must take exactly one argument" ); + explicit BoundLambda( L const &lambda ) : m_lambda( lambda ) {} + + auto setValue( std::string const &arg ) -> ParserResult override { + return invokeLambda::ArgType>( m_lambda, arg ); + } + }; + + template + struct BoundFlagLambda : BoundFlagRefBase { + L m_lambda; + + static_assert( UnaryLambdaTraits::isValid, "Supplied lambda must take exactly one argument" ); + static_assert( std::is_same::ArgType, bool>::value, "flags must be boolean" ); + + explicit BoundFlagLambda( L const &lambda ) : m_lambda( lambda ) {} + + auto setFlag( bool flag ) -> ParserResult override { + return LambdaInvoker::ReturnType>::invoke( m_lambda, flag ); + } + }; + + enum class Optionality { Optional, Required }; + + struct Parser; + + class ParserBase { + public: + virtual ~ParserBase() = default; + virtual auto validate() const -> Result { return Result::ok(); } + virtual auto parse( std::string const& exeName, TokenStream const &tokens) const -> InternalParseResult = 0; + virtual auto cardinality() const -> size_t { return 1; } + + auto parse( Args const &args ) const -> InternalParseResult { + return parse( args.exeName(), TokenStream( args ) ); + } + }; + + template + class ComposableParserImpl : public ParserBase { + public: + template + auto operator|( T const &other ) const -> Parser; + + template + auto operator+( T const &other ) const -> Parser; + }; + + // Common code and state for Args and Opts + template + class ParserRefImpl : public ComposableParserImpl { + protected: + Optionality m_optionality = Optionality::Optional; + std::shared_ptr m_ref; + std::string m_hint; + std::string m_description; + + explicit ParserRefImpl( std::shared_ptr const &ref ) : m_ref( ref ) {} + + public: + template + ParserRefImpl( T &ref, std::string const &hint ) + : m_ref( std::make_shared>( ref ) ), + m_hint( hint ) + {} + + template + ParserRefImpl( LambdaT const &ref, std::string const &hint ) + : m_ref( std::make_shared>( ref ) ), + m_hint(hint) + {} + + auto operator()( std::string const &description ) -> DerivedT & { + m_description = description; + return static_cast( *this ); + } + + auto optional() -> DerivedT & { + m_optionality = Optionality::Optional; + return static_cast( *this ); + }; + + auto required() -> DerivedT & { + m_optionality = Optionality::Required; + return static_cast( *this ); + }; + + auto isOptional() const -> bool { + return m_optionality == Optionality::Optional; + } + + auto cardinality() const -> size_t override { + if( m_ref->isContainer() ) + return 0; + else + return 1; + } + + auto hint() const -> std::string { return m_hint; } + }; + + class ExeName : public ComposableParserImpl { + std::shared_ptr m_name; + std::shared_ptr m_ref; + + template + static auto makeRef(LambdaT const &lambda) -> std::shared_ptr { + return std::make_shared>( lambda) ; + } + + public: + ExeName() : m_name( std::make_shared( "" ) ) {} + + explicit ExeName( std::string &ref ) : ExeName() { + m_ref = std::make_shared>( ref ); + } + + template + explicit ExeName( LambdaT const& lambda ) : ExeName() { + m_ref = std::make_shared>( lambda ); + } + + // The exe name is not parsed out of the normal tokens, but is handled specially + auto parse( std::string const&, TokenStream const &tokens ) const -> InternalParseResult override { + return InternalParseResult::ok( ParseState( ParseResultType::NoMatch, tokens ) ); + } + + auto name() const -> std::string { return *m_name; } + auto set( std::string const& newName ) -> ParserResult { + + auto lastSlash = newName.find_last_of( "\\/" ); + auto filename = ( lastSlash == std::string::npos ) + ? newName + : newName.substr( lastSlash+1 ); + + *m_name = filename; + if( m_ref ) + return m_ref->setValue( filename ); + else + return ParserResult::ok( ParseResultType::Matched ); + } + }; + + class Arg : public ParserRefImpl { + public: + using ParserRefImpl::ParserRefImpl; + + auto parse( std::string const &, TokenStream const &tokens ) const -> InternalParseResult override { + auto validationResult = validate(); + if( !validationResult ) + return InternalParseResult( validationResult ); + + auto remainingTokens = tokens; + auto const &token = *remainingTokens; + if( token.type != TokenType::Argument ) + return InternalParseResult::ok( ParseState( ParseResultType::NoMatch, remainingTokens ) ); + + assert( !m_ref->isFlag() ); + auto valueRef = static_cast( m_ref.get() ); + + auto result = valueRef->setValue( remainingTokens->token ); + if( !result ) + return InternalParseResult( result ); + else + return InternalParseResult::ok( ParseState( ParseResultType::Matched, ++remainingTokens ) ); + } + }; + + inline auto normaliseOpt( std::string const &optName ) -> std::string { +#ifdef CATCH_PLATFORM_WINDOWS + if( optName[0] == '/' ) + return "-" + optName.substr( 1 ); + else +#endif + return optName; + } + + class Opt : public ParserRefImpl { + protected: + std::vector m_optNames; + + public: + template + explicit Opt( LambdaT const &ref ) : ParserRefImpl( std::make_shared>( ref ) ) {} + + explicit Opt( bool &ref ) : ParserRefImpl( std::make_shared( ref ) ) {} + + template + Opt( LambdaT const &ref, std::string const &hint ) : ParserRefImpl( ref, hint ) {} + + template + Opt( T &ref, std::string const &hint ) : ParserRefImpl( ref, hint ) {} + + auto operator[]( std::string const &optName ) -> Opt & { + m_optNames.push_back( optName ); + return *this; + } + + auto getHelpColumns() const -> std::vector { + std::ostringstream oss; + bool first = true; + for( auto const &opt : m_optNames ) { + if (first) + first = false; + else + oss << ", "; + oss << opt; + } + if( !m_hint.empty() ) + oss << " <" << m_hint << ">"; + return { { oss.str(), m_description } }; + } + + auto isMatch( std::string const &optToken ) const -> bool { + auto normalisedToken = normaliseOpt( optToken ); + for( auto const &name : m_optNames ) { + if( normaliseOpt( name ) == normalisedToken ) + return true; + } + return false; + } + + using ParserBase::parse; + + auto parse( std::string const&, TokenStream const &tokens ) const -> InternalParseResult override { + auto validationResult = validate(); + if( !validationResult ) + return InternalParseResult( validationResult ); + + auto remainingTokens = tokens; + if( remainingTokens && remainingTokens->type == TokenType::Option ) { + auto const &token = *remainingTokens; + if( isMatch(token.token ) ) { + if( m_ref->isFlag() ) { + auto flagRef = static_cast( m_ref.get() ); + auto result = flagRef->setFlag( true ); + if( !result ) + return InternalParseResult( result ); + if( result.value() == ParseResultType::ShortCircuitAll ) + return InternalParseResult::ok( ParseState( result.value(), remainingTokens ) ); + } else { + auto valueRef = static_cast( m_ref.get() ); + ++remainingTokens; + if( !remainingTokens ) + return InternalParseResult::runtimeError( "Expected argument following " + token.token ); + auto const &argToken = *remainingTokens; + if( argToken.type != TokenType::Argument ) + return InternalParseResult::runtimeError( "Expected argument following " + token.token ); + auto result = valueRef->setValue( argToken.token ); + if( !result ) + return InternalParseResult( result ); + if( result.value() == ParseResultType::ShortCircuitAll ) + return InternalParseResult::ok( ParseState( result.value(), remainingTokens ) ); + } + return InternalParseResult::ok( ParseState( ParseResultType::Matched, ++remainingTokens ) ); + } + } + return InternalParseResult::ok( ParseState( ParseResultType::NoMatch, remainingTokens ) ); + } + + auto validate() const -> Result override { + if( m_optNames.empty() ) + return Result::logicError( "No options supplied to Opt" ); + for( auto const &name : m_optNames ) { + if( name.empty() ) + return Result::logicError( "Option name cannot be empty" ); +#ifdef CATCH_PLATFORM_WINDOWS + if( name[0] != '-' && name[0] != '/' ) + return Result::logicError( "Option name must begin with '-' or '/'" ); +#else + if( name[0] != '-' ) + return Result::logicError( "Option name must begin with '-'" ); +#endif + } + return ParserRefImpl::validate(); + } + }; + + struct Help : Opt { + Help( bool &showHelpFlag ) + : Opt([&]( bool flag ) { + showHelpFlag = flag; + return ParserResult::ok( ParseResultType::ShortCircuitAll ); + }) + { + static_cast( *this ) + ("display usage information") + ["-?"]["-h"]["--help"] + .optional(); + } + }; + + struct Parser : ParserBase { + + mutable ExeName m_exeName; + std::vector m_options; + std::vector m_args; + + auto operator|=( ExeName const &exeName ) -> Parser & { + m_exeName = exeName; + return *this; + } + + auto operator|=( Arg const &arg ) -> Parser & { + m_args.push_back(arg); + return *this; + } + + auto operator|=( Opt const &opt ) -> Parser & { + m_options.push_back(opt); + return *this; + } + + auto operator|=( Parser const &other ) -> Parser & { + m_options.insert(m_options.end(), other.m_options.begin(), other.m_options.end()); + m_args.insert(m_args.end(), other.m_args.begin(), other.m_args.end()); + return *this; + } + + template + auto operator|( T const &other ) const -> Parser { + return Parser( *this ) |= other; + } + + // Forward deprecated interface with '+' instead of '|' + template + auto operator+=( T const &other ) -> Parser & { return operator|=( other ); } + template + auto operator+( T const &other ) const -> Parser { return operator|( other ); } + + auto getHelpColumns() const -> std::vector { + std::vector cols; + for (auto const &o : m_options) { + auto childCols = o.getHelpColumns(); + cols.insert( cols.end(), childCols.begin(), childCols.end() ); + } + return cols; + } + + void writeToStream( std::ostream &os ) const { + if (!m_exeName.name().empty()) { + os << "usage:\n" << " " << m_exeName.name() << " "; + bool required = true, first = true; + for( auto const &arg : m_args ) { + if (first) + first = false; + else + os << " "; + if( arg.isOptional() && required ) { + os << "["; + required = false; + } + os << "<" << arg.hint() << ">"; + if( arg.cardinality() == 0 ) + os << " ... "; + } + if( !required ) + os << "]"; + if( !m_options.empty() ) + os << " options"; + os << "\n\nwhere options are:" << std::endl; + } + + auto rows = getHelpColumns(); + size_t consoleWidth = CATCH_CLARA_CONFIG_CONSOLE_WIDTH; + size_t optWidth = 0; + for( auto const &cols : rows ) + optWidth = (std::max)(optWidth, cols.left.size() + 2); + + optWidth = (std::min)(optWidth, consoleWidth/2); + + for( auto const &cols : rows ) { + auto row = + TextFlow::Column( cols.left ).width( optWidth ).indent( 2 ) + + TextFlow::Spacer(4) + + TextFlow::Column( cols.right ).width( consoleWidth - 7 - optWidth ); + os << row << std::endl; + } + } + + friend auto operator<<( std::ostream &os, Parser const &parser ) -> std::ostream& { + parser.writeToStream( os ); + return os; + } + + auto validate() const -> Result override { + for( auto const &opt : m_options ) { + auto result = opt.validate(); + if( !result ) + return result; + } + for( auto const &arg : m_args ) { + auto result = arg.validate(); + if( !result ) + return result; + } + return Result::ok(); + } + + using ParserBase::parse; + + auto parse( std::string const& exeName, TokenStream const &tokens ) const -> InternalParseResult override { + + struct ParserInfo { + ParserBase const* parser = nullptr; + size_t count = 0; + }; + const size_t totalParsers = m_options.size() + m_args.size(); + assert( totalParsers < 512 ); + // ParserInfo parseInfos[totalParsers]; // <-- this is what we really want to do + ParserInfo parseInfos[512]; + + { + size_t i = 0; + for (auto const &opt : m_options) parseInfos[i++].parser = &opt; + for (auto const &arg : m_args) parseInfos[i++].parser = &arg; + } + + m_exeName.set( exeName ); + + auto result = InternalParseResult::ok( ParseState( ParseResultType::NoMatch, tokens ) ); + while( result.value().remainingTokens() ) { + bool tokenParsed = false; + + for( size_t i = 0; i < totalParsers; ++i ) { + auto& parseInfo = parseInfos[i]; + if( parseInfo.parser->cardinality() == 0 || parseInfo.count < parseInfo.parser->cardinality() ) { + result = parseInfo.parser->parse(exeName, result.value().remainingTokens()); + if (!result) + return result; + if (result.value().type() != ParseResultType::NoMatch) { + tokenParsed = true; + ++parseInfo.count; + break; + } + } + } + + if( result.value().type() == ParseResultType::ShortCircuitAll ) + return result; + if( !tokenParsed ) + return InternalParseResult::runtimeError( "Unrecognised token: " + result.value().remainingTokens()->token ); + } + // !TBD Check missing required options + return result; + } + }; + + template + template + auto ComposableParserImpl::operator|( T const &other ) const -> Parser { + return Parser() | static_cast( *this ) | other; + } +} // namespace detail + +// A Combined parser +using detail::Parser; + +// A parser for options +using detail::Opt; + +// A parser for arguments +using detail::Arg; + +// Wrapper for argc, argv from main() +using detail::Args; + +// Specifies the name of the executable +using detail::ExeName; + +// Convenience wrapper for option parser that specifies the help option +using detail::Help; + +// enum of result types from a parse +using detail::ParseResultType; + +// Result type for parser operation +using detail::ParserResult; + +}} // namespace Catch::clara + +// end clara.hpp +#ifdef __clang__ +#pragma clang diagnostic pop +#endif + +// Restore Clara's value for console width, if present +#ifdef CATCH_TEMP_CLARA_CONFIG_CONSOLE_WIDTH +#define CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH CATCH_TEMP_CLARA_CONFIG_CONSOLE_WIDTH +#undef CATCH_TEMP_CLARA_CONFIG_CONSOLE_WIDTH +#endif + +// end catch_clara.h +namespace Catch { + + clara::Parser makeCommandLineParser( ConfigData& config ); + +} // end namespace Catch + +// end catch_commandline.h +#include +#include + +namespace Catch { + + clara::Parser makeCommandLineParser( ConfigData& config ) { + + using namespace clara; + + auto const setWarning = [&]( std::string const& warning ) { + auto warningSet = [&]() { + if( warning == "NoAssertions" ) + return WarnAbout::NoAssertions; + + if ( warning == "NoTests" ) + return WarnAbout::NoTests; + + return WarnAbout::Nothing; + }(); + + if (warningSet == WarnAbout::Nothing) + return ParserResult::runtimeError( "Unrecognised warning: '" + warning + "'" ); + config.warnings = static_cast( config.warnings | warningSet ); + return ParserResult::ok( ParseResultType::Matched ); + }; + auto const loadTestNamesFromFile = [&]( std::string const& filename ) { + std::ifstream f( filename.c_str() ); + if( !f.is_open() ) + return ParserResult::runtimeError( "Unable to load input file: '" + filename + "'" ); + + std::string line; + while( std::getline( f, line ) ) { + line = trim(line); + if( !line.empty() && !startsWith( line, '#' ) ) { + if( !startsWith( line, '"' ) ) + line = '"' + line + '"'; + config.testsOrTags.push_back( line + ',' ); + } + } + return ParserResult::ok( ParseResultType::Matched ); + }; + auto const setTestOrder = [&]( std::string const& order ) { + if( startsWith( "declared", order ) ) + config.runOrder = RunTests::InDeclarationOrder; + else if( startsWith( "lexical", order ) ) + config.runOrder = RunTests::InLexicographicalOrder; + else if( startsWith( "random", order ) ) + config.runOrder = RunTests::InRandomOrder; + else + return clara::ParserResult::runtimeError( "Unrecognised ordering: '" + order + "'" ); + return ParserResult::ok( ParseResultType::Matched ); + }; + auto const setRngSeed = [&]( std::string const& seed ) { + if( seed != "time" ) + return clara::detail::convertInto( seed, config.rngSeed ); + config.rngSeed = static_cast( std::time(nullptr) ); + return ParserResult::ok( ParseResultType::Matched ); + }; + auto const setColourUsage = [&]( std::string const& useColour ) { + auto mode = toLower( useColour ); + + if( mode == "yes" ) + config.useColour = UseColour::Yes; + else if( mode == "no" ) + config.useColour = UseColour::No; + else if( mode == "auto" ) + config.useColour = UseColour::Auto; + else + return ParserResult::runtimeError( "colour mode must be one of: auto, yes or no. '" + useColour + "' not recognised" ); + return ParserResult::ok( ParseResultType::Matched ); + }; + auto const setWaitForKeypress = [&]( std::string const& keypress ) { + auto keypressLc = toLower( keypress ); + if( keypressLc == "start" ) + config.waitForKeypress = WaitForKeypress::BeforeStart; + else if( keypressLc == "exit" ) + config.waitForKeypress = WaitForKeypress::BeforeExit; + else if( keypressLc == "both" ) + config.waitForKeypress = WaitForKeypress::BeforeStartAndExit; + else + return ParserResult::runtimeError( "keypress argument must be one of: start, exit or both. '" + keypress + "' not recognised" ); + return ParserResult::ok( ParseResultType::Matched ); + }; + auto const setVerbosity = [&]( std::string const& verbosity ) { + auto lcVerbosity = toLower( verbosity ); + if( lcVerbosity == "quiet" ) + config.verbosity = Verbosity::Quiet; + else if( lcVerbosity == "normal" ) + config.verbosity = Verbosity::Normal; + else if( lcVerbosity == "high" ) + config.verbosity = Verbosity::High; + else + return ParserResult::runtimeError( "Unrecognised verbosity, '" + verbosity + "'" ); + return ParserResult::ok( ParseResultType::Matched ); + }; + auto const setReporter = [&]( std::string const& reporter ) { + IReporterRegistry::FactoryMap const& factories = getRegistryHub().getReporterRegistry().getFactories(); + + auto lcReporter = toLower( reporter ); + auto result = factories.find( lcReporter ); + + if( factories.end() != result ) + config.reporterName = lcReporter; + else + return ParserResult::runtimeError( "Unrecognized reporter, '" + reporter + "'. Check available with --list-reporters" ); + return ParserResult::ok( ParseResultType::Matched ); + }; + + auto cli + = ExeName( config.processName ) + | Help( config.showHelp ) + | Opt( config.listTests ) + ["-l"]["--list-tests"] + ( "list all/matching test cases" ) + | Opt( config.listTags ) + ["-t"]["--list-tags"] + ( "list all/matching tags" ) + | Opt( config.showSuccessfulTests ) + ["-s"]["--success"] + ( "include successful tests in output" ) + | Opt( config.shouldDebugBreak ) + ["-b"]["--break"] + ( "break into debugger on failure" ) + | Opt( config.noThrow ) + ["-e"]["--nothrow"] + ( "skip exception tests" ) + | Opt( config.showInvisibles ) + ["-i"]["--invisibles"] + ( "show invisibles (tabs, newlines)" ) + | Opt( config.outputFilename, "filename" ) + ["-o"]["--out"] + ( "output filename" ) + | Opt( setReporter, "name" ) + ["-r"]["--reporter"] + ( "reporter to use (defaults to console)" ) + | Opt( config.name, "name" ) + ["-n"]["--name"] + ( "suite name" ) + | Opt( [&]( bool ){ config.abortAfter = 1; } ) + ["-a"]["--abort"] + ( "abort at first failure" ) + | Opt( [&]( int x ){ config.abortAfter = x; }, "no. failures" ) + ["-x"]["--abortx"] + ( "abort after x failures" ) + | Opt( setWarning, "warning name" ) + ["-w"]["--warn"] + ( "enable warnings" ) + | Opt( [&]( bool flag ) { config.showDurations = flag ? ShowDurations::Always : ShowDurations::Never; }, "yes|no" ) + ["-d"]["--durations"] + ( "show test durations" ) + | Opt( loadTestNamesFromFile, "filename" ) + ["-f"]["--input-file"] + ( "load test names to run from a file" ) + | Opt( config.filenamesAsTags ) + ["-#"]["--filenames-as-tags"] + ( "adds a tag for the filename" ) + | Opt( config.sectionsToRun, "section name" ) + ["-c"]["--section"] + ( "specify section to run" ) + | Opt( setVerbosity, "quiet|normal|high" ) + ["-v"]["--verbosity"] + ( "set output verbosity" ) + | Opt( config.listTestNamesOnly ) + ["--list-test-names-only"] + ( "list all/matching test cases names only" ) + | Opt( config.listReporters ) + ["--list-reporters"] + ( "list all reporters" ) + | Opt( setTestOrder, "decl|lex|rand" ) + ["--order"] + ( "test case order (defaults to decl)" ) + | Opt( setRngSeed, "'time'|number" ) + ["--rng-seed"] + ( "set a specific seed for random numbers" ) + | Opt( setColourUsage, "yes|no" ) + ["--use-colour"] + ( "should output be colourised" ) + | Opt( config.libIdentify ) + ["--libidentify"] + ( "report name and version according to libidentify standard" ) + | Opt( setWaitForKeypress, "start|exit|both" ) + ["--wait-for-keypress"] + ( "waits for a keypress before exiting" ) + | Opt( config.benchmarkResolutionMultiple, "multiplier" ) + ["--benchmark-resolution-multiple"] + ( "multiple of clock resolution to run benchmarks" ) + + | Arg( config.testsOrTags, "test name|pattern|tags" ) + ( "which test or tests to use" ); + + return cli; + } + +} // end namespace Catch +// end catch_commandline.cpp +// start catch_common.cpp + +#include +#include + +namespace Catch { + + bool SourceLineInfo::empty() const noexcept { + return file[0] == '\0'; + } + bool SourceLineInfo::operator == ( SourceLineInfo const& other ) const noexcept { + return line == other.line && (file == other.file || std::strcmp(file, other.file) == 0); + } + bool SourceLineInfo::operator < ( SourceLineInfo const& other ) const noexcept { + // We can assume that the same file will usually have the same pointer. + // Thus, if the pointers are the same, there is no point in calling the strcmp + return line < other.line || ( line == other.line && file != other.file && (std::strcmp(file, other.file) < 0)); + } + + std::ostream& operator << ( std::ostream& os, SourceLineInfo const& info ) { +#ifndef __GNUG__ + os << info.file << '(' << info.line << ')'; +#else + os << info.file << ':' << info.line; +#endif + return os; + } + + std::string StreamEndStop::operator+() const { + return std::string(); + } + + NonCopyable::NonCopyable() = default; + NonCopyable::~NonCopyable() = default; + +} +// end catch_common.cpp +// start catch_config.cpp + +namespace Catch { + + Config::Config( ConfigData const& data ) + : m_data( data ), + m_stream( openStream() ) + { + TestSpecParser parser(ITagAliasRegistry::get()); + if (data.testsOrTags.empty()) { + parser.parse("~[.]"); // All not hidden tests + } + else { + m_hasTestFilters = true; + for( auto const& testOrTags : data.testsOrTags ) + parser.parse( testOrTags ); + } + m_testSpec = parser.testSpec(); + } + + std::string const& Config::getFilename() const { + return m_data.outputFilename ; + } + + bool Config::listTests() const { return m_data.listTests; } + bool Config::listTestNamesOnly() const { return m_data.listTestNamesOnly; } + bool Config::listTags() const { return m_data.listTags; } + bool Config::listReporters() const { return m_data.listReporters; } + + std::string Config::getProcessName() const { return m_data.processName; } + std::string const& Config::getReporterName() const { return m_data.reporterName; } + + std::vector const& Config::getTestsOrTags() const { return m_data.testsOrTags; } + std::vector const& Config::getSectionsToRun() const { return m_data.sectionsToRun; } + + TestSpec const& Config::testSpec() const { return m_testSpec; } + bool Config::hasTestFilters() const { return m_hasTestFilters; } + + bool Config::showHelp() const { return m_data.showHelp; } + + // IConfig interface + bool Config::allowThrows() const { return !m_data.noThrow; } + std::ostream& Config::stream() const { return m_stream->stream(); } + std::string Config::name() const { return m_data.name.empty() ? m_data.processName : m_data.name; } + bool Config::includeSuccessfulResults() const { return m_data.showSuccessfulTests; } + bool Config::warnAboutMissingAssertions() const { return !!(m_data.warnings & WarnAbout::NoAssertions); } + bool Config::warnAboutNoTests() const { return !!(m_data.warnings & WarnAbout::NoTests); } + ShowDurations::OrNot Config::showDurations() const { return m_data.showDurations; } + RunTests::InWhatOrder Config::runOrder() const { return m_data.runOrder; } + unsigned int Config::rngSeed() const { return m_data.rngSeed; } + int Config::benchmarkResolutionMultiple() const { return m_data.benchmarkResolutionMultiple; } + UseColour::YesOrNo Config::useColour() const { return m_data.useColour; } + bool Config::shouldDebugBreak() const { return m_data.shouldDebugBreak; } + int Config::abortAfter() const { return m_data.abortAfter; } + bool Config::showInvisibles() const { return m_data.showInvisibles; } + Verbosity Config::verbosity() const { return m_data.verbosity; } + + IStream const* Config::openStream() { + return Catch::makeStream(m_data.outputFilename); + } + +} // end namespace Catch +// end catch_config.cpp +// start catch_console_colour.cpp + +#if defined(__clang__) +# pragma clang diagnostic push +# pragma clang diagnostic ignored "-Wexit-time-destructors" +#endif + +// start catch_errno_guard.h + +namespace Catch { + + class ErrnoGuard { + public: + ErrnoGuard(); + ~ErrnoGuard(); + private: + int m_oldErrno; + }; + +} + +// end catch_errno_guard.h +#include + +namespace Catch { + namespace { + + struct IColourImpl { + virtual ~IColourImpl() = default; + virtual void use( Colour::Code _colourCode ) = 0; + }; + + struct NoColourImpl : IColourImpl { + void use( Colour::Code ) {} + + static IColourImpl* instance() { + static NoColourImpl s_instance; + return &s_instance; + } + }; + + } // anon namespace +} // namespace Catch + +#if !defined( CATCH_CONFIG_COLOUR_NONE ) && !defined( CATCH_CONFIG_COLOUR_WINDOWS ) && !defined( CATCH_CONFIG_COLOUR_ANSI ) +# ifdef CATCH_PLATFORM_WINDOWS +# define CATCH_CONFIG_COLOUR_WINDOWS +# else +# define CATCH_CONFIG_COLOUR_ANSI +# endif +#endif + +#if defined ( CATCH_CONFIG_COLOUR_WINDOWS ) ///////////////////////////////////////// + +namespace Catch { +namespace { + + class Win32ColourImpl : public IColourImpl { + public: + Win32ColourImpl() : stdoutHandle( GetStdHandle(STD_OUTPUT_HANDLE) ) + { + CONSOLE_SCREEN_BUFFER_INFO csbiInfo; + GetConsoleScreenBufferInfo( stdoutHandle, &csbiInfo ); + originalForegroundAttributes = csbiInfo.wAttributes & ~( BACKGROUND_GREEN | BACKGROUND_RED | BACKGROUND_BLUE | BACKGROUND_INTENSITY ); + originalBackgroundAttributes = csbiInfo.wAttributes & ~( FOREGROUND_GREEN | FOREGROUND_RED | FOREGROUND_BLUE | FOREGROUND_INTENSITY ); + } + + virtual void use( Colour::Code _colourCode ) override { + switch( _colourCode ) { + case Colour::None: return setTextAttribute( originalForegroundAttributes ); + case Colour::White: return setTextAttribute( FOREGROUND_GREEN | FOREGROUND_RED | FOREGROUND_BLUE ); + case Colour::Red: return setTextAttribute( FOREGROUND_RED ); + case Colour::Green: return setTextAttribute( FOREGROUND_GREEN ); + case Colour::Blue: return setTextAttribute( FOREGROUND_BLUE ); + case Colour::Cyan: return setTextAttribute( FOREGROUND_BLUE | FOREGROUND_GREEN ); + case Colour::Yellow: return setTextAttribute( FOREGROUND_RED | FOREGROUND_GREEN ); + case Colour::Grey: return setTextAttribute( 0 ); + + case Colour::LightGrey: return setTextAttribute( FOREGROUND_INTENSITY ); + case Colour::BrightRed: return setTextAttribute( FOREGROUND_INTENSITY | FOREGROUND_RED ); + case Colour::BrightGreen: return setTextAttribute( FOREGROUND_INTENSITY | FOREGROUND_GREEN ); + case Colour::BrightWhite: return setTextAttribute( FOREGROUND_INTENSITY | FOREGROUND_GREEN | FOREGROUND_RED | FOREGROUND_BLUE ); + case Colour::BrightYellow: return setTextAttribute( FOREGROUND_INTENSITY | FOREGROUND_RED | FOREGROUND_GREEN ); + + case Colour::Bright: CATCH_INTERNAL_ERROR( "not a colour" ); + + default: + CATCH_ERROR( "Unknown colour requested" ); + } + } + + private: + void setTextAttribute( WORD _textAttribute ) { + SetConsoleTextAttribute( stdoutHandle, _textAttribute | originalBackgroundAttributes ); + } + HANDLE stdoutHandle; + WORD originalForegroundAttributes; + WORD originalBackgroundAttributes; + }; + + IColourImpl* platformColourInstance() { + static Win32ColourImpl s_instance; + + IConfigPtr config = getCurrentContext().getConfig(); + UseColour::YesOrNo colourMode = config + ? config->useColour() + : UseColour::Auto; + if( colourMode == UseColour::Auto ) + colourMode = UseColour::Yes; + return colourMode == UseColour::Yes + ? &s_instance + : NoColourImpl::instance(); + } + +} // end anon namespace +} // end namespace Catch + +#elif defined( CATCH_CONFIG_COLOUR_ANSI ) ////////////////////////////////////// + +#include + +namespace Catch { +namespace { + + // use POSIX/ ANSI console terminal codes + // Thanks to Adam Strzelecki for original contribution + // (http://github.com/nanoant) + // https://github.com/philsquared/Catch/pull/131 + class PosixColourImpl : public IColourImpl { + public: + virtual void use( Colour::Code _colourCode ) override { + switch( _colourCode ) { + case Colour::None: + case Colour::White: return setColour( "[0m" ); + case Colour::Red: return setColour( "[0;31m" ); + case Colour::Green: return setColour( "[0;32m" ); + case Colour::Blue: return setColour( "[0;34m" ); + case Colour::Cyan: return setColour( "[0;36m" ); + case Colour::Yellow: return setColour( "[0;33m" ); + case Colour::Grey: return setColour( "[1;30m" ); + + case Colour::LightGrey: return setColour( "[0;37m" ); + case Colour::BrightRed: return setColour( "[1;31m" ); + case Colour::BrightGreen: return setColour( "[1;32m" ); + case Colour::BrightWhite: return setColour( "[1;37m" ); + case Colour::BrightYellow: return setColour( "[1;33m" ); + + case Colour::Bright: CATCH_INTERNAL_ERROR( "not a colour" ); + default: CATCH_INTERNAL_ERROR( "Unknown colour requested" ); + } + } + static IColourImpl* instance() { + static PosixColourImpl s_instance; + return &s_instance; + } + + private: + void setColour( const char* _escapeCode ) { + getCurrentContext().getConfig()->stream() + << '\033' << _escapeCode; + } + }; + + bool useColourOnPlatform() { + return +#ifdef CATCH_PLATFORM_MAC + !isDebuggerActive() && +#endif +#if !(defined(__DJGPP__) && defined(__STRICT_ANSI__)) + isatty(STDOUT_FILENO) +#else + false +#endif + ; + } + IColourImpl* platformColourInstance() { + ErrnoGuard guard; + IConfigPtr config = getCurrentContext().getConfig(); + UseColour::YesOrNo colourMode = config + ? config->useColour() + : UseColour::Auto; + if( colourMode == UseColour::Auto ) + colourMode = useColourOnPlatform() + ? UseColour::Yes + : UseColour::No; + return colourMode == UseColour::Yes + ? PosixColourImpl::instance() + : NoColourImpl::instance(); + } + +} // end anon namespace +} // end namespace Catch + +#else // not Windows or ANSI /////////////////////////////////////////////// + +namespace Catch { + + static IColourImpl* platformColourInstance() { return NoColourImpl::instance(); } + +} // end namespace Catch + +#endif // Windows/ ANSI/ None + +namespace Catch { + + Colour::Colour( Code _colourCode ) { use( _colourCode ); } + Colour::Colour( Colour&& rhs ) noexcept { + m_moved = rhs.m_moved; + rhs.m_moved = true; + } + Colour& Colour::operator=( Colour&& rhs ) noexcept { + m_moved = rhs.m_moved; + rhs.m_moved = true; + return *this; + } + + Colour::~Colour(){ if( !m_moved ) use( None ); } + + void Colour::use( Code _colourCode ) { + static IColourImpl* impl = platformColourInstance(); + impl->use( _colourCode ); + } + + std::ostream& operator << ( std::ostream& os, Colour const& ) { + return os; + } + +} // end namespace Catch + +#if defined(__clang__) +# pragma clang diagnostic pop +#endif + +// end catch_console_colour.cpp +// start catch_context.cpp + +namespace Catch { + + class Context : public IMutableContext, NonCopyable { + + public: // IContext + virtual IResultCapture* getResultCapture() override { + return m_resultCapture; + } + virtual IRunner* getRunner() override { + return m_runner; + } + + virtual IConfigPtr const& getConfig() const override { + return m_config; + } + + virtual ~Context() override; + + public: // IMutableContext + virtual void setResultCapture( IResultCapture* resultCapture ) override { + m_resultCapture = resultCapture; + } + virtual void setRunner( IRunner* runner ) override { + m_runner = runner; + } + virtual void setConfig( IConfigPtr const& config ) override { + m_config = config; + } + + friend IMutableContext& getCurrentMutableContext(); + + private: + IConfigPtr m_config; + IRunner* m_runner = nullptr; + IResultCapture* m_resultCapture = nullptr; + }; + + IMutableContext *IMutableContext::currentContext = nullptr; + + void IMutableContext::createContext() + { + currentContext = new Context(); + } + + void cleanUpContext() { + delete IMutableContext::currentContext; + IMutableContext::currentContext = nullptr; + } + IContext::~IContext() = default; + IMutableContext::~IMutableContext() = default; + Context::~Context() = default; +} +// end catch_context.cpp +// start catch_debug_console.cpp + +// start catch_debug_console.h + +#include + +namespace Catch { + void writeToDebugConsole( std::string const& text ); +} + +// end catch_debug_console.h +#ifdef CATCH_PLATFORM_WINDOWS + + namespace Catch { + void writeToDebugConsole( std::string const& text ) { + ::OutputDebugStringA( text.c_str() ); + } + } + +#else + + namespace Catch { + void writeToDebugConsole( std::string const& text ) { + // !TBD: Need a version for Mac/ XCode and other IDEs + Catch::cout() << text; + } + } + +#endif // Platform +// end catch_debug_console.cpp +// start catch_debugger.cpp + +#ifdef CATCH_PLATFORM_MAC + +# include +# include +# include +# include +# include +# include +# include + +namespace Catch { + + // The following function is taken directly from the following technical note: + // http://developer.apple.com/library/mac/#qa/qa2004/qa1361.html + + // Returns true if the current process is being debugged (either + // running under the debugger or has a debugger attached post facto). + bool isDebuggerActive(){ + + int mib[4]; + struct kinfo_proc info; + std::size_t size; + + // Initialize the flags so that, if sysctl fails for some bizarre + // reason, we get a predictable result. + + info.kp_proc.p_flag = 0; + + // Initialize mib, which tells sysctl the info we want, in this case + // we're looking for information about a specific process ID. + + mib[0] = CTL_KERN; + mib[1] = KERN_PROC; + mib[2] = KERN_PROC_PID; + mib[3] = getpid(); + + // Call sysctl. + + size = sizeof(info); + if( sysctl(mib, sizeof(mib) / sizeof(*mib), &info, &size, nullptr, 0) != 0 ) { + Catch::cerr() << "\n** Call to sysctl failed - unable to determine if debugger is active **\n" << std::endl; + return false; + } + + // We're being debugged if the P_TRACED flag is set. + + return ( (info.kp_proc.p_flag & P_TRACED) != 0 ); + } + } // namespace Catch + +#elif defined(CATCH_PLATFORM_LINUX) + #include + #include + + namespace Catch{ + // The standard POSIX way of detecting a debugger is to attempt to + // ptrace() the process, but this needs to be done from a child and not + // this process itself to still allow attaching to this process later + // if wanted, so is rather heavy. Under Linux we have the PID of the + // "debugger" (which doesn't need to be gdb, of course, it could also + // be strace, for example) in /proc/$PID/status, so just get it from + // there instead. + bool isDebuggerActive(){ + // Libstdc++ has a bug, where std::ifstream sets errno to 0 + // This way our users can properly assert over errno values + ErrnoGuard guard; + std::ifstream in("/proc/self/status"); + for( std::string line; std::getline(in, line); ) { + static const int PREFIX_LEN = 11; + if( line.compare(0, PREFIX_LEN, "TracerPid:\t") == 0 ) { + // We're traced if the PID is not 0 and no other PID starts + // with 0 digit, so it's enough to check for just a single + // character. + return line.length() > PREFIX_LEN && line[PREFIX_LEN] != '0'; + } + } + + return false; + } + } // namespace Catch +#elif defined(_MSC_VER) + extern "C" __declspec(dllimport) int __stdcall IsDebuggerPresent(); + namespace Catch { + bool isDebuggerActive() { + return IsDebuggerPresent() != 0; + } + } +#elif defined(__MINGW32__) + extern "C" __declspec(dllimport) int __stdcall IsDebuggerPresent(); + namespace Catch { + bool isDebuggerActive() { + return IsDebuggerPresent() != 0; + } + } +#else + namespace Catch { + bool isDebuggerActive() { return false; } + } +#endif // Platform +// end catch_debugger.cpp +// start catch_decomposer.cpp + +namespace Catch { + + ITransientExpression::~ITransientExpression() = default; + + void formatReconstructedExpression( std::ostream &os, std::string const& lhs, StringRef op, std::string const& rhs ) { + if( lhs.size() + rhs.size() < 40 && + lhs.find('\n') == std::string::npos && + rhs.find('\n') == std::string::npos ) + os << lhs << " " << op << " " << rhs; + else + os << lhs << "\n" << op << "\n" << rhs; + } +} +// end catch_decomposer.cpp +// start catch_enforce.cpp + +namespace Catch { +#if defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) && !defined(CATCH_CONFIG_DISABLE_EXCEPTIONS_CUSTOM_HANDLER) + [[noreturn]] + void throw_exception(std::exception const& e) { + Catch::cerr() << "Catch will terminate because it needed to throw an exception.\n" + << "The message was: " << e.what() << '\n'; + std::terminate(); + } +#endif +} // namespace Catch; +// end catch_enforce.cpp +// start catch_errno_guard.cpp + +#include + +namespace Catch { + ErrnoGuard::ErrnoGuard():m_oldErrno(errno){} + ErrnoGuard::~ErrnoGuard() { errno = m_oldErrno; } +} +// end catch_errno_guard.cpp +// start catch_exception_translator_registry.cpp + +// start catch_exception_translator_registry.h + +#include +#include +#include + +namespace Catch { + + class ExceptionTranslatorRegistry : public IExceptionTranslatorRegistry { + public: + ~ExceptionTranslatorRegistry(); + virtual void registerTranslator( const IExceptionTranslator* translator ); + virtual std::string translateActiveException() const override; + std::string tryTranslators() const; + + private: + std::vector> m_translators; + }; +} + +// end catch_exception_translator_registry.h +#ifdef __OBJC__ +#import "Foundation/Foundation.h" +#endif + +namespace Catch { + + ExceptionTranslatorRegistry::~ExceptionTranslatorRegistry() { + } + + void ExceptionTranslatorRegistry::registerTranslator( const IExceptionTranslator* translator ) { + m_translators.push_back( std::unique_ptr( translator ) ); + } + +#if !defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) + std::string ExceptionTranslatorRegistry::translateActiveException() const { + try { +#ifdef __OBJC__ + // In Objective-C try objective-c exceptions first + @try { + return tryTranslators(); + } + @catch (NSException *exception) { + return Catch::Detail::stringify( [exception description] ); + } +#else + // Compiling a mixed mode project with MSVC means that CLR + // exceptions will be caught in (...) as well. However, these + // do not fill-in std::current_exception and thus lead to crash + // when attempting rethrow. + // /EHa switch also causes structured exceptions to be caught + // here, but they fill-in current_exception properly, so + // at worst the output should be a little weird, instead of + // causing a crash. + if (std::current_exception() == nullptr) { + return "Non C++ exception. Possibly a CLR exception."; + } + return tryTranslators(); +#endif + } + catch( TestFailureException& ) { + std::rethrow_exception(std::current_exception()); + } + catch( std::exception& ex ) { + return ex.what(); + } + catch( std::string& msg ) { + return msg; + } + catch( const char* msg ) { + return msg; + } + catch(...) { + return "Unknown exception"; + } + } + + std::string ExceptionTranslatorRegistry::tryTranslators() const { + if (m_translators.empty()) { + std::rethrow_exception(std::current_exception()); + } else { + return m_translators[0]->translate(m_translators.begin() + 1, m_translators.end()); + } + } + +#else // ^^ Exceptions are enabled // Exceptions are disabled vv + std::string ExceptionTranslatorRegistry::translateActiveException() const { + CATCH_INTERNAL_ERROR("Attempted to translate active exception under CATCH_CONFIG_DISABLE_EXCEPTIONS!"); + } + + std::string ExceptionTranslatorRegistry::tryTranslators() const { + CATCH_INTERNAL_ERROR("Attempted to use exception translators under CATCH_CONFIG_DISABLE_EXCEPTIONS!"); + } +#endif + +} +// end catch_exception_translator_registry.cpp +// start catch_fatal_condition.cpp + +#if defined(__GNUC__) +# pragma GCC diagnostic push +# pragma GCC diagnostic ignored "-Wmissing-field-initializers" +#endif + +#if defined( CATCH_CONFIG_WINDOWS_SEH ) || defined( CATCH_CONFIG_POSIX_SIGNALS ) + +namespace { + // Report the error condition + void reportFatal( char const * const message ) { + Catch::getCurrentContext().getResultCapture()->handleFatalErrorCondition( message ); + } +} + +#endif // signals/SEH handling + +#if defined( CATCH_CONFIG_WINDOWS_SEH ) + +namespace Catch { + struct SignalDefs { DWORD id; const char* name; }; + + // There is no 1-1 mapping between signals and windows exceptions. + // Windows can easily distinguish between SO and SigSegV, + // but SigInt, SigTerm, etc are handled differently. + static SignalDefs signalDefs[] = { + { EXCEPTION_ILLEGAL_INSTRUCTION, "SIGILL - Illegal instruction signal" }, + { EXCEPTION_STACK_OVERFLOW, "SIGSEGV - Stack overflow" }, + { EXCEPTION_ACCESS_VIOLATION, "SIGSEGV - Segmentation violation signal" }, + { EXCEPTION_INT_DIVIDE_BY_ZERO, "Divide by zero error" }, + }; + + LONG CALLBACK FatalConditionHandler::handleVectoredException(PEXCEPTION_POINTERS ExceptionInfo) { + for (auto const& def : signalDefs) { + if (ExceptionInfo->ExceptionRecord->ExceptionCode == def.id) { + reportFatal(def.name); + } + } + // If its not an exception we care about, pass it along. + // This stops us from eating debugger breaks etc. + return EXCEPTION_CONTINUE_SEARCH; + } + + FatalConditionHandler::FatalConditionHandler() { + isSet = true; + // 32k seems enough for Catch to handle stack overflow, + // but the value was found experimentally, so there is no strong guarantee + guaranteeSize = 32 * 1024; + exceptionHandlerHandle = nullptr; + // Register as first handler in current chain + exceptionHandlerHandle = AddVectoredExceptionHandler(1, handleVectoredException); + // Pass in guarantee size to be filled + SetThreadStackGuarantee(&guaranteeSize); + } + + void FatalConditionHandler::reset() { + if (isSet) { + RemoveVectoredExceptionHandler(exceptionHandlerHandle); + SetThreadStackGuarantee(&guaranteeSize); + exceptionHandlerHandle = nullptr; + isSet = false; + } + } + + FatalConditionHandler::~FatalConditionHandler() { + reset(); + } + +bool FatalConditionHandler::isSet = false; +ULONG FatalConditionHandler::guaranteeSize = 0; +PVOID FatalConditionHandler::exceptionHandlerHandle = nullptr; + +} // namespace Catch + +#elif defined( CATCH_CONFIG_POSIX_SIGNALS ) + +namespace Catch { + + struct SignalDefs { + int id; + const char* name; + }; + + // 32kb for the alternate stack seems to be sufficient. However, this value + // is experimentally determined, so that's not guaranteed. + constexpr static std::size_t sigStackSize = 32768 >= MINSIGSTKSZ ? 32768 : MINSIGSTKSZ; + + static SignalDefs signalDefs[] = { + { SIGINT, "SIGINT - Terminal interrupt signal" }, + { SIGILL, "SIGILL - Illegal instruction signal" }, + { SIGFPE, "SIGFPE - Floating point error signal" }, + { SIGSEGV, "SIGSEGV - Segmentation violation signal" }, + { SIGTERM, "SIGTERM - Termination request signal" }, + { SIGABRT, "SIGABRT - Abort (abnormal termination) signal" } + }; + + void FatalConditionHandler::handleSignal( int sig ) { + char const * name = ""; + for (auto const& def : signalDefs) { + if (sig == def.id) { + name = def.name; + break; + } + } + reset(); + reportFatal(name); + raise( sig ); + } + + FatalConditionHandler::FatalConditionHandler() { + isSet = true; + stack_t sigStack; + sigStack.ss_sp = altStackMem; + sigStack.ss_size = sigStackSize; + sigStack.ss_flags = 0; + sigaltstack(&sigStack, &oldSigStack); + struct sigaction sa = { }; + + sa.sa_handler = handleSignal; + sa.sa_flags = SA_ONSTACK; + for (std::size_t i = 0; i < sizeof(signalDefs)/sizeof(SignalDefs); ++i) { + sigaction(signalDefs[i].id, &sa, &oldSigActions[i]); + } + } + + FatalConditionHandler::~FatalConditionHandler() { + reset(); + } + + void FatalConditionHandler::reset() { + if( isSet ) { + // Set signals back to previous values -- hopefully nobody overwrote them in the meantime + for( std::size_t i = 0; i < sizeof(signalDefs)/sizeof(SignalDefs); ++i ) { + sigaction(signalDefs[i].id, &oldSigActions[i], nullptr); + } + // Return the old stack + sigaltstack(&oldSigStack, nullptr); + isSet = false; + } + } + + bool FatalConditionHandler::isSet = false; + struct sigaction FatalConditionHandler::oldSigActions[sizeof(signalDefs)/sizeof(SignalDefs)] = {}; + stack_t FatalConditionHandler::oldSigStack = {}; + char FatalConditionHandler::altStackMem[sigStackSize] = {}; + +} // namespace Catch + +#else + +namespace Catch { + void FatalConditionHandler::reset() {} +} + +#endif // signals/SEH handling + +#if defined(__GNUC__) +# pragma GCC diagnostic pop +#endif +// end catch_fatal_condition.cpp +// start catch_generators.cpp + +// start catch_random_number_generator.h + +#include +#include + +namespace Catch { + + struct IConfig; + + std::mt19937& rng(); + void seedRng( IConfig const& config ); + unsigned int rngSeed(); + +} + +// end catch_random_number_generator.h +#include +#include + +namespace Catch { + +IGeneratorTracker::~IGeneratorTracker() {} + +const char* GeneratorException::what() const noexcept { + return m_msg; +} + +namespace Generators { + + GeneratorUntypedBase::~GeneratorUntypedBase() {} + + auto acquireGeneratorTracker( SourceLineInfo const& lineInfo ) -> IGeneratorTracker& { + return getResultCapture().acquireGeneratorTracker( lineInfo ); + } + +} // namespace Generators +} // namespace Catch +// end catch_generators.cpp +// start catch_interfaces_capture.cpp + +namespace Catch { + IResultCapture::~IResultCapture() = default; +} +// end catch_interfaces_capture.cpp +// start catch_interfaces_config.cpp + +namespace Catch { + IConfig::~IConfig() = default; +} +// end catch_interfaces_config.cpp +// start catch_interfaces_exception.cpp + +namespace Catch { + IExceptionTranslator::~IExceptionTranslator() = default; + IExceptionTranslatorRegistry::~IExceptionTranslatorRegistry() = default; +} +// end catch_interfaces_exception.cpp +// start catch_interfaces_registry_hub.cpp + +namespace Catch { + IRegistryHub::~IRegistryHub() = default; + IMutableRegistryHub::~IMutableRegistryHub() = default; +} +// end catch_interfaces_registry_hub.cpp +// start catch_interfaces_reporter.cpp + +// start catch_reporter_listening.h + +namespace Catch { + + class ListeningReporter : public IStreamingReporter { + using Reporters = std::vector; + Reporters m_listeners; + IStreamingReporterPtr m_reporter = nullptr; + ReporterPreferences m_preferences; + + public: + ListeningReporter(); + + void addListener( IStreamingReporterPtr&& listener ); + void addReporter( IStreamingReporterPtr&& reporter ); + + public: // IStreamingReporter + + ReporterPreferences getPreferences() const override; + + void noMatchingTestCases( std::string const& spec ) override; + + static std::set getSupportedVerbosities(); + + void benchmarkStarting( BenchmarkInfo const& benchmarkInfo ) override; + void benchmarkEnded( BenchmarkStats const& benchmarkStats ) override; + + void testRunStarting( TestRunInfo const& testRunInfo ) override; + void testGroupStarting( GroupInfo const& groupInfo ) override; + void testCaseStarting( TestCaseInfo const& testInfo ) override; + void sectionStarting( SectionInfo const& sectionInfo ) override; + void assertionStarting( AssertionInfo const& assertionInfo ) override; + + // The return value indicates if the messages buffer should be cleared: + bool assertionEnded( AssertionStats const& assertionStats ) override; + void sectionEnded( SectionStats const& sectionStats ) override; + void testCaseEnded( TestCaseStats const& testCaseStats ) override; + void testGroupEnded( TestGroupStats const& testGroupStats ) override; + void testRunEnded( TestRunStats const& testRunStats ) override; + + void skipTest( TestCaseInfo const& testInfo ) override; + bool isMulti() const override; + + }; + +} // end namespace Catch + +// end catch_reporter_listening.h +namespace Catch { + + ReporterConfig::ReporterConfig( IConfigPtr const& _fullConfig ) + : m_stream( &_fullConfig->stream() ), m_fullConfig( _fullConfig ) {} + + ReporterConfig::ReporterConfig( IConfigPtr const& _fullConfig, std::ostream& _stream ) + : m_stream( &_stream ), m_fullConfig( _fullConfig ) {} + + std::ostream& ReporterConfig::stream() const { return *m_stream; } + IConfigPtr ReporterConfig::fullConfig() const { return m_fullConfig; } + + TestRunInfo::TestRunInfo( std::string const& _name ) : name( _name ) {} + + GroupInfo::GroupInfo( std::string const& _name, + std::size_t _groupIndex, + std::size_t _groupsCount ) + : name( _name ), + groupIndex( _groupIndex ), + groupsCounts( _groupsCount ) + {} + + AssertionStats::AssertionStats( AssertionResult const& _assertionResult, + std::vector const& _infoMessages, + Totals const& _totals ) + : assertionResult( _assertionResult ), + infoMessages( _infoMessages ), + totals( _totals ) + { + assertionResult.m_resultData.lazyExpression.m_transientExpression = _assertionResult.m_resultData.lazyExpression.m_transientExpression; + + if( assertionResult.hasMessage() ) { + // Copy message into messages list. + // !TBD This should have been done earlier, somewhere + MessageBuilder builder( assertionResult.getTestMacroName(), assertionResult.getSourceInfo(), assertionResult.getResultType() ); + builder << assertionResult.getMessage(); + builder.m_info.message = builder.m_stream.str(); + + infoMessages.push_back( builder.m_info ); + } + } + + AssertionStats::~AssertionStats() = default; + + SectionStats::SectionStats( SectionInfo const& _sectionInfo, + Counts const& _assertions, + double _durationInSeconds, + bool _missingAssertions ) + : sectionInfo( _sectionInfo ), + assertions( _assertions ), + durationInSeconds( _durationInSeconds ), + missingAssertions( _missingAssertions ) + {} + + SectionStats::~SectionStats() = default; + + TestCaseStats::TestCaseStats( TestCaseInfo const& _testInfo, + Totals const& _totals, + std::string const& _stdOut, + std::string const& _stdErr, + bool _aborting ) + : testInfo( _testInfo ), + totals( _totals ), + stdOut( _stdOut ), + stdErr( _stdErr ), + aborting( _aborting ) + {} + + TestCaseStats::~TestCaseStats() = default; + + TestGroupStats::TestGroupStats( GroupInfo const& _groupInfo, + Totals const& _totals, + bool _aborting ) + : groupInfo( _groupInfo ), + totals( _totals ), + aborting( _aborting ) + {} + + TestGroupStats::TestGroupStats( GroupInfo const& _groupInfo ) + : groupInfo( _groupInfo ), + aborting( false ) + {} + + TestGroupStats::~TestGroupStats() = default; + + TestRunStats::TestRunStats( TestRunInfo const& _runInfo, + Totals const& _totals, + bool _aborting ) + : runInfo( _runInfo ), + totals( _totals ), + aborting( _aborting ) + {} + + TestRunStats::~TestRunStats() = default; + + void IStreamingReporter::fatalErrorEncountered( StringRef ) {} + bool IStreamingReporter::isMulti() const { return false; } + + IReporterFactory::~IReporterFactory() = default; + IReporterRegistry::~IReporterRegistry() = default; + +} // end namespace Catch +// end catch_interfaces_reporter.cpp +// start catch_interfaces_runner.cpp + +namespace Catch { + IRunner::~IRunner() = default; +} +// end catch_interfaces_runner.cpp +// start catch_interfaces_testcase.cpp + +namespace Catch { + ITestInvoker::~ITestInvoker() = default; + ITestCaseRegistry::~ITestCaseRegistry() = default; +} +// end catch_interfaces_testcase.cpp +// start catch_leak_detector.cpp + +#ifdef CATCH_CONFIG_WINDOWS_CRTDBG +#include + +namespace Catch { + + LeakDetector::LeakDetector() { + int flag = _CrtSetDbgFlag(_CRTDBG_REPORT_FLAG); + flag |= _CRTDBG_LEAK_CHECK_DF; + flag |= _CRTDBG_ALLOC_MEM_DF; + _CrtSetDbgFlag(flag); + _CrtSetReportMode(_CRT_WARN, _CRTDBG_MODE_FILE | _CRTDBG_MODE_DEBUG); + _CrtSetReportFile(_CRT_WARN, _CRTDBG_FILE_STDERR); + // Change this to leaking allocation's number to break there + _CrtSetBreakAlloc(-1); + } +} + +#else + + Catch::LeakDetector::LeakDetector() {} + +#endif + +Catch::LeakDetector::~LeakDetector() { + Catch::cleanUp(); +} +// end catch_leak_detector.cpp +// start catch_list.cpp + +// start catch_list.h + +#include + +namespace Catch { + + std::size_t listTests( Config const& config ); + + std::size_t listTestsNamesOnly( Config const& config ); + + struct TagInfo { + void add( std::string const& spelling ); + std::string all() const; + + std::set spellings; + std::size_t count = 0; + }; + + std::size_t listTags( Config const& config ); + + std::size_t listReporters(); + + Option list( std::shared_ptr const& config ); + +} // end namespace Catch + +// end catch_list.h +// start catch_text.h + +namespace Catch { + using namespace clara::TextFlow; +} + +// end catch_text.h +#include +#include +#include + +namespace Catch { + + std::size_t listTests( Config const& config ) { + TestSpec testSpec = config.testSpec(); + if( config.hasTestFilters() ) + Catch::cout() << "Matching test cases:\n"; + else { + Catch::cout() << "All available test cases:\n"; + } + + auto matchedTestCases = filterTests( getAllTestCasesSorted( config ), testSpec, config ); + for( auto const& testCaseInfo : matchedTestCases ) { + Colour::Code colour = testCaseInfo.isHidden() + ? Colour::SecondaryText + : Colour::None; + Colour colourGuard( colour ); + + Catch::cout() << Column( testCaseInfo.name ).initialIndent( 2 ).indent( 4 ) << "\n"; + if( config.verbosity() >= Verbosity::High ) { + Catch::cout() << Column( Catch::Detail::stringify( testCaseInfo.lineInfo ) ).indent(4) << std::endl; + std::string description = testCaseInfo.description; + if( description.empty() ) + description = "(NO DESCRIPTION)"; + Catch::cout() << Column( description ).indent(4) << std::endl; + } + if( !testCaseInfo.tags.empty() ) + Catch::cout() << Column( testCaseInfo.tagsAsString() ).indent( 6 ) << "\n"; + } + + if( !config.hasTestFilters() ) + Catch::cout() << pluralise( matchedTestCases.size(), "test case" ) << '\n' << std::endl; + else + Catch::cout() << pluralise( matchedTestCases.size(), "matching test case" ) << '\n' << std::endl; + return matchedTestCases.size(); + } + + std::size_t listTestsNamesOnly( Config const& config ) { + TestSpec testSpec = config.testSpec(); + std::size_t matchedTests = 0; + std::vector matchedTestCases = filterTests( getAllTestCasesSorted( config ), testSpec, config ); + for( auto const& testCaseInfo : matchedTestCases ) { + matchedTests++; + if( startsWith( testCaseInfo.name, '#' ) ) + Catch::cout() << '"' << testCaseInfo.name << '"'; + else + Catch::cout() << testCaseInfo.name; + if ( config.verbosity() >= Verbosity::High ) + Catch::cout() << "\t@" << testCaseInfo.lineInfo; + Catch::cout() << std::endl; + } + return matchedTests; + } + + void TagInfo::add( std::string const& spelling ) { + ++count; + spellings.insert( spelling ); + } + + std::string TagInfo::all() const { + std::string out; + for( auto const& spelling : spellings ) + out += "[" + spelling + "]"; + return out; + } + + std::size_t listTags( Config const& config ) { + TestSpec testSpec = config.testSpec(); + if( config.hasTestFilters() ) + Catch::cout() << "Tags for matching test cases:\n"; + else { + Catch::cout() << "All available tags:\n"; + } + + std::map tagCounts; + + std::vector matchedTestCases = filterTests( getAllTestCasesSorted( config ), testSpec, config ); + for( auto const& testCase : matchedTestCases ) { + for( auto const& tagName : testCase.getTestCaseInfo().tags ) { + std::string lcaseTagName = toLower( tagName ); + auto countIt = tagCounts.find( lcaseTagName ); + if( countIt == tagCounts.end() ) + countIt = tagCounts.insert( std::make_pair( lcaseTagName, TagInfo() ) ).first; + countIt->second.add( tagName ); + } + } + + for( auto const& tagCount : tagCounts ) { + ReusableStringStream rss; + rss << " " << std::setw(2) << tagCount.second.count << " "; + auto str = rss.str(); + auto wrapper = Column( tagCount.second.all() ) + .initialIndent( 0 ) + .indent( str.size() ) + .width( CATCH_CONFIG_CONSOLE_WIDTH-10 ); + Catch::cout() << str << wrapper << '\n'; + } + Catch::cout() << pluralise( tagCounts.size(), "tag" ) << '\n' << std::endl; + return tagCounts.size(); + } + + std::size_t listReporters() { + Catch::cout() << "Available reporters:\n"; + IReporterRegistry::FactoryMap const& factories = getRegistryHub().getReporterRegistry().getFactories(); + std::size_t maxNameLen = 0; + for( auto const& factoryKvp : factories ) + maxNameLen = (std::max)( maxNameLen, factoryKvp.first.size() ); + + for( auto const& factoryKvp : factories ) { + Catch::cout() + << Column( factoryKvp.first + ":" ) + .indent(2) + .width( 5+maxNameLen ) + + Column( factoryKvp.second->getDescription() ) + .initialIndent(0) + .indent(2) + .width( CATCH_CONFIG_CONSOLE_WIDTH - maxNameLen-8 ) + << "\n"; + } + Catch::cout() << std::endl; + return factories.size(); + } + + Option list( std::shared_ptr const& config ) { + Option listedCount; + getCurrentMutableContext().setConfig( config ); + if( config->listTests() ) + listedCount = listedCount.valueOr(0) + listTests( *config ); + if( config->listTestNamesOnly() ) + listedCount = listedCount.valueOr(0) + listTestsNamesOnly( *config ); + if( config->listTags() ) + listedCount = listedCount.valueOr(0) + listTags( *config ); + if( config->listReporters() ) + listedCount = listedCount.valueOr(0) + listReporters(); + return listedCount; + } + +} // end namespace Catch +// end catch_list.cpp +// start catch_matchers.cpp + +namespace Catch { +namespace Matchers { + namespace Impl { + + std::string MatcherUntypedBase::toString() const { + if( m_cachedToString.empty() ) + m_cachedToString = describe(); + return m_cachedToString; + } + + MatcherUntypedBase::~MatcherUntypedBase() = default; + + } // namespace Impl +} // namespace Matchers + +using namespace Matchers; +using Matchers::Impl::MatcherBase; + +} // namespace Catch +// end catch_matchers.cpp +// start catch_matchers_floating.cpp + +// start catch_polyfills.hpp + +namespace Catch { + bool isnan(float f); + bool isnan(double d); +} + +// end catch_polyfills.hpp +// start catch_to_string.hpp + +#include + +namespace Catch { + template + std::string to_string(T const& t) { +#if defined(CATCH_CONFIG_CPP11_TO_STRING) + return std::to_string(t); +#else + ReusableStringStream rss; + rss << t; + return rss.str(); +#endif + } +} // end namespace Catch + +// end catch_to_string.hpp +#include +#include +#include + +namespace Catch { +namespace Matchers { +namespace Floating { +enum class FloatingPointKind : uint8_t { + Float, + Double +}; +} +} +} + +namespace { + +template +struct Converter; + +template <> +struct Converter { + static_assert(sizeof(float) == sizeof(int32_t), "Important ULP matcher assumption violated"); + Converter(float f) { + std::memcpy(&i, &f, sizeof(f)); + } + int32_t i; +}; + +template <> +struct Converter { + static_assert(sizeof(double) == sizeof(int64_t), "Important ULP matcher assumption violated"); + Converter(double d) { + std::memcpy(&i, &d, sizeof(d)); + } + int64_t i; +}; + +template +auto convert(T t) -> Converter { + return Converter(t); +} + +template +bool almostEqualUlps(FP lhs, FP rhs, int maxUlpDiff) { + // Comparison with NaN should always be false. + // This way we can rule it out before getting into the ugly details + if (Catch::isnan(lhs) || Catch::isnan(rhs)) { + return false; + } + + auto lc = convert(lhs); + auto rc = convert(rhs); + + if ((lc.i < 0) != (rc.i < 0)) { + // Potentially we can have +0 and -0 + return lhs == rhs; + } + + auto ulpDiff = std::abs(lc.i - rc.i); + return ulpDiff <= maxUlpDiff; +} + +} + +namespace Catch { +namespace Matchers { +namespace Floating { + WithinAbsMatcher::WithinAbsMatcher(double target, double margin) + :m_target{ target }, m_margin{ margin } { + CATCH_ENFORCE(margin >= 0, "Invalid margin: " << margin << '.' + << " Margin has to be non-negative."); + } + + // Performs equivalent check of std::fabs(lhs - rhs) <= margin + // But without the subtraction to allow for INFINITY in comparison + bool WithinAbsMatcher::match(double const& matchee) const { + return (matchee + m_margin >= m_target) && (m_target + m_margin >= matchee); + } + + std::string WithinAbsMatcher::describe() const { + return "is within " + ::Catch::Detail::stringify(m_margin) + " of " + ::Catch::Detail::stringify(m_target); + } + + WithinUlpsMatcher::WithinUlpsMatcher(double target, int ulps, FloatingPointKind baseType) + :m_target{ target }, m_ulps{ ulps }, m_type{ baseType } { + CATCH_ENFORCE(ulps >= 0, "Invalid ULP setting: " << ulps << '.' + << " ULPs have to be non-negative."); + } + +#if defined(__clang__) +#pragma clang diagnostic push +// Clang <3.5 reports on the default branch in the switch below +#pragma clang diagnostic ignored "-Wunreachable-code" +#endif + + bool WithinUlpsMatcher::match(double const& matchee) const { + switch (m_type) { + case FloatingPointKind::Float: + return almostEqualUlps(static_cast(matchee), static_cast(m_target), m_ulps); + case FloatingPointKind::Double: + return almostEqualUlps(matchee, m_target, m_ulps); + default: + CATCH_INTERNAL_ERROR( "Unknown FloatingPointKind value" ); + } + } + +#if defined(__clang__) +#pragma clang diagnostic pop +#endif + + std::string WithinUlpsMatcher::describe() const { + return "is within " + Catch::to_string(m_ulps) + " ULPs of " + ::Catch::Detail::stringify(m_target) + ((m_type == FloatingPointKind::Float)? "f" : ""); + } + +}// namespace Floating + +Floating::WithinUlpsMatcher WithinULP(double target, int maxUlpDiff) { + return Floating::WithinUlpsMatcher(target, maxUlpDiff, Floating::FloatingPointKind::Double); +} + +Floating::WithinUlpsMatcher WithinULP(float target, int maxUlpDiff) { + return Floating::WithinUlpsMatcher(target, maxUlpDiff, Floating::FloatingPointKind::Float); +} + +Floating::WithinAbsMatcher WithinAbs(double target, double margin) { + return Floating::WithinAbsMatcher(target, margin); +} + +} // namespace Matchers +} // namespace Catch + +// end catch_matchers_floating.cpp +// start catch_matchers_generic.cpp + +std::string Catch::Matchers::Generic::Detail::finalizeDescription(const std::string& desc) { + if (desc.empty()) { + return "matches undescribed predicate"; + } else { + return "matches predicate: \"" + desc + '"'; + } +} +// end catch_matchers_generic.cpp +// start catch_matchers_string.cpp + +#include + +namespace Catch { +namespace Matchers { + + namespace StdString { + + CasedString::CasedString( std::string const& str, CaseSensitive::Choice caseSensitivity ) + : m_caseSensitivity( caseSensitivity ), + m_str( adjustString( str ) ) + {} + std::string CasedString::adjustString( std::string const& str ) const { + return m_caseSensitivity == CaseSensitive::No + ? toLower( str ) + : str; + } + std::string CasedString::caseSensitivitySuffix() const { + return m_caseSensitivity == CaseSensitive::No + ? " (case insensitive)" + : std::string(); + } + + StringMatcherBase::StringMatcherBase( std::string const& operation, CasedString const& comparator ) + : m_comparator( comparator ), + m_operation( operation ) { + } + + std::string StringMatcherBase::describe() const { + std::string description; + description.reserve(5 + m_operation.size() + m_comparator.m_str.size() + + m_comparator.caseSensitivitySuffix().size()); + description += m_operation; + description += ": \""; + description += m_comparator.m_str; + description += "\""; + description += m_comparator.caseSensitivitySuffix(); + return description; + } + + EqualsMatcher::EqualsMatcher( CasedString const& comparator ) : StringMatcherBase( "equals", comparator ) {} + + bool EqualsMatcher::match( std::string const& source ) const { + return m_comparator.adjustString( source ) == m_comparator.m_str; + } + + ContainsMatcher::ContainsMatcher( CasedString const& comparator ) : StringMatcherBase( "contains", comparator ) {} + + bool ContainsMatcher::match( std::string const& source ) const { + return contains( m_comparator.adjustString( source ), m_comparator.m_str ); + } + + StartsWithMatcher::StartsWithMatcher( CasedString const& comparator ) : StringMatcherBase( "starts with", comparator ) {} + + bool StartsWithMatcher::match( std::string const& source ) const { + return startsWith( m_comparator.adjustString( source ), m_comparator.m_str ); + } + + EndsWithMatcher::EndsWithMatcher( CasedString const& comparator ) : StringMatcherBase( "ends with", comparator ) {} + + bool EndsWithMatcher::match( std::string const& source ) const { + return endsWith( m_comparator.adjustString( source ), m_comparator.m_str ); + } + + RegexMatcher::RegexMatcher(std::string regex, CaseSensitive::Choice caseSensitivity): m_regex(std::move(regex)), m_caseSensitivity(caseSensitivity) {} + + bool RegexMatcher::match(std::string const& matchee) const { + auto flags = std::regex::ECMAScript; // ECMAScript is the default syntax option anyway + if (m_caseSensitivity == CaseSensitive::Choice::No) { + flags |= std::regex::icase; + } + auto reg = std::regex(m_regex, flags); + return std::regex_match(matchee, reg); + } + + std::string RegexMatcher::describe() const { + return "matches " + ::Catch::Detail::stringify(m_regex) + ((m_caseSensitivity == CaseSensitive::Choice::Yes)? " case sensitively" : " case insensitively"); + } + + } // namespace StdString + + StdString::EqualsMatcher Equals( std::string const& str, CaseSensitive::Choice caseSensitivity ) { + return StdString::EqualsMatcher( StdString::CasedString( str, caseSensitivity) ); + } + StdString::ContainsMatcher Contains( std::string const& str, CaseSensitive::Choice caseSensitivity ) { + return StdString::ContainsMatcher( StdString::CasedString( str, caseSensitivity) ); + } + StdString::EndsWithMatcher EndsWith( std::string const& str, CaseSensitive::Choice caseSensitivity ) { + return StdString::EndsWithMatcher( StdString::CasedString( str, caseSensitivity) ); + } + StdString::StartsWithMatcher StartsWith( std::string const& str, CaseSensitive::Choice caseSensitivity ) { + return StdString::StartsWithMatcher( StdString::CasedString( str, caseSensitivity) ); + } + + StdString::RegexMatcher Matches(std::string const& regex, CaseSensitive::Choice caseSensitivity) { + return StdString::RegexMatcher(regex, caseSensitivity); + } + +} // namespace Matchers +} // namespace Catch +// end catch_matchers_string.cpp +// start catch_message.cpp + +// start catch_uncaught_exceptions.h + +namespace Catch { + bool uncaught_exceptions(); +} // end namespace Catch + +// end catch_uncaught_exceptions.h +#include +#include + +namespace Catch { + + MessageInfo::MessageInfo( StringRef const& _macroName, + SourceLineInfo const& _lineInfo, + ResultWas::OfType _type ) + : macroName( _macroName ), + lineInfo( _lineInfo ), + type( _type ), + sequence( ++globalCount ) + {} + + bool MessageInfo::operator==( MessageInfo const& other ) const { + return sequence == other.sequence; + } + + bool MessageInfo::operator<( MessageInfo const& other ) const { + return sequence < other.sequence; + } + + // This may need protecting if threading support is added + unsigned int MessageInfo::globalCount = 0; + + //////////////////////////////////////////////////////////////////////////// + + Catch::MessageBuilder::MessageBuilder( StringRef const& macroName, + SourceLineInfo const& lineInfo, + ResultWas::OfType type ) + :m_info(macroName, lineInfo, type) {} + + //////////////////////////////////////////////////////////////////////////// + + ScopedMessage::ScopedMessage( MessageBuilder const& builder ) + : m_info( builder.m_info ), m_moved() + { + m_info.message = builder.m_stream.str(); + getResultCapture().pushScopedMessage( m_info ); + } + + ScopedMessage::ScopedMessage( ScopedMessage&& old ) + : m_info( old.m_info ), m_moved() + { + old.m_moved = true; + } + + ScopedMessage::~ScopedMessage() { + if ( !uncaught_exceptions() && !m_moved ){ + getResultCapture().popScopedMessage(m_info); + } + } + + Capturer::Capturer( StringRef macroName, SourceLineInfo const& lineInfo, ResultWas::OfType resultType, StringRef names ) { + auto trimmed = [&] (size_t start, size_t end) { + while (names[start] == ',' || isspace(names[start])) { + ++start; + } + while (names[end] == ',' || isspace(names[end])) { + --end; + } + return names.substr(start, end - start + 1); + }; + + size_t start = 0; + std::stack openings; + for (size_t pos = 0; pos < names.size(); ++pos) { + char c = names[pos]; + switch (c) { + case '[': + case '{': + case '(': + // It is basically impossible to disambiguate between + // comparison and start of template args in this context +// case '<': + openings.push(c); + break; + case ']': + case '}': + case ')': +// case '>': + openings.pop(); + break; + case ',': + if (start != pos && openings.size() == 0) { + m_messages.emplace_back(macroName, lineInfo, resultType); + m_messages.back().message = trimmed(start, pos); + m_messages.back().message += " := "; + start = pos; + } + } + } + assert(openings.size() == 0 && "Mismatched openings"); + m_messages.emplace_back(macroName, lineInfo, resultType); + m_messages.back().message = trimmed(start, names.size() - 1); + m_messages.back().message += " := "; + } + Capturer::~Capturer() { + if ( !uncaught_exceptions() ){ + assert( m_captured == m_messages.size() ); + for( size_t i = 0; i < m_captured; ++i ) + m_resultCapture.popScopedMessage( m_messages[i] ); + } + } + + void Capturer::captureValue( size_t index, std::string const& value ) { + assert( index < m_messages.size() ); + m_messages[index].message += value; + m_resultCapture.pushScopedMessage( m_messages[index] ); + m_captured++; + } + +} // end namespace Catch +// end catch_message.cpp +// start catch_output_redirect.cpp + +// start catch_output_redirect.h +#ifndef TWOBLUECUBES_CATCH_OUTPUT_REDIRECT_H +#define TWOBLUECUBES_CATCH_OUTPUT_REDIRECT_H + +#include +#include +#include + +namespace Catch { + + class RedirectedStream { + std::ostream& m_originalStream; + std::ostream& m_redirectionStream; + std::streambuf* m_prevBuf; + + public: + RedirectedStream( std::ostream& originalStream, std::ostream& redirectionStream ); + ~RedirectedStream(); + }; + + class RedirectedStdOut { + ReusableStringStream m_rss; + RedirectedStream m_cout; + public: + RedirectedStdOut(); + auto str() const -> std::string; + }; + + // StdErr has two constituent streams in C++, std::cerr and std::clog + // This means that we need to redirect 2 streams into 1 to keep proper + // order of writes + class RedirectedStdErr { + ReusableStringStream m_rss; + RedirectedStream m_cerr; + RedirectedStream m_clog; + public: + RedirectedStdErr(); + auto str() const -> std::string; + }; + + class RedirectedStreams { + public: + RedirectedStreams(RedirectedStreams const&) = delete; + RedirectedStreams& operator=(RedirectedStreams const&) = delete; + RedirectedStreams(RedirectedStreams&&) = delete; + RedirectedStreams& operator=(RedirectedStreams&&) = delete; + + RedirectedStreams(std::string& redirectedCout, std::string& redirectedCerr); + ~RedirectedStreams(); + private: + std::string& m_redirectedCout; + std::string& m_redirectedCerr; + RedirectedStdOut m_redirectedStdOut; + RedirectedStdErr m_redirectedStdErr; + }; + +#if defined(CATCH_CONFIG_NEW_CAPTURE) + + // Windows's implementation of std::tmpfile is terrible (it tries + // to create a file inside system folder, thus requiring elevated + // privileges for the binary), so we have to use tmpnam(_s) and + // create the file ourselves there. + class TempFile { + public: + TempFile(TempFile const&) = delete; + TempFile& operator=(TempFile const&) = delete; + TempFile(TempFile&&) = delete; + TempFile& operator=(TempFile&&) = delete; + + TempFile(); + ~TempFile(); + + std::FILE* getFile(); + std::string getContents(); + + private: + std::FILE* m_file = nullptr; + #if defined(_MSC_VER) + char m_buffer[L_tmpnam] = { 0 }; + #endif + }; + + class OutputRedirect { + public: + OutputRedirect(OutputRedirect const&) = delete; + OutputRedirect& operator=(OutputRedirect const&) = delete; + OutputRedirect(OutputRedirect&&) = delete; + OutputRedirect& operator=(OutputRedirect&&) = delete; + + OutputRedirect(std::string& stdout_dest, std::string& stderr_dest); + ~OutputRedirect(); + + private: + int m_originalStdout = -1; + int m_originalStderr = -1; + TempFile m_stdoutFile; + TempFile m_stderrFile; + std::string& m_stdoutDest; + std::string& m_stderrDest; + }; + +#endif + +} // end namespace Catch + +#endif // TWOBLUECUBES_CATCH_OUTPUT_REDIRECT_H +// end catch_output_redirect.h +#include +#include +#include +#include +#include + +#if defined(CATCH_CONFIG_NEW_CAPTURE) + #if defined(_MSC_VER) + #include //_dup and _dup2 + #define dup _dup + #define dup2 _dup2 + #define fileno _fileno + #else + #include // dup and dup2 + #endif +#endif + +namespace Catch { + + RedirectedStream::RedirectedStream( std::ostream& originalStream, std::ostream& redirectionStream ) + : m_originalStream( originalStream ), + m_redirectionStream( redirectionStream ), + m_prevBuf( m_originalStream.rdbuf() ) + { + m_originalStream.rdbuf( m_redirectionStream.rdbuf() ); + } + + RedirectedStream::~RedirectedStream() { + m_originalStream.rdbuf( m_prevBuf ); + } + + RedirectedStdOut::RedirectedStdOut() : m_cout( Catch::cout(), m_rss.get() ) {} + auto RedirectedStdOut::str() const -> std::string { return m_rss.str(); } + + RedirectedStdErr::RedirectedStdErr() + : m_cerr( Catch::cerr(), m_rss.get() ), + m_clog( Catch::clog(), m_rss.get() ) + {} + auto RedirectedStdErr::str() const -> std::string { return m_rss.str(); } + + RedirectedStreams::RedirectedStreams(std::string& redirectedCout, std::string& redirectedCerr) + : m_redirectedCout(redirectedCout), + m_redirectedCerr(redirectedCerr) + {} + + RedirectedStreams::~RedirectedStreams() { + m_redirectedCout += m_redirectedStdOut.str(); + m_redirectedCerr += m_redirectedStdErr.str(); + } + +#if defined(CATCH_CONFIG_NEW_CAPTURE) + +#if defined(_MSC_VER) + TempFile::TempFile() { + if (tmpnam_s(m_buffer)) { + CATCH_RUNTIME_ERROR("Could not get a temp filename"); + } + if (fopen_s(&m_file, m_buffer, "w")) { + char buffer[100]; + if (strerror_s(buffer, errno)) { + CATCH_RUNTIME_ERROR("Could not translate errno to a string"); + } + CATCH_RUNTIME_ERROR("Coul dnot open the temp file: '" << m_buffer << "' because: " << buffer); + } + } +#else + TempFile::TempFile() { + m_file = std::tmpfile(); + if (!m_file) { + CATCH_RUNTIME_ERROR("Could not create a temp file."); + } + } + +#endif + + TempFile::~TempFile() { + // TBD: What to do about errors here? + std::fclose(m_file); + // We manually create the file on Windows only, on Linux + // it will be autodeleted +#if defined(_MSC_VER) + std::remove(m_buffer); +#endif + } + + FILE* TempFile::getFile() { + return m_file; + } + + std::string TempFile::getContents() { + std::stringstream sstr; + char buffer[100] = {}; + std::rewind(m_file); + while (std::fgets(buffer, sizeof(buffer), m_file)) { + sstr << buffer; + } + return sstr.str(); + } + + OutputRedirect::OutputRedirect(std::string& stdout_dest, std::string& stderr_dest) : + m_originalStdout(dup(1)), + m_originalStderr(dup(2)), + m_stdoutDest(stdout_dest), + m_stderrDest(stderr_dest) { + dup2(fileno(m_stdoutFile.getFile()), 1); + dup2(fileno(m_stderrFile.getFile()), 2); + } + + OutputRedirect::~OutputRedirect() { + Catch::cout() << std::flush; + fflush(stdout); + // Since we support overriding these streams, we flush cerr + // even though std::cerr is unbuffered + Catch::cerr() << std::flush; + Catch::clog() << std::flush; + fflush(stderr); + + dup2(m_originalStdout, 1); + dup2(m_originalStderr, 2); + + m_stdoutDest += m_stdoutFile.getContents(); + m_stderrDest += m_stderrFile.getContents(); + } + +#endif // CATCH_CONFIG_NEW_CAPTURE + +} // namespace Catch + +#if defined(CATCH_CONFIG_NEW_CAPTURE) + #if defined(_MSC_VER) + #undef dup + #undef dup2 + #undef fileno + #endif +#endif +// end catch_output_redirect.cpp +// start catch_polyfills.cpp + +#include + +namespace Catch { + +#if !defined(CATCH_CONFIG_POLYFILL_ISNAN) + bool isnan(float f) { + return std::isnan(f); + } + bool isnan(double d) { + return std::isnan(d); + } +#else + // For now we only use this for embarcadero + bool isnan(float f) { + return std::_isnan(f); + } + bool isnan(double d) { + return std::_isnan(d); + } +#endif + +} // end namespace Catch +// end catch_polyfills.cpp +// start catch_random_number_generator.cpp + +namespace Catch { + + std::mt19937& rng() { + static std::mt19937 s_rng; + return s_rng; + } + + void seedRng( IConfig const& config ) { + if( config.rngSeed() != 0 ) { + std::srand( config.rngSeed() ); + rng().seed( config.rngSeed() ); + } + } + + unsigned int rngSeed() { + return getCurrentContext().getConfig()->rngSeed(); + } +} +// end catch_random_number_generator.cpp +// start catch_registry_hub.cpp + +// start catch_test_case_registry_impl.h + +#include +#include +#include +#include + +namespace Catch { + + class TestCase; + struct IConfig; + + std::vector sortTests( IConfig const& config, std::vector const& unsortedTestCases ); + bool matchTest( TestCase const& testCase, TestSpec const& testSpec, IConfig const& config ); + + void enforceNoDuplicateTestCases( std::vector const& functions ); + + std::vector filterTests( std::vector const& testCases, TestSpec const& testSpec, IConfig const& config ); + std::vector const& getAllTestCasesSorted( IConfig const& config ); + + class TestRegistry : public ITestCaseRegistry { + public: + virtual ~TestRegistry() = default; + + virtual void registerTest( TestCase const& testCase ); + + std::vector const& getAllTests() const override; + std::vector const& getAllTestsSorted( IConfig const& config ) const override; + + private: + std::vector m_functions; + mutable RunTests::InWhatOrder m_currentSortOrder = RunTests::InDeclarationOrder; + mutable std::vector m_sortedFunctions; + std::size_t m_unnamedCount = 0; + std::ios_base::Init m_ostreamInit; // Forces cout/ cerr to be initialised + }; + + /////////////////////////////////////////////////////////////////////////// + + class TestInvokerAsFunction : public ITestInvoker { + void(*m_testAsFunction)(); + public: + TestInvokerAsFunction( void(*testAsFunction)() ) noexcept; + + void invoke() const override; + }; + + std::string extractClassName( StringRef const& classOrQualifiedMethodName ); + + /////////////////////////////////////////////////////////////////////////// + +} // end namespace Catch + +// end catch_test_case_registry_impl.h +// start catch_reporter_registry.h + +#include + +namespace Catch { + + class ReporterRegistry : public IReporterRegistry { + + public: + + ~ReporterRegistry() override; + + IStreamingReporterPtr create( std::string const& name, IConfigPtr const& config ) const override; + + void registerReporter( std::string const& name, IReporterFactoryPtr const& factory ); + void registerListener( IReporterFactoryPtr const& factory ); + + FactoryMap const& getFactories() const override; + Listeners const& getListeners() const override; + + private: + FactoryMap m_factories; + Listeners m_listeners; + }; +} + +// end catch_reporter_registry.h +// start catch_tag_alias_registry.h + +// start catch_tag_alias.h + +#include + +namespace Catch { + + struct TagAlias { + TagAlias(std::string const& _tag, SourceLineInfo _lineInfo); + + std::string tag; + SourceLineInfo lineInfo; + }; + +} // end namespace Catch + +// end catch_tag_alias.h +#include + +namespace Catch { + + class TagAliasRegistry : public ITagAliasRegistry { + public: + ~TagAliasRegistry() override; + TagAlias const* find( std::string const& alias ) const override; + std::string expandAliases( std::string const& unexpandedTestSpec ) const override; + void add( std::string const& alias, std::string const& tag, SourceLineInfo const& lineInfo ); + + private: + std::map m_registry; + }; + +} // end namespace Catch + +// end catch_tag_alias_registry.h +// start catch_startup_exception_registry.h + +#include +#include + +namespace Catch { + + class StartupExceptionRegistry { + public: + void add(std::exception_ptr const& exception) noexcept; + std::vector const& getExceptions() const noexcept; + private: + std::vector m_exceptions; + }; + +} // end namespace Catch + +// end catch_startup_exception_registry.h +// start catch_singletons.hpp + +namespace Catch { + + struct ISingleton { + virtual ~ISingleton(); + }; + + void addSingleton( ISingleton* singleton ); + void cleanupSingletons(); + + template + class Singleton : SingletonImplT, public ISingleton { + + static auto getInternal() -> Singleton* { + static Singleton* s_instance = nullptr; + if( !s_instance ) { + s_instance = new Singleton; + addSingleton( s_instance ); + } + return s_instance; + } + + public: + static auto get() -> InterfaceT const& { + return *getInternal(); + } + static auto getMutable() -> MutableInterfaceT& { + return *getInternal(); + } + }; + +} // namespace Catch + +// end catch_singletons.hpp +namespace Catch { + + namespace { + + class RegistryHub : public IRegistryHub, public IMutableRegistryHub, + private NonCopyable { + + public: // IRegistryHub + RegistryHub() = default; + IReporterRegistry const& getReporterRegistry() const override { + return m_reporterRegistry; + } + ITestCaseRegistry const& getTestCaseRegistry() const override { + return m_testCaseRegistry; + } + IExceptionTranslatorRegistry const& getExceptionTranslatorRegistry() const override { + return m_exceptionTranslatorRegistry; + } + ITagAliasRegistry const& getTagAliasRegistry() const override { + return m_tagAliasRegistry; + } + StartupExceptionRegistry const& getStartupExceptionRegistry() const override { + return m_exceptionRegistry; + } + + public: // IMutableRegistryHub + void registerReporter( std::string const& name, IReporterFactoryPtr const& factory ) override { + m_reporterRegistry.registerReporter( name, factory ); + } + void registerListener( IReporterFactoryPtr const& factory ) override { + m_reporterRegistry.registerListener( factory ); + } + void registerTest( TestCase const& testInfo ) override { + m_testCaseRegistry.registerTest( testInfo ); + } + void registerTranslator( const IExceptionTranslator* translator ) override { + m_exceptionTranslatorRegistry.registerTranslator( translator ); + } + void registerTagAlias( std::string const& alias, std::string const& tag, SourceLineInfo const& lineInfo ) override { + m_tagAliasRegistry.add( alias, tag, lineInfo ); + } + void registerStartupException() noexcept override { + m_exceptionRegistry.add(std::current_exception()); + } + + private: + TestRegistry m_testCaseRegistry; + ReporterRegistry m_reporterRegistry; + ExceptionTranslatorRegistry m_exceptionTranslatorRegistry; + TagAliasRegistry m_tagAliasRegistry; + StartupExceptionRegistry m_exceptionRegistry; + }; + } + + using RegistryHubSingleton = Singleton; + + IRegistryHub const& getRegistryHub() { + return RegistryHubSingleton::get(); + } + IMutableRegistryHub& getMutableRegistryHub() { + return RegistryHubSingleton::getMutable(); + } + void cleanUp() { + cleanupSingletons(); + cleanUpContext(); + } + std::string translateActiveException() { + return getRegistryHub().getExceptionTranslatorRegistry().translateActiveException(); + } + +} // end namespace Catch +// end catch_registry_hub.cpp +// start catch_reporter_registry.cpp + +namespace Catch { + + ReporterRegistry::~ReporterRegistry() = default; + + IStreamingReporterPtr ReporterRegistry::create( std::string const& name, IConfigPtr const& config ) const { + auto it = m_factories.find( name ); + if( it == m_factories.end() ) + return nullptr; + return it->second->create( ReporterConfig( config ) ); + } + + void ReporterRegistry::registerReporter( std::string const& name, IReporterFactoryPtr const& factory ) { + m_factories.emplace(name, factory); + } + void ReporterRegistry::registerListener( IReporterFactoryPtr const& factory ) { + m_listeners.push_back( factory ); + } + + IReporterRegistry::FactoryMap const& ReporterRegistry::getFactories() const { + return m_factories; + } + IReporterRegistry::Listeners const& ReporterRegistry::getListeners() const { + return m_listeners; + } + +} +// end catch_reporter_registry.cpp +// start catch_result_type.cpp + +namespace Catch { + + bool isOk( ResultWas::OfType resultType ) { + return ( resultType & ResultWas::FailureBit ) == 0; + } + bool isJustInfo( int flags ) { + return flags == ResultWas::Info; + } + + ResultDisposition::Flags operator | ( ResultDisposition::Flags lhs, ResultDisposition::Flags rhs ) { + return static_cast( static_cast( lhs ) | static_cast( rhs ) ); + } + + bool shouldContinueOnFailure( int flags ) { return ( flags & ResultDisposition::ContinueOnFailure ) != 0; } + bool shouldSuppressFailure( int flags ) { return ( flags & ResultDisposition::SuppressFail ) != 0; } + +} // end namespace Catch +// end catch_result_type.cpp +// start catch_run_context.cpp + +#include +#include +#include + +namespace Catch { + + namespace Generators { + struct GeneratorTracker : TestCaseTracking::TrackerBase, IGeneratorTracker { + GeneratorBasePtr m_generator; + + GeneratorTracker( TestCaseTracking::NameAndLocation const& nameAndLocation, TrackerContext& ctx, ITracker* parent ) + : TrackerBase( nameAndLocation, ctx, parent ) + {} + ~GeneratorTracker(); + + static GeneratorTracker& acquire( TrackerContext& ctx, TestCaseTracking::NameAndLocation const& nameAndLocation ) { + std::shared_ptr tracker; + + ITracker& currentTracker = ctx.currentTracker(); + if( TestCaseTracking::ITrackerPtr childTracker = currentTracker.findChild( nameAndLocation ) ) { + assert( childTracker ); + assert( childTracker->isGeneratorTracker() ); + tracker = std::static_pointer_cast( childTracker ); + } + else { + tracker = std::make_shared( nameAndLocation, ctx, ¤tTracker ); + currentTracker.addChild( tracker ); + } + + if( !ctx.completedCycle() && !tracker->isComplete() ) { + tracker->open(); + } + + return *tracker; + } + + // TrackerBase interface + bool isGeneratorTracker() const override { return true; } + auto hasGenerator() const -> bool override { + return !!m_generator; + } + void close() override { + TrackerBase::close(); + // Generator interface only finds out if it has another item on atual move + if (m_runState == CompletedSuccessfully && m_generator->next()) { + m_children.clear(); + m_runState = Executing; + } + } + + // IGeneratorTracker interface + auto getGenerator() const -> GeneratorBasePtr const& override { + return m_generator; + } + void setGenerator( GeneratorBasePtr&& generator ) override { + m_generator = std::move( generator ); + } + }; + GeneratorTracker::~GeneratorTracker() {} + } + + RunContext::RunContext(IConfigPtr const& _config, IStreamingReporterPtr&& reporter) + : m_runInfo(_config->name()), + m_context(getCurrentMutableContext()), + m_config(_config), + m_reporter(std::move(reporter)), + m_lastAssertionInfo{ StringRef(), SourceLineInfo("",0), StringRef(), ResultDisposition::Normal }, + m_includeSuccessfulResults( m_config->includeSuccessfulResults() || m_reporter->getPreferences().shouldReportAllAssertions ) + { + m_context.setRunner(this); + m_context.setConfig(m_config); + m_context.setResultCapture(this); + m_reporter->testRunStarting(m_runInfo); + } + + RunContext::~RunContext() { + m_reporter->testRunEnded(TestRunStats(m_runInfo, m_totals, aborting())); + } + + void RunContext::testGroupStarting(std::string const& testSpec, std::size_t groupIndex, std::size_t groupsCount) { + m_reporter->testGroupStarting(GroupInfo(testSpec, groupIndex, groupsCount)); + } + + void RunContext::testGroupEnded(std::string const& testSpec, Totals const& totals, std::size_t groupIndex, std::size_t groupsCount) { + m_reporter->testGroupEnded(TestGroupStats(GroupInfo(testSpec, groupIndex, groupsCount), totals, aborting())); + } + + Totals RunContext::runTest(TestCase const& testCase) { + Totals prevTotals = m_totals; + + std::string redirectedCout; + std::string redirectedCerr; + + auto const& testInfo = testCase.getTestCaseInfo(); + + m_reporter->testCaseStarting(testInfo); + + m_activeTestCase = &testCase; + + ITracker& rootTracker = m_trackerContext.startRun(); + assert(rootTracker.isSectionTracker()); + static_cast(rootTracker).addInitialFilters(m_config->getSectionsToRun()); + do { + m_trackerContext.startCycle(); + m_testCaseTracker = &SectionTracker::acquire(m_trackerContext, TestCaseTracking::NameAndLocation(testInfo.name, testInfo.lineInfo)); + runCurrentTest(redirectedCout, redirectedCerr); + } while (!m_testCaseTracker->isSuccessfullyCompleted() && !aborting()); + + Totals deltaTotals = m_totals.delta(prevTotals); + if (testInfo.expectedToFail() && deltaTotals.testCases.passed > 0) { + deltaTotals.assertions.failed++; + deltaTotals.testCases.passed--; + deltaTotals.testCases.failed++; + } + m_totals.testCases += deltaTotals.testCases; + m_reporter->testCaseEnded(TestCaseStats(testInfo, + deltaTotals, + redirectedCout, + redirectedCerr, + aborting())); + + m_activeTestCase = nullptr; + m_testCaseTracker = nullptr; + + return deltaTotals; + } + + IConfigPtr RunContext::config() const { + return m_config; + } + + IStreamingReporter& RunContext::reporter() const { + return *m_reporter; + } + + void RunContext::assertionEnded(AssertionResult const & result) { + if (result.getResultType() == ResultWas::Ok) { + m_totals.assertions.passed++; + m_lastAssertionPassed = true; + } else if (!result.isOk()) { + m_lastAssertionPassed = false; + if( m_activeTestCase->getTestCaseInfo().okToFail() ) + m_totals.assertions.failedButOk++; + else + m_totals.assertions.failed++; + } + else { + m_lastAssertionPassed = true; + } + + // We have no use for the return value (whether messages should be cleared), because messages were made scoped + // and should be let to clear themselves out. + static_cast(m_reporter->assertionEnded(AssertionStats(result, m_messages, m_totals))); + + if (result.getResultType() != ResultWas::Warning) + m_messageScopes.clear(); + + // Reset working state + resetAssertionInfo(); + m_lastResult = result; + } + void RunContext::resetAssertionInfo() { + m_lastAssertionInfo.macroName = StringRef(); + m_lastAssertionInfo.capturedExpression = "{Unknown expression after the reported line}"_sr; + } + + bool RunContext::sectionStarted(SectionInfo const & sectionInfo, Counts & assertions) { + ITracker& sectionTracker = SectionTracker::acquire(m_trackerContext, TestCaseTracking::NameAndLocation(sectionInfo.name, sectionInfo.lineInfo)); + if (!sectionTracker.isOpen()) + return false; + m_activeSections.push_back(§ionTracker); + + m_lastAssertionInfo.lineInfo = sectionInfo.lineInfo; + + m_reporter->sectionStarting(sectionInfo); + + assertions = m_totals.assertions; + + return true; + } + auto RunContext::acquireGeneratorTracker( SourceLineInfo const& lineInfo ) -> IGeneratorTracker& { + using namespace Generators; + GeneratorTracker& tracker = GeneratorTracker::acquire( m_trackerContext, TestCaseTracking::NameAndLocation( "generator", lineInfo ) ); + assert( tracker.isOpen() ); + m_lastAssertionInfo.lineInfo = lineInfo; + return tracker; + } + + bool RunContext::testForMissingAssertions(Counts& assertions) { + if (assertions.total() != 0) + return false; + if (!m_config->warnAboutMissingAssertions()) + return false; + if (m_trackerContext.currentTracker().hasChildren()) + return false; + m_totals.assertions.failed++; + assertions.failed++; + return true; + } + + void RunContext::sectionEnded(SectionEndInfo const & endInfo) { + Counts assertions = m_totals.assertions - endInfo.prevAssertions; + bool missingAssertions = testForMissingAssertions(assertions); + + if (!m_activeSections.empty()) { + m_activeSections.back()->close(); + m_activeSections.pop_back(); + } + + m_reporter->sectionEnded(SectionStats(endInfo.sectionInfo, assertions, endInfo.durationInSeconds, missingAssertions)); + m_messages.clear(); + m_messageScopes.clear(); + } + + void RunContext::sectionEndedEarly(SectionEndInfo const & endInfo) { + if (m_unfinishedSections.empty()) + m_activeSections.back()->fail(); + else + m_activeSections.back()->close(); + m_activeSections.pop_back(); + + m_unfinishedSections.push_back(endInfo); + } + void RunContext::benchmarkStarting( BenchmarkInfo const& info ) { + m_reporter->benchmarkStarting( info ); + } + void RunContext::benchmarkEnded( BenchmarkStats const& stats ) { + m_reporter->benchmarkEnded( stats ); + } + + void RunContext::pushScopedMessage(MessageInfo const & message) { + m_messages.push_back(message); + } + + void RunContext::popScopedMessage(MessageInfo const & message) { + m_messages.erase(std::remove(m_messages.begin(), m_messages.end(), message), m_messages.end()); + } + + void RunContext::emplaceUnscopedMessage( MessageBuilder const& builder ) { + m_messageScopes.emplace_back( builder ); + } + + std::string RunContext::getCurrentTestName() const { + return m_activeTestCase + ? m_activeTestCase->getTestCaseInfo().name + : std::string(); + } + + const AssertionResult * RunContext::getLastResult() const { + return &(*m_lastResult); + } + + void RunContext::exceptionEarlyReported() { + m_shouldReportUnexpected = false; + } + + void RunContext::handleFatalErrorCondition( StringRef message ) { + // First notify reporter that bad things happened + m_reporter->fatalErrorEncountered(message); + + // Don't rebuild the result -- the stringification itself can cause more fatal errors + // Instead, fake a result data. + AssertionResultData tempResult( ResultWas::FatalErrorCondition, { false } ); + tempResult.message = message; + AssertionResult result(m_lastAssertionInfo, tempResult); + + assertionEnded(result); + + handleUnfinishedSections(); + + // Recreate section for test case (as we will lose the one that was in scope) + auto const& testCaseInfo = m_activeTestCase->getTestCaseInfo(); + SectionInfo testCaseSection(testCaseInfo.lineInfo, testCaseInfo.name); + + Counts assertions; + assertions.failed = 1; + SectionStats testCaseSectionStats(testCaseSection, assertions, 0, false); + m_reporter->sectionEnded(testCaseSectionStats); + + auto const& testInfo = m_activeTestCase->getTestCaseInfo(); + + Totals deltaTotals; + deltaTotals.testCases.failed = 1; + deltaTotals.assertions.failed = 1; + m_reporter->testCaseEnded(TestCaseStats(testInfo, + deltaTotals, + std::string(), + std::string(), + false)); + m_totals.testCases.failed++; + testGroupEnded(std::string(), m_totals, 1, 1); + m_reporter->testRunEnded(TestRunStats(m_runInfo, m_totals, false)); + } + + bool RunContext::lastAssertionPassed() { + return m_lastAssertionPassed; + } + + void RunContext::assertionPassed() { + m_lastAssertionPassed = true; + ++m_totals.assertions.passed; + resetAssertionInfo(); + m_messageScopes.clear(); + } + + bool RunContext::aborting() const { + return m_totals.assertions.failed >= static_cast(m_config->abortAfter()); + } + + void RunContext::runCurrentTest(std::string & redirectedCout, std::string & redirectedCerr) { + auto const& testCaseInfo = m_activeTestCase->getTestCaseInfo(); + SectionInfo testCaseSection(testCaseInfo.lineInfo, testCaseInfo.name); + m_reporter->sectionStarting(testCaseSection); + Counts prevAssertions = m_totals.assertions; + double duration = 0; + m_shouldReportUnexpected = true; + m_lastAssertionInfo = { "TEST_CASE"_sr, testCaseInfo.lineInfo, StringRef(), ResultDisposition::Normal }; + + seedRng(*m_config); + + Timer timer; + CATCH_TRY { + if (m_reporter->getPreferences().shouldRedirectStdOut) { +#if !defined(CATCH_CONFIG_EXPERIMENTAL_REDIRECT) + RedirectedStreams redirectedStreams(redirectedCout, redirectedCerr); + + timer.start(); + invokeActiveTestCase(); +#else + OutputRedirect r(redirectedCout, redirectedCerr); + timer.start(); + invokeActiveTestCase(); +#endif + } else { + timer.start(); + invokeActiveTestCase(); + } + duration = timer.getElapsedSeconds(); + } CATCH_CATCH_ANON (TestFailureException&) { + // This just means the test was aborted due to failure + } CATCH_CATCH_ALL { + // Under CATCH_CONFIG_FAST_COMPILE, unexpected exceptions under REQUIRE assertions + // are reported without translation at the point of origin. + if( m_shouldReportUnexpected ) { + AssertionReaction dummyReaction; + handleUnexpectedInflightException( m_lastAssertionInfo, translateActiveException(), dummyReaction ); + } + } + Counts assertions = m_totals.assertions - prevAssertions; + bool missingAssertions = testForMissingAssertions(assertions); + + m_testCaseTracker->close(); + handleUnfinishedSections(); + m_messages.clear(); + m_messageScopes.clear(); + + SectionStats testCaseSectionStats(testCaseSection, assertions, duration, missingAssertions); + m_reporter->sectionEnded(testCaseSectionStats); + } + + void RunContext::invokeActiveTestCase() { + FatalConditionHandler fatalConditionHandler; // Handle signals + m_activeTestCase->invoke(); + fatalConditionHandler.reset(); + } + + void RunContext::handleUnfinishedSections() { + // If sections ended prematurely due to an exception we stored their + // infos here so we can tear them down outside the unwind process. + for (auto it = m_unfinishedSections.rbegin(), + itEnd = m_unfinishedSections.rend(); + it != itEnd; + ++it) + sectionEnded(*it); + m_unfinishedSections.clear(); + } + + void RunContext::handleExpr( + AssertionInfo const& info, + ITransientExpression const& expr, + AssertionReaction& reaction + ) { + m_reporter->assertionStarting( info ); + + bool negated = isFalseTest( info.resultDisposition ); + bool result = expr.getResult() != negated; + + if( result ) { + if (!m_includeSuccessfulResults) { + assertionPassed(); + } + else { + reportExpr(info, ResultWas::Ok, &expr, negated); + } + } + else { + reportExpr(info, ResultWas::ExpressionFailed, &expr, negated ); + populateReaction( reaction ); + } + } + void RunContext::reportExpr( + AssertionInfo const &info, + ResultWas::OfType resultType, + ITransientExpression const *expr, + bool negated ) { + + m_lastAssertionInfo = info; + AssertionResultData data( resultType, LazyExpression( negated ) ); + + AssertionResult assertionResult{ info, data }; + assertionResult.m_resultData.lazyExpression.m_transientExpression = expr; + + assertionEnded( assertionResult ); + } + + void RunContext::handleMessage( + AssertionInfo const& info, + ResultWas::OfType resultType, + StringRef const& message, + AssertionReaction& reaction + ) { + m_reporter->assertionStarting( info ); + + m_lastAssertionInfo = info; + + AssertionResultData data( resultType, LazyExpression( false ) ); + data.message = message; + AssertionResult assertionResult{ m_lastAssertionInfo, data }; + assertionEnded( assertionResult ); + if( !assertionResult.isOk() ) + populateReaction( reaction ); + } + void RunContext::handleUnexpectedExceptionNotThrown( + AssertionInfo const& info, + AssertionReaction& reaction + ) { + handleNonExpr(info, Catch::ResultWas::DidntThrowException, reaction); + } + + void RunContext::handleUnexpectedInflightException( + AssertionInfo const& info, + std::string const& message, + AssertionReaction& reaction + ) { + m_lastAssertionInfo = info; + + AssertionResultData data( ResultWas::ThrewException, LazyExpression( false ) ); + data.message = message; + AssertionResult assertionResult{ info, data }; + assertionEnded( assertionResult ); + populateReaction( reaction ); + } + + void RunContext::populateReaction( AssertionReaction& reaction ) { + reaction.shouldDebugBreak = m_config->shouldDebugBreak(); + reaction.shouldThrow = aborting() || (m_lastAssertionInfo.resultDisposition & ResultDisposition::Normal); + } + + void RunContext::handleIncomplete( + AssertionInfo const& info + ) { + m_lastAssertionInfo = info; + + AssertionResultData data( ResultWas::ThrewException, LazyExpression( false ) ); + data.message = "Exception translation was disabled by CATCH_CONFIG_FAST_COMPILE"; + AssertionResult assertionResult{ info, data }; + assertionEnded( assertionResult ); + } + void RunContext::handleNonExpr( + AssertionInfo const &info, + ResultWas::OfType resultType, + AssertionReaction &reaction + ) { + m_lastAssertionInfo = info; + + AssertionResultData data( resultType, LazyExpression( false ) ); + AssertionResult assertionResult{ info, data }; + assertionEnded( assertionResult ); + + if( !assertionResult.isOk() ) + populateReaction( reaction ); + } + + IResultCapture& getResultCapture() { + if (auto* capture = getCurrentContext().getResultCapture()) + return *capture; + else + CATCH_INTERNAL_ERROR("No result capture instance"); + } +} +// end catch_run_context.cpp +// start catch_section.cpp + +namespace Catch { + + Section::Section( SectionInfo const& info ) + : m_info( info ), + m_sectionIncluded( getResultCapture().sectionStarted( m_info, m_assertions ) ) + { + m_timer.start(); + } + + Section::~Section() { + if( m_sectionIncluded ) { + SectionEndInfo endInfo{ m_info, m_assertions, m_timer.getElapsedSeconds() }; + if( uncaught_exceptions() ) + getResultCapture().sectionEndedEarly( endInfo ); + else + getResultCapture().sectionEnded( endInfo ); + } + } + + // This indicates whether the section should be executed or not + Section::operator bool() const { + return m_sectionIncluded; + } + +} // end namespace Catch +// end catch_section.cpp +// start catch_section_info.cpp + +namespace Catch { + + SectionInfo::SectionInfo + ( SourceLineInfo const& _lineInfo, + std::string const& _name ) + : name( _name ), + lineInfo( _lineInfo ) + {} + +} // end namespace Catch +// end catch_section_info.cpp +// start catch_session.cpp + +// start catch_session.h + +#include + +namespace Catch { + + class Session : NonCopyable { + public: + + Session(); + ~Session() override; + + void showHelp() const; + void libIdentify(); + + int applyCommandLine( int argc, char const * const * argv ); + #if defined(CATCH_CONFIG_WCHAR) && defined(WIN32) && defined(UNICODE) + int applyCommandLine( int argc, wchar_t const * const * argv ); + #endif + + void useConfigData( ConfigData const& configData ); + + template + int run(int argc, CharT const * const argv[]) { + if (m_startupExceptions) + return 1; + int returnCode = applyCommandLine(argc, argv); + if (returnCode == 0) + returnCode = run(); + return returnCode; + } + + int run(); + + clara::Parser const& cli() const; + void cli( clara::Parser const& newParser ); + ConfigData& configData(); + Config& config(); + private: + int runInternal(); + + clara::Parser m_cli; + ConfigData m_configData; + std::shared_ptr m_config; + bool m_startupExceptions = false; + }; + +} // end namespace Catch + +// end catch_session.h +// start catch_version.h + +#include + +namespace Catch { + + // Versioning information + struct Version { + Version( Version const& ) = delete; + Version& operator=( Version const& ) = delete; + Version( unsigned int _majorVersion, + unsigned int _minorVersion, + unsigned int _patchNumber, + char const * const _branchName, + unsigned int _buildNumber ); + + unsigned int const majorVersion; + unsigned int const minorVersion; + unsigned int const patchNumber; + + // buildNumber is only used if branchName is not null + char const * const branchName; + unsigned int const buildNumber; + + friend std::ostream& operator << ( std::ostream& os, Version const& version ); + }; + + Version const& libraryVersion(); +} + +// end catch_version.h +#include +#include + +namespace Catch { + + namespace { + const int MaxExitCode = 255; + + IStreamingReporterPtr createReporter(std::string const& reporterName, IConfigPtr const& config) { + auto reporter = Catch::getRegistryHub().getReporterRegistry().create(reporterName, config); + CATCH_ENFORCE(reporter, "No reporter registered with name: '" << reporterName << "'"); + + return reporter; + } + + IStreamingReporterPtr makeReporter(std::shared_ptr const& config) { + if (Catch::getRegistryHub().getReporterRegistry().getListeners().empty()) { + return createReporter(config->getReporterName(), config); + } + + // On older platforms, returning std::unique_ptr + // when the return type is std::unique_ptr + // doesn't compile without a std::move call. However, this causes + // a warning on newer platforms. Thus, we have to work around + // it a bit and downcast the pointer manually. + auto ret = std::unique_ptr(new ListeningReporter); + auto& multi = static_cast(*ret); + auto const& listeners = Catch::getRegistryHub().getReporterRegistry().getListeners(); + for (auto const& listener : listeners) { + multi.addListener(listener->create(Catch::ReporterConfig(config))); + } + multi.addReporter(createReporter(config->getReporterName(), config)); + return ret; + } + + Catch::Totals runTests(std::shared_ptr const& config) { + auto reporter = makeReporter(config); + + RunContext context(config, std::move(reporter)); + + Totals totals; + + context.testGroupStarting(config->name(), 1, 1); + + TestSpec testSpec = config->testSpec(); + + auto const& allTestCases = getAllTestCasesSorted(*config); + for (auto const& testCase : allTestCases) { + if (!context.aborting() && matchTest(testCase, testSpec, *config)) + totals += context.runTest(testCase); + else + context.reporter().skipTest(testCase); + } + + if (config->warnAboutNoTests() && totals.testCases.total() == 0) { + ReusableStringStream testConfig; + + bool first = true; + for (const auto& input : config->getTestsOrTags()) { + if (!first) { testConfig << ' '; } + first = false; + testConfig << input; + } + + context.reporter().noMatchingTestCases(testConfig.str()); + totals.error = -1; + } + + context.testGroupEnded(config->name(), totals, 1, 1); + return totals; + } + + void applyFilenamesAsTags(Catch::IConfig const& config) { + auto& tests = const_cast&>(getAllTestCasesSorted(config)); + for (auto& testCase : tests) { + auto tags = testCase.tags; + + std::string filename = testCase.lineInfo.file; + auto lastSlash = filename.find_last_of("\\/"); + if (lastSlash != std::string::npos) { + filename.erase(0, lastSlash); + filename[0] = '#'; + } + + auto lastDot = filename.find_last_of('.'); + if (lastDot != std::string::npos) { + filename.erase(lastDot); + } + + tags.push_back(std::move(filename)); + setTags(testCase, tags); + } + } + + } // anon namespace + + Session::Session() { + static bool alreadyInstantiated = false; + if( alreadyInstantiated ) { + CATCH_TRY { CATCH_INTERNAL_ERROR( "Only one instance of Catch::Session can ever be used" ); } + CATCH_CATCH_ALL { getMutableRegistryHub().registerStartupException(); } + } + + // There cannot be exceptions at startup in no-exception mode. +#if !defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) + const auto& exceptions = getRegistryHub().getStartupExceptionRegistry().getExceptions(); + if ( !exceptions.empty() ) { + m_startupExceptions = true; + Colour colourGuard( Colour::Red ); + Catch::cerr() << "Errors occurred during startup!" << '\n'; + // iterate over all exceptions and notify user + for ( const auto& ex_ptr : exceptions ) { + try { + std::rethrow_exception(ex_ptr); + } catch ( std::exception const& ex ) { + Catch::cerr() << Column( ex.what() ).indent(2) << '\n'; + } + } + } +#endif + + alreadyInstantiated = true; + m_cli = makeCommandLineParser( m_configData ); + } + Session::~Session() { + Catch::cleanUp(); + } + + void Session::showHelp() const { + Catch::cout() + << "\nCatch v" << libraryVersion() << "\n" + << m_cli << std::endl + << "For more detailed usage please see the project docs\n" << std::endl; + } + void Session::libIdentify() { + Catch::cout() + << std::left << std::setw(16) << "description: " << "A Catch test executable\n" + << std::left << std::setw(16) << "category: " << "testframework\n" + << std::left << std::setw(16) << "framework: " << "Catch Test\n" + << std::left << std::setw(16) << "version: " << libraryVersion() << std::endl; + } + + int Session::applyCommandLine( int argc, char const * const * argv ) { + if( m_startupExceptions ) + return 1; + + auto result = m_cli.parse( clara::Args( argc, argv ) ); + if( !result ) { + config(); + getCurrentMutableContext().setConfig(m_config); + Catch::cerr() + << Colour( Colour::Red ) + << "\nError(s) in input:\n" + << Column( result.errorMessage() ).indent( 2 ) + << "\n\n"; + Catch::cerr() << "Run with -? for usage\n" << std::endl; + return MaxExitCode; + } + + if( m_configData.showHelp ) + showHelp(); + if( m_configData.libIdentify ) + libIdentify(); + m_config.reset(); + return 0; + } + +#if defined(CATCH_CONFIG_WCHAR) && defined(WIN32) && defined(UNICODE) + int Session::applyCommandLine( int argc, wchar_t const * const * argv ) { + + char **utf8Argv = new char *[ argc ]; + + for ( int i = 0; i < argc; ++i ) { + int bufSize = WideCharToMultiByte( CP_UTF8, 0, argv[i], -1, NULL, 0, NULL, NULL ); + + utf8Argv[ i ] = new char[ bufSize ]; + + WideCharToMultiByte( CP_UTF8, 0, argv[i], -1, utf8Argv[i], bufSize, NULL, NULL ); + } + + int returnCode = applyCommandLine( argc, utf8Argv ); + + for ( int i = 0; i < argc; ++i ) + delete [] utf8Argv[ i ]; + + delete [] utf8Argv; + + return returnCode; + } +#endif + + void Session::useConfigData( ConfigData const& configData ) { + m_configData = configData; + m_config.reset(); + } + + int Session::run() { + if( ( m_configData.waitForKeypress & WaitForKeypress::BeforeStart ) != 0 ) { + Catch::cout() << "...waiting for enter/ return before starting" << std::endl; + static_cast(std::getchar()); + } + int exitCode = runInternal(); + if( ( m_configData.waitForKeypress & WaitForKeypress::BeforeExit ) != 0 ) { + Catch::cout() << "...waiting for enter/ return before exiting, with code: " << exitCode << std::endl; + static_cast(std::getchar()); + } + return exitCode; + } + + clara::Parser const& Session::cli() const { + return m_cli; + } + void Session::cli( clara::Parser const& newParser ) { + m_cli = newParser; + } + ConfigData& Session::configData() { + return m_configData; + } + Config& Session::config() { + if( !m_config ) + m_config = std::make_shared( m_configData ); + return *m_config; + } + + int Session::runInternal() { + if( m_startupExceptions ) + return 1; + + if (m_configData.showHelp || m_configData.libIdentify) { + return 0; + } + + CATCH_TRY { + config(); // Force config to be constructed + + seedRng( *m_config ); + + if( m_configData.filenamesAsTags ) + applyFilenamesAsTags( *m_config ); + + // Handle list request + if( Option listed = list( m_config ) ) + return static_cast( *listed ); + + auto totals = runTests( m_config ); + // Note that on unices only the lower 8 bits are usually used, clamping + // the return value to 255 prevents false negative when some multiple + // of 256 tests has failed + return (std::min) (MaxExitCode, (std::max) (totals.error, static_cast(totals.assertions.failed))); + } +#if !defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) + catch( std::exception& ex ) { + Catch::cerr() << ex.what() << std::endl; + return MaxExitCode; + } +#endif + } + +} // end namespace Catch +// end catch_session.cpp +// start catch_singletons.cpp + +#include + +namespace Catch { + + namespace { + static auto getSingletons() -> std::vector*& { + static std::vector* g_singletons = nullptr; + if( !g_singletons ) + g_singletons = new std::vector(); + return g_singletons; + } + } + + ISingleton::~ISingleton() {} + + void addSingleton(ISingleton* singleton ) { + getSingletons()->push_back( singleton ); + } + void cleanupSingletons() { + auto& singletons = getSingletons(); + for( auto singleton : *singletons ) + delete singleton; + delete singletons; + singletons = nullptr; + } + +} // namespace Catch +// end catch_singletons.cpp +// start catch_startup_exception_registry.cpp + +namespace Catch { +void StartupExceptionRegistry::add( std::exception_ptr const& exception ) noexcept { + CATCH_TRY { + m_exceptions.push_back(exception); + } CATCH_CATCH_ALL { + // If we run out of memory during start-up there's really not a lot more we can do about it + std::terminate(); + } + } + + std::vector const& StartupExceptionRegistry::getExceptions() const noexcept { + return m_exceptions; + } + +} // end namespace Catch +// end catch_startup_exception_registry.cpp +// start catch_stream.cpp + +#include +#include +#include +#include +#include +#include + +namespace Catch { + + Catch::IStream::~IStream() = default; + + namespace detail { namespace { + template + class StreamBufImpl : public std::streambuf { + char data[bufferSize]; + WriterF m_writer; + + public: + StreamBufImpl() { + setp( data, data + sizeof(data) ); + } + + ~StreamBufImpl() noexcept { + StreamBufImpl::sync(); + } + + private: + int overflow( int c ) override { + sync(); + + if( c != EOF ) { + if( pbase() == epptr() ) + m_writer( std::string( 1, static_cast( c ) ) ); + else + sputc( static_cast( c ) ); + } + return 0; + } + + int sync() override { + if( pbase() != pptr() ) { + m_writer( std::string( pbase(), static_cast( pptr() - pbase() ) ) ); + setp( pbase(), epptr() ); + } + return 0; + } + }; + + /////////////////////////////////////////////////////////////////////////// + + struct OutputDebugWriter { + + void operator()( std::string const&str ) { + writeToDebugConsole( str ); + } + }; + + /////////////////////////////////////////////////////////////////////////// + + class FileStream : public IStream { + mutable std::ofstream m_ofs; + public: + FileStream( StringRef filename ) { + m_ofs.open( filename.c_str() ); + CATCH_ENFORCE( !m_ofs.fail(), "Unable to open file: '" << filename << "'" ); + } + ~FileStream() override = default; + public: // IStream + std::ostream& stream() const override { + return m_ofs; + } + }; + + /////////////////////////////////////////////////////////////////////////// + + class CoutStream : public IStream { + mutable std::ostream m_os; + public: + // Store the streambuf from cout up-front because + // cout may get redirected when running tests + CoutStream() : m_os( Catch::cout().rdbuf() ) {} + ~CoutStream() override = default; + + public: // IStream + std::ostream& stream() const override { return m_os; } + }; + + /////////////////////////////////////////////////////////////////////////// + + class DebugOutStream : public IStream { + std::unique_ptr> m_streamBuf; + mutable std::ostream m_os; + public: + DebugOutStream() + : m_streamBuf( new StreamBufImpl() ), + m_os( m_streamBuf.get() ) + {} + + ~DebugOutStream() override = default; + + public: // IStream + std::ostream& stream() const override { return m_os; } + }; + + }} // namespace anon::detail + + /////////////////////////////////////////////////////////////////////////// + + auto makeStream( StringRef const &filename ) -> IStream const* { + if( filename.empty() ) + return new detail::CoutStream(); + else if( filename[0] == '%' ) { + if( filename == "%debug" ) + return new detail::DebugOutStream(); + else + CATCH_ERROR( "Unrecognised stream: '" << filename << "'" ); + } + else + return new detail::FileStream( filename ); + } + + // This class encapsulates the idea of a pool of ostringstreams that can be reused. + struct StringStreams { + std::vector> m_streams; + std::vector m_unused; + std::ostringstream m_referenceStream; // Used for copy state/ flags from + + auto add() -> std::size_t { + if( m_unused.empty() ) { + m_streams.push_back( std::unique_ptr( new std::ostringstream ) ); + return m_streams.size()-1; + } + else { + auto index = m_unused.back(); + m_unused.pop_back(); + return index; + } + } + + void release( std::size_t index ) { + m_streams[index]->copyfmt( m_referenceStream ); // Restore initial flags and other state + m_unused.push_back(index); + } + }; + + ReusableStringStream::ReusableStringStream() + : m_index( Singleton::getMutable().add() ), + m_oss( Singleton::getMutable().m_streams[m_index].get() ) + {} + + ReusableStringStream::~ReusableStringStream() { + static_cast( m_oss )->str(""); + m_oss->clear(); + Singleton::getMutable().release( m_index ); + } + + auto ReusableStringStream::str() const -> std::string { + return static_cast( m_oss )->str(); + } + + /////////////////////////////////////////////////////////////////////////// + +#ifndef CATCH_CONFIG_NOSTDOUT // If you #define this you must implement these functions + std::ostream& cout() { return std::cout; } + std::ostream& cerr() { return std::cerr; } + std::ostream& clog() { return std::clog; } +#endif +} +// end catch_stream.cpp +// start catch_string_manip.cpp + +#include +#include +#include +#include + +namespace Catch { + + namespace { + char toLowerCh(char c) { + return static_cast( std::tolower( c ) ); + } + } + + bool startsWith( std::string const& s, std::string const& prefix ) { + return s.size() >= prefix.size() && std::equal(prefix.begin(), prefix.end(), s.begin()); + } + bool startsWith( std::string const& s, char prefix ) { + return !s.empty() && s[0] == prefix; + } + bool endsWith( std::string const& s, std::string const& suffix ) { + return s.size() >= suffix.size() && std::equal(suffix.rbegin(), suffix.rend(), s.rbegin()); + } + bool endsWith( std::string const& s, char suffix ) { + return !s.empty() && s[s.size()-1] == suffix; + } + bool contains( std::string const& s, std::string const& infix ) { + return s.find( infix ) != std::string::npos; + } + void toLowerInPlace( std::string& s ) { + std::transform( s.begin(), s.end(), s.begin(), toLowerCh ); + } + std::string toLower( std::string const& s ) { + std::string lc = s; + toLowerInPlace( lc ); + return lc; + } + std::string trim( std::string const& str ) { + static char const* whitespaceChars = "\n\r\t "; + std::string::size_type start = str.find_first_not_of( whitespaceChars ); + std::string::size_type end = str.find_last_not_of( whitespaceChars ); + + return start != std::string::npos ? str.substr( start, 1+end-start ) : std::string(); + } + + bool replaceInPlace( std::string& str, std::string const& replaceThis, std::string const& withThis ) { + bool replaced = false; + std::size_t i = str.find( replaceThis ); + while( i != std::string::npos ) { + replaced = true; + str = str.substr( 0, i ) + withThis + str.substr( i+replaceThis.size() ); + if( i < str.size()-withThis.size() ) + i = str.find( replaceThis, i+withThis.size() ); + else + i = std::string::npos; + } + return replaced; + } + + pluralise::pluralise( std::size_t count, std::string const& label ) + : m_count( count ), + m_label( label ) + {} + + std::ostream& operator << ( std::ostream& os, pluralise const& pluraliser ) { + os << pluraliser.m_count << ' ' << pluraliser.m_label; + if( pluraliser.m_count != 1 ) + os << 's'; + return os; + } + +} +// end catch_string_manip.cpp +// start catch_stringref.cpp + +#if defined(__clang__) +# pragma clang diagnostic push +# pragma clang diagnostic ignored "-Wexit-time-destructors" +#endif + +#include +#include +#include + +namespace { + const uint32_t byte_2_lead = 0xC0; + const uint32_t byte_3_lead = 0xE0; + const uint32_t byte_4_lead = 0xF0; +} + +namespace Catch { + StringRef::StringRef( char const* rawChars ) noexcept + : StringRef( rawChars, static_cast(std::strlen(rawChars) ) ) + {} + + StringRef::operator std::string() const { + return std::string( m_start, m_size ); + } + + void StringRef::swap( StringRef& other ) noexcept { + std::swap( m_start, other.m_start ); + std::swap( m_size, other.m_size ); + std::swap( m_data, other.m_data ); + } + + auto StringRef::c_str() const -> char const* { + if( isSubstring() ) + const_cast( this )->takeOwnership(); + return m_start; + } + auto StringRef::currentData() const noexcept -> char const* { + return m_start; + } + + auto StringRef::isOwned() const noexcept -> bool { + return m_data != nullptr; + } + auto StringRef::isSubstring() const noexcept -> bool { + return m_start[m_size] != '\0'; + } + + void StringRef::takeOwnership() { + if( !isOwned() ) { + m_data = new char[m_size+1]; + memcpy( m_data, m_start, m_size ); + m_data[m_size] = '\0'; + m_start = m_data; + } + } + auto StringRef::substr( size_type start, size_type size ) const noexcept -> StringRef { + if( start < m_size ) + return StringRef( m_start+start, size ); + else + return StringRef(); + } + auto StringRef::operator == ( StringRef const& other ) const noexcept -> bool { + return + size() == other.size() && + (std::strncmp( m_start, other.m_start, size() ) == 0); + } + auto StringRef::operator != ( StringRef const& other ) const noexcept -> bool { + return !operator==( other ); + } + + auto StringRef::operator[](size_type index) const noexcept -> char { + return m_start[index]; + } + + auto StringRef::numberOfCharacters() const noexcept -> size_type { + size_type noChars = m_size; + // Make adjustments for uft encodings + for( size_type i=0; i < m_size; ++i ) { + char c = m_start[i]; + if( ( c & byte_2_lead ) == byte_2_lead ) { + noChars--; + if (( c & byte_3_lead ) == byte_3_lead ) + noChars--; + if( ( c & byte_4_lead ) == byte_4_lead ) + noChars--; + } + } + return noChars; + } + + auto operator + ( StringRef const& lhs, StringRef const& rhs ) -> std::string { + std::string str; + str.reserve( lhs.size() + rhs.size() ); + str += lhs; + str += rhs; + return str; + } + auto operator + ( StringRef const& lhs, const char* rhs ) -> std::string { + return std::string( lhs ) + std::string( rhs ); + } + auto operator + ( char const* lhs, StringRef const& rhs ) -> std::string { + return std::string( lhs ) + std::string( rhs ); + } + + auto operator << ( std::ostream& os, StringRef const& str ) -> std::ostream& { + return os.write(str.currentData(), str.size()); + } + + auto operator+=( std::string& lhs, StringRef const& rhs ) -> std::string& { + lhs.append(rhs.currentData(), rhs.size()); + return lhs; + } + +} // namespace Catch + +#if defined(__clang__) +# pragma clang diagnostic pop +#endif +// end catch_stringref.cpp +// start catch_tag_alias.cpp + +namespace Catch { + TagAlias::TagAlias(std::string const & _tag, SourceLineInfo _lineInfo): tag(_tag), lineInfo(_lineInfo) {} +} +// end catch_tag_alias.cpp +// start catch_tag_alias_autoregistrar.cpp + +namespace Catch { + + RegistrarForTagAliases::RegistrarForTagAliases(char const* alias, char const* tag, SourceLineInfo const& lineInfo) { + CATCH_TRY { + getMutableRegistryHub().registerTagAlias(alias, tag, lineInfo); + } CATCH_CATCH_ALL { + // Do not throw when constructing global objects, instead register the exception to be processed later + getMutableRegistryHub().registerStartupException(); + } + } + +} +// end catch_tag_alias_autoregistrar.cpp +// start catch_tag_alias_registry.cpp + +#include + +namespace Catch { + + TagAliasRegistry::~TagAliasRegistry() {} + + TagAlias const* TagAliasRegistry::find( std::string const& alias ) const { + auto it = m_registry.find( alias ); + if( it != m_registry.end() ) + return &(it->second); + else + return nullptr; + } + + std::string TagAliasRegistry::expandAliases( std::string const& unexpandedTestSpec ) const { + std::string expandedTestSpec = unexpandedTestSpec; + for( auto const& registryKvp : m_registry ) { + std::size_t pos = expandedTestSpec.find( registryKvp.first ); + if( pos != std::string::npos ) { + expandedTestSpec = expandedTestSpec.substr( 0, pos ) + + registryKvp.second.tag + + expandedTestSpec.substr( pos + registryKvp.first.size() ); + } + } + return expandedTestSpec; + } + + void TagAliasRegistry::add( std::string const& alias, std::string const& tag, SourceLineInfo const& lineInfo ) { + CATCH_ENFORCE( startsWith(alias, "[@") && endsWith(alias, ']'), + "error: tag alias, '" << alias << "' is not of the form [@alias name].\n" << lineInfo ); + + CATCH_ENFORCE( m_registry.insert(std::make_pair(alias, TagAlias(tag, lineInfo))).second, + "error: tag alias, '" << alias << "' already registered.\n" + << "\tFirst seen at: " << find(alias)->lineInfo << "\n" + << "\tRedefined at: " << lineInfo ); + } + + ITagAliasRegistry::~ITagAliasRegistry() {} + + ITagAliasRegistry const& ITagAliasRegistry::get() { + return getRegistryHub().getTagAliasRegistry(); + } + +} // end namespace Catch +// end catch_tag_alias_registry.cpp +// start catch_test_case_info.cpp + +#include +#include +#include +#include + +namespace Catch { + + namespace { + TestCaseInfo::SpecialProperties parseSpecialTag( std::string const& tag ) { + if( startsWith( tag, '.' ) || + tag == "!hide" ) + return TestCaseInfo::IsHidden; + else if( tag == "!throws" ) + return TestCaseInfo::Throws; + else if( tag == "!shouldfail" ) + return TestCaseInfo::ShouldFail; + else if( tag == "!mayfail" ) + return TestCaseInfo::MayFail; + else if( tag == "!nonportable" ) + return TestCaseInfo::NonPortable; + else if( tag == "!benchmark" ) + return static_cast( TestCaseInfo::Benchmark | TestCaseInfo::IsHidden ); + else + return TestCaseInfo::None; + } + bool isReservedTag( std::string const& tag ) { + return parseSpecialTag( tag ) == TestCaseInfo::None && tag.size() > 0 && !std::isalnum( static_cast(tag[0]) ); + } + void enforceNotReservedTag( std::string const& tag, SourceLineInfo const& _lineInfo ) { + CATCH_ENFORCE( !isReservedTag(tag), + "Tag name: [" << tag << "] is not allowed.\n" + << "Tag names starting with non alpha-numeric characters are reserved\n" + << _lineInfo ); + } + } + + TestCase makeTestCase( ITestInvoker* _testCase, + std::string const& _className, + NameAndTags const& nameAndTags, + SourceLineInfo const& _lineInfo ) + { + bool isHidden = false; + + // Parse out tags + std::vector tags; + std::string desc, tag; + bool inTag = false; + std::string _descOrTags = nameAndTags.tags; + for (char c : _descOrTags) { + if( !inTag ) { + if( c == '[' ) + inTag = true; + else + desc += c; + } + else { + if( c == ']' ) { + TestCaseInfo::SpecialProperties prop = parseSpecialTag( tag ); + if( ( prop & TestCaseInfo::IsHidden ) != 0 ) + isHidden = true; + else if( prop == TestCaseInfo::None ) + enforceNotReservedTag( tag, _lineInfo ); + + tags.push_back( tag ); + tag.clear(); + inTag = false; + } + else + tag += c; + } + } + if( isHidden ) { + tags.push_back( "." ); + } + + TestCaseInfo info( nameAndTags.name, _className, desc, tags, _lineInfo ); + return TestCase( _testCase, std::move(info) ); + } + + void setTags( TestCaseInfo& testCaseInfo, std::vector tags ) { + std::sort(begin(tags), end(tags)); + tags.erase(std::unique(begin(tags), end(tags)), end(tags)); + testCaseInfo.lcaseTags.clear(); + + for( auto const& tag : tags ) { + std::string lcaseTag = toLower( tag ); + testCaseInfo.properties = static_cast( testCaseInfo.properties | parseSpecialTag( lcaseTag ) ); + testCaseInfo.lcaseTags.push_back( lcaseTag ); + } + testCaseInfo.tags = std::move(tags); + } + + TestCaseInfo::TestCaseInfo( std::string const& _name, + std::string const& _className, + std::string const& _description, + std::vector const& _tags, + SourceLineInfo const& _lineInfo ) + : name( _name ), + className( _className ), + description( _description ), + lineInfo( _lineInfo ), + properties( None ) + { + setTags( *this, _tags ); + } + + bool TestCaseInfo::isHidden() const { + return ( properties & IsHidden ) != 0; + } + bool TestCaseInfo::throws() const { + return ( properties & Throws ) != 0; + } + bool TestCaseInfo::okToFail() const { + return ( properties & (ShouldFail | MayFail ) ) != 0; + } + bool TestCaseInfo::expectedToFail() const { + return ( properties & (ShouldFail ) ) != 0; + } + + std::string TestCaseInfo::tagsAsString() const { + std::string ret; + // '[' and ']' per tag + std::size_t full_size = 2 * tags.size(); + for (const auto& tag : tags) { + full_size += tag.size(); + } + ret.reserve(full_size); + for (const auto& tag : tags) { + ret.push_back('['); + ret.append(tag); + ret.push_back(']'); + } + + return ret; + } + + TestCase::TestCase( ITestInvoker* testCase, TestCaseInfo&& info ) : TestCaseInfo( std::move(info) ), test( testCase ) {} + + TestCase TestCase::withName( std::string const& _newName ) const { + TestCase other( *this ); + other.name = _newName; + return other; + } + + void TestCase::invoke() const { + test->invoke(); + } + + bool TestCase::operator == ( TestCase const& other ) const { + return test.get() == other.test.get() && + name == other.name && + className == other.className; + } + + bool TestCase::operator < ( TestCase const& other ) const { + return name < other.name; + } + + TestCaseInfo const& TestCase::getTestCaseInfo() const + { + return *this; + } + +} // end namespace Catch +// end catch_test_case_info.cpp +// start catch_test_case_registry_impl.cpp + +#include + +namespace Catch { + + std::vector sortTests( IConfig const& config, std::vector const& unsortedTestCases ) { + + std::vector sorted = unsortedTestCases; + + switch( config.runOrder() ) { + case RunTests::InLexicographicalOrder: + std::sort( sorted.begin(), sorted.end() ); + break; + case RunTests::InRandomOrder: + seedRng( config ); + std::shuffle( sorted.begin(), sorted.end(), rng() ); + break; + case RunTests::InDeclarationOrder: + // already in declaration order + break; + } + return sorted; + } + bool matchTest( TestCase const& testCase, TestSpec const& testSpec, IConfig const& config ) { + return testSpec.matches( testCase ) && ( config.allowThrows() || !testCase.throws() ); + } + + void enforceNoDuplicateTestCases( std::vector const& functions ) { + std::set seenFunctions; + for( auto const& function : functions ) { + auto prev = seenFunctions.insert( function ); + CATCH_ENFORCE( prev.second, + "error: TEST_CASE( \"" << function.name << "\" ) already defined.\n" + << "\tFirst seen at " << prev.first->getTestCaseInfo().lineInfo << "\n" + << "\tRedefined at " << function.getTestCaseInfo().lineInfo ); + } + } + + std::vector filterTests( std::vector const& testCases, TestSpec const& testSpec, IConfig const& config ) { + std::vector filtered; + filtered.reserve( testCases.size() ); + for( auto const& testCase : testCases ) + if( matchTest( testCase, testSpec, config ) ) + filtered.push_back( testCase ); + return filtered; + } + std::vector const& getAllTestCasesSorted( IConfig const& config ) { + return getRegistryHub().getTestCaseRegistry().getAllTestsSorted( config ); + } + + void TestRegistry::registerTest( TestCase const& testCase ) { + std::string name = testCase.getTestCaseInfo().name; + if( name.empty() ) { + ReusableStringStream rss; + rss << "Anonymous test case " << ++m_unnamedCount; + return registerTest( testCase.withName( rss.str() ) ); + } + m_functions.push_back( testCase ); + } + + std::vector const& TestRegistry::getAllTests() const { + return m_functions; + } + std::vector const& TestRegistry::getAllTestsSorted( IConfig const& config ) const { + if( m_sortedFunctions.empty() ) + enforceNoDuplicateTestCases( m_functions ); + + if( m_currentSortOrder != config.runOrder() || m_sortedFunctions.empty() ) { + m_sortedFunctions = sortTests( config, m_functions ); + m_currentSortOrder = config.runOrder(); + } + return m_sortedFunctions; + } + + /////////////////////////////////////////////////////////////////////////// + TestInvokerAsFunction::TestInvokerAsFunction( void(*testAsFunction)() ) noexcept : m_testAsFunction( testAsFunction ) {} + + void TestInvokerAsFunction::invoke() const { + m_testAsFunction(); + } + + std::string extractClassName( StringRef const& classOrQualifiedMethodName ) { + std::string className = classOrQualifiedMethodName; + if( startsWith( className, '&' ) ) + { + std::size_t lastColons = className.rfind( "::" ); + std::size_t penultimateColons = className.rfind( "::", lastColons-1 ); + if( penultimateColons == std::string::npos ) + penultimateColons = 1; + className = className.substr( penultimateColons, lastColons-penultimateColons ); + } + return className; + } + +} // end namespace Catch +// end catch_test_case_registry_impl.cpp +// start catch_test_case_tracker.cpp + +#include +#include +#include +#include +#include + +#if defined(__clang__) +# pragma clang diagnostic push +# pragma clang diagnostic ignored "-Wexit-time-destructors" +#endif + +namespace Catch { +namespace TestCaseTracking { + + NameAndLocation::NameAndLocation( std::string const& _name, SourceLineInfo const& _location ) + : name( _name ), + location( _location ) + {} + + ITracker::~ITracker() = default; + + TrackerContext& TrackerContext::instance() { + static TrackerContext s_instance; + return s_instance; + } + + ITracker& TrackerContext::startRun() { + m_rootTracker = std::make_shared( NameAndLocation( "{root}", CATCH_INTERNAL_LINEINFO ), *this, nullptr ); + m_currentTracker = nullptr; + m_runState = Executing; + return *m_rootTracker; + } + + void TrackerContext::endRun() { + m_rootTracker.reset(); + m_currentTracker = nullptr; + m_runState = NotStarted; + } + + void TrackerContext::startCycle() { + m_currentTracker = m_rootTracker.get(); + m_runState = Executing; + } + void TrackerContext::completeCycle() { + m_runState = CompletedCycle; + } + + bool TrackerContext::completedCycle() const { + return m_runState == CompletedCycle; + } + ITracker& TrackerContext::currentTracker() { + return *m_currentTracker; + } + void TrackerContext::setCurrentTracker( ITracker* tracker ) { + m_currentTracker = tracker; + } + + TrackerBase::TrackerBase( NameAndLocation const& nameAndLocation, TrackerContext& ctx, ITracker* parent ) + : m_nameAndLocation( nameAndLocation ), + m_ctx( ctx ), + m_parent( parent ) + {} + + NameAndLocation const& TrackerBase::nameAndLocation() const { + return m_nameAndLocation; + } + bool TrackerBase::isComplete() const { + return m_runState == CompletedSuccessfully || m_runState == Failed; + } + bool TrackerBase::isSuccessfullyCompleted() const { + return m_runState == CompletedSuccessfully; + } + bool TrackerBase::isOpen() const { + return m_runState != NotStarted && !isComplete(); + } + bool TrackerBase::hasChildren() const { + return !m_children.empty(); + } + + void TrackerBase::addChild( ITrackerPtr const& child ) { + m_children.push_back( child ); + } + + ITrackerPtr TrackerBase::findChild( NameAndLocation const& nameAndLocation ) { + auto it = std::find_if( m_children.begin(), m_children.end(), + [&nameAndLocation]( ITrackerPtr const& tracker ){ + return + tracker->nameAndLocation().location == nameAndLocation.location && + tracker->nameAndLocation().name == nameAndLocation.name; + } ); + return( it != m_children.end() ) + ? *it + : nullptr; + } + ITracker& TrackerBase::parent() { + assert( m_parent ); // Should always be non-null except for root + return *m_parent; + } + + void TrackerBase::openChild() { + if( m_runState != ExecutingChildren ) { + m_runState = ExecutingChildren; + if( m_parent ) + m_parent->openChild(); + } + } + + bool TrackerBase::isSectionTracker() const { return false; } + bool TrackerBase::isGeneratorTracker() const { return false; } + + void TrackerBase::open() { + m_runState = Executing; + moveToThis(); + if( m_parent ) + m_parent->openChild(); + } + + void TrackerBase::close() { + + // Close any still open children (e.g. generators) + while( &m_ctx.currentTracker() != this ) + m_ctx.currentTracker().close(); + + switch( m_runState ) { + case NeedsAnotherRun: + break; + + case Executing: + m_runState = CompletedSuccessfully; + break; + case ExecutingChildren: + if( m_children.empty() || m_children.back()->isComplete() ) + m_runState = CompletedSuccessfully; + break; + + case NotStarted: + case CompletedSuccessfully: + case Failed: + CATCH_INTERNAL_ERROR( "Illogical state: " << m_runState ); + + default: + CATCH_INTERNAL_ERROR( "Unknown state: " << m_runState ); + } + moveToParent(); + m_ctx.completeCycle(); + } + void TrackerBase::fail() { + m_runState = Failed; + if( m_parent ) + m_parent->markAsNeedingAnotherRun(); + moveToParent(); + m_ctx.completeCycle(); + } + void TrackerBase::markAsNeedingAnotherRun() { + m_runState = NeedsAnotherRun; + } + + void TrackerBase::moveToParent() { + assert( m_parent ); + m_ctx.setCurrentTracker( m_parent ); + } + void TrackerBase::moveToThis() { + m_ctx.setCurrentTracker( this ); + } + + SectionTracker::SectionTracker( NameAndLocation const& nameAndLocation, TrackerContext& ctx, ITracker* parent ) + : TrackerBase( nameAndLocation, ctx, parent ) + { + if( parent ) { + while( !parent->isSectionTracker() ) + parent = &parent->parent(); + + SectionTracker& parentSection = static_cast( *parent ); + addNextFilters( parentSection.m_filters ); + } + } + + bool SectionTracker::isComplete() const { + bool complete = true; + + if ((m_filters.empty() || m_filters[0] == "") || + std::find(m_filters.begin(), m_filters.end(), + m_nameAndLocation.name) != m_filters.end()) + complete = TrackerBase::isComplete(); + return complete; + + } + + bool SectionTracker::isSectionTracker() const { return true; } + + SectionTracker& SectionTracker::acquire( TrackerContext& ctx, NameAndLocation const& nameAndLocation ) { + std::shared_ptr section; + + ITracker& currentTracker = ctx.currentTracker(); + if( ITrackerPtr childTracker = currentTracker.findChild( nameAndLocation ) ) { + assert( childTracker ); + assert( childTracker->isSectionTracker() ); + section = std::static_pointer_cast( childTracker ); + } + else { + section = std::make_shared( nameAndLocation, ctx, ¤tTracker ); + currentTracker.addChild( section ); + } + if( !ctx.completedCycle() ) + section->tryOpen(); + return *section; + } + + void SectionTracker::tryOpen() { + if( !isComplete() && (m_filters.empty() || m_filters[0].empty() || m_filters[0] == m_nameAndLocation.name ) ) + open(); + } + + void SectionTracker::addInitialFilters( std::vector const& filters ) { + if( !filters.empty() ) { + m_filters.push_back(""); // Root - should never be consulted + m_filters.push_back(""); // Test Case - not a section filter + m_filters.insert( m_filters.end(), filters.begin(), filters.end() ); + } + } + void SectionTracker::addNextFilters( std::vector const& filters ) { + if( filters.size() > 1 ) + m_filters.insert( m_filters.end(), ++filters.begin(), filters.end() ); + } + +} // namespace TestCaseTracking + +using TestCaseTracking::ITracker; +using TestCaseTracking::TrackerContext; +using TestCaseTracking::SectionTracker; + +} // namespace Catch + +#if defined(__clang__) +# pragma clang diagnostic pop +#endif +// end catch_test_case_tracker.cpp +// start catch_test_registry.cpp + +namespace Catch { + + auto makeTestInvoker( void(*testAsFunction)() ) noexcept -> ITestInvoker* { + return new(std::nothrow) TestInvokerAsFunction( testAsFunction ); + } + + NameAndTags::NameAndTags( StringRef const& name_ , StringRef const& tags_ ) noexcept : name( name_ ), tags( tags_ ) {} + + AutoReg::AutoReg( ITestInvoker* invoker, SourceLineInfo const& lineInfo, StringRef const& classOrMethod, NameAndTags const& nameAndTags ) noexcept { + CATCH_TRY { + getMutableRegistryHub() + .registerTest( + makeTestCase( + invoker, + extractClassName( classOrMethod ), + nameAndTags, + lineInfo)); + } CATCH_CATCH_ALL { + // Do not throw when constructing global objects, instead register the exception to be processed later + getMutableRegistryHub().registerStartupException(); + } + } + + AutoReg::~AutoReg() = default; +} +// end catch_test_registry.cpp +// start catch_test_spec.cpp + +#include +#include +#include +#include + +namespace Catch { + + TestSpec::Pattern::~Pattern() = default; + TestSpec::NamePattern::~NamePattern() = default; + TestSpec::TagPattern::~TagPattern() = default; + TestSpec::ExcludedPattern::~ExcludedPattern() = default; + + TestSpec::NamePattern::NamePattern( std::string const& name ) + : m_wildcardPattern( toLower( name ), CaseSensitive::No ) + {} + bool TestSpec::NamePattern::matches( TestCaseInfo const& testCase ) const { + return m_wildcardPattern.matches( toLower( testCase.name ) ); + } + + TestSpec::TagPattern::TagPattern( std::string const& tag ) : m_tag( toLower( tag ) ) {} + bool TestSpec::TagPattern::matches( TestCaseInfo const& testCase ) const { + return std::find(begin(testCase.lcaseTags), + end(testCase.lcaseTags), + m_tag) != end(testCase.lcaseTags); + } + + TestSpec::ExcludedPattern::ExcludedPattern( PatternPtr const& underlyingPattern ) : m_underlyingPattern( underlyingPattern ) {} + bool TestSpec::ExcludedPattern::matches( TestCaseInfo const& testCase ) const { return !m_underlyingPattern->matches( testCase ); } + + bool TestSpec::Filter::matches( TestCaseInfo const& testCase ) const { + // All patterns in a filter must match for the filter to be a match + for( auto const& pattern : m_patterns ) { + if( !pattern->matches( testCase ) ) + return false; + } + return true; + } + + bool TestSpec::hasFilters() const { + return !m_filters.empty(); + } + bool TestSpec::matches( TestCaseInfo const& testCase ) const { + // A TestSpec matches if any filter matches + for( auto const& filter : m_filters ) + if( filter.matches( testCase ) ) + return true; + return false; + } +} +// end catch_test_spec.cpp +// start catch_test_spec_parser.cpp + +namespace Catch { + + TestSpecParser::TestSpecParser( ITagAliasRegistry const& tagAliases ) : m_tagAliases( &tagAliases ) {} + + TestSpecParser& TestSpecParser::parse( std::string const& arg ) { + m_mode = None; + m_exclusion = false; + m_start = std::string::npos; + m_arg = m_tagAliases->expandAliases( arg ); + m_escapeChars.clear(); + for( m_pos = 0; m_pos < m_arg.size(); ++m_pos ) + visitChar( m_arg[m_pos] ); + if( m_mode == Name ) + addPattern(); + return *this; + } + TestSpec TestSpecParser::testSpec() { + addFilter(); + return m_testSpec; + } + + void TestSpecParser::visitChar( char c ) { + if( m_mode == None ) { + switch( c ) { + case ' ': return; + case '~': m_exclusion = true; return; + case '[': return startNewMode( Tag, ++m_pos ); + case '"': return startNewMode( QuotedName, ++m_pos ); + case '\\': return escape(); + default: startNewMode( Name, m_pos ); break; + } + } + if( m_mode == Name ) { + if( c == ',' ) { + addPattern(); + addFilter(); + } + else if( c == '[' ) { + if( subString() == "exclude:" ) + m_exclusion = true; + else + addPattern(); + startNewMode( Tag, ++m_pos ); + } + else if( c == '\\' ) + escape(); + } + else if( m_mode == EscapedName ) + m_mode = Name; + else if( m_mode == QuotedName && c == '"' ) + addPattern(); + else if( m_mode == Tag && c == ']' ) + addPattern(); + } + void TestSpecParser::startNewMode( Mode mode, std::size_t start ) { + m_mode = mode; + m_start = start; + } + void TestSpecParser::escape() { + if( m_mode == None ) + m_start = m_pos; + m_mode = EscapedName; + m_escapeChars.push_back( m_pos ); + } + std::string TestSpecParser::subString() const { return m_arg.substr( m_start, m_pos - m_start ); } + + void TestSpecParser::addFilter() { + if( !m_currentFilter.m_patterns.empty() ) { + m_testSpec.m_filters.push_back( m_currentFilter ); + m_currentFilter = TestSpec::Filter(); + } + } + + TestSpec parseTestSpec( std::string const& arg ) { + return TestSpecParser( ITagAliasRegistry::get() ).parse( arg ).testSpec(); + } + +} // namespace Catch +// end catch_test_spec_parser.cpp +// start catch_timer.cpp + +#include + +static const uint64_t nanosecondsInSecond = 1000000000; + +namespace Catch { + + auto getCurrentNanosecondsSinceEpoch() -> uint64_t { + return std::chrono::duration_cast( std::chrono::high_resolution_clock::now().time_since_epoch() ).count(); + } + + namespace { + auto estimateClockResolution() -> uint64_t { + uint64_t sum = 0; + static const uint64_t iterations = 1000000; + + auto startTime = getCurrentNanosecondsSinceEpoch(); + + for( std::size_t i = 0; i < iterations; ++i ) { + + uint64_t ticks; + uint64_t baseTicks = getCurrentNanosecondsSinceEpoch(); + do { + ticks = getCurrentNanosecondsSinceEpoch(); + } while( ticks == baseTicks ); + + auto delta = ticks - baseTicks; + sum += delta; + + // If we have been calibrating for over 3 seconds -- the clock + // is terrible and we should move on. + // TBD: How to signal that the measured resolution is probably wrong? + if (ticks > startTime + 3 * nanosecondsInSecond) { + return sum / ( i + 1u ); + } + } + + // We're just taking the mean, here. To do better we could take the std. dev and exclude outliers + // - and potentially do more iterations if there's a high variance. + return sum/iterations; + } + } + auto getEstimatedClockResolution() -> uint64_t { + static auto s_resolution = estimateClockResolution(); + return s_resolution; + } + + void Timer::start() { + m_nanoseconds = getCurrentNanosecondsSinceEpoch(); + } + auto Timer::getElapsedNanoseconds() const -> uint64_t { + return getCurrentNanosecondsSinceEpoch() - m_nanoseconds; + } + auto Timer::getElapsedMicroseconds() const -> uint64_t { + return getElapsedNanoseconds()/1000; + } + auto Timer::getElapsedMilliseconds() const -> unsigned int { + return static_cast(getElapsedMicroseconds()/1000); + } + auto Timer::getElapsedSeconds() const -> double { + return getElapsedMicroseconds()/1000000.0; + } + +} // namespace Catch +// end catch_timer.cpp +// start catch_tostring.cpp + +#if defined(__clang__) +# pragma clang diagnostic push +# pragma clang diagnostic ignored "-Wexit-time-destructors" +# pragma clang diagnostic ignored "-Wglobal-constructors" +#endif + +// Enable specific decls locally +#if !defined(CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER) +#define CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER +#endif + +#include +#include + +namespace Catch { + +namespace Detail { + + const std::string unprintableString = "{?}"; + + namespace { + const int hexThreshold = 255; + + struct Endianness { + enum Arch { Big, Little }; + + static Arch which() { + union _{ + int asInt; + char asChar[sizeof (int)]; + } u; + + u.asInt = 1; + return ( u.asChar[sizeof(int)-1] == 1 ) ? Big : Little; + } + }; + } + + std::string rawMemoryToString( const void *object, std::size_t size ) { + // Reverse order for little endian architectures + int i = 0, end = static_cast( size ), inc = 1; + if( Endianness::which() == Endianness::Little ) { + i = end-1; + end = inc = -1; + } + + unsigned char const *bytes = static_cast(object); + ReusableStringStream rss; + rss << "0x" << std::setfill('0') << std::hex; + for( ; i != end; i += inc ) + rss << std::setw(2) << static_cast(bytes[i]); + return rss.str(); + } +} + +template +std::string fpToString( T value, int precision ) { + if (Catch::isnan(value)) { + return "nan"; + } + + ReusableStringStream rss; + rss << std::setprecision( precision ) + << std::fixed + << value; + std::string d = rss.str(); + std::size_t i = d.find_last_not_of( '0' ); + if( i != std::string::npos && i != d.size()-1 ) { + if( d[i] == '.' ) + i++; + d = d.substr( 0, i+1 ); + } + return d; +} + +//// ======================================================= //// +// +// Out-of-line defs for full specialization of StringMaker +// +//// ======================================================= //// + +std::string StringMaker::convert(const std::string& str) { + if (!getCurrentContext().getConfig()->showInvisibles()) { + return '"' + str + '"'; + } + + std::string s("\""); + for (char c : str) { + switch (c) { + case '\n': + s.append("\\n"); + break; + case '\t': + s.append("\\t"); + break; + default: + s.push_back(c); + break; + } + } + s.append("\""); + return s; +} + +#ifdef CATCH_CONFIG_CPP17_STRING_VIEW +std::string StringMaker::convert(std::string_view str) { + return ::Catch::Detail::stringify(std::string{ str }); +} +#endif + +std::string StringMaker::convert(char const* str) { + if (str) { + return ::Catch::Detail::stringify(std::string{ str }); + } else { + return{ "{null string}" }; + } +} +std::string StringMaker::convert(char* str) { + if (str) { + return ::Catch::Detail::stringify(std::string{ str }); + } else { + return{ "{null string}" }; + } +} + +#ifdef CATCH_CONFIG_WCHAR +std::string StringMaker::convert(const std::wstring& wstr) { + std::string s; + s.reserve(wstr.size()); + for (auto c : wstr) { + s += (c <= 0xff) ? static_cast(c) : '?'; + } + return ::Catch::Detail::stringify(s); +} + +# ifdef CATCH_CONFIG_CPP17_STRING_VIEW +std::string StringMaker::convert(std::wstring_view str) { + return StringMaker::convert(std::wstring(str)); +} +# endif + +std::string StringMaker::convert(wchar_t const * str) { + if (str) { + return ::Catch::Detail::stringify(std::wstring{ str }); + } else { + return{ "{null string}" }; + } +} +std::string StringMaker::convert(wchar_t * str) { + if (str) { + return ::Catch::Detail::stringify(std::wstring{ str }); + } else { + return{ "{null string}" }; + } +} +#endif + +std::string StringMaker::convert(int value) { + return ::Catch::Detail::stringify(static_cast(value)); +} +std::string StringMaker::convert(long value) { + return ::Catch::Detail::stringify(static_cast(value)); +} +std::string StringMaker::convert(long long value) { + ReusableStringStream rss; + rss << value; + if (value > Detail::hexThreshold) { + rss << " (0x" << std::hex << value << ')'; + } + return rss.str(); +} + +std::string StringMaker::convert(unsigned int value) { + return ::Catch::Detail::stringify(static_cast(value)); +} +std::string StringMaker::convert(unsigned long value) { + return ::Catch::Detail::stringify(static_cast(value)); +} +std::string StringMaker::convert(unsigned long long value) { + ReusableStringStream rss; + rss << value; + if (value > Detail::hexThreshold) { + rss << " (0x" << std::hex << value << ')'; + } + return rss.str(); +} + +std::string StringMaker::convert(bool b) { + return b ? "true" : "false"; +} + +std::string StringMaker::convert(signed char value) { + if (value == '\r') { + return "'\\r'"; + } else if (value == '\f') { + return "'\\f'"; + } else if (value == '\n') { + return "'\\n'"; + } else if (value == '\t') { + return "'\\t'"; + } else if ('\0' <= value && value < ' ') { + return ::Catch::Detail::stringify(static_cast(value)); + } else { + char chstr[] = "' '"; + chstr[1] = value; + return chstr; + } +} +std::string StringMaker::convert(char c) { + return ::Catch::Detail::stringify(static_cast(c)); +} +std::string StringMaker::convert(unsigned char c) { + return ::Catch::Detail::stringify(static_cast(c)); +} + +std::string StringMaker::convert(std::nullptr_t) { + return "nullptr"; +} + +std::string StringMaker::convert(float value) { + return fpToString(value, 5) + 'f'; +} +std::string StringMaker::convert(double value) { + return fpToString(value, 10); +} + +std::string ratio_string::symbol() { return "a"; } +std::string ratio_string::symbol() { return "f"; } +std::string ratio_string::symbol() { return "p"; } +std::string ratio_string::symbol() { return "n"; } +std::string ratio_string::symbol() { return "u"; } +std::string ratio_string::symbol() { return "m"; } + +} // end namespace Catch + +#if defined(__clang__) +# pragma clang diagnostic pop +#endif + +// end catch_tostring.cpp +// start catch_totals.cpp + +namespace Catch { + + Counts Counts::operator - ( Counts const& other ) const { + Counts diff; + diff.passed = passed - other.passed; + diff.failed = failed - other.failed; + diff.failedButOk = failedButOk - other.failedButOk; + return diff; + } + + Counts& Counts::operator += ( Counts const& other ) { + passed += other.passed; + failed += other.failed; + failedButOk += other.failedButOk; + return *this; + } + + std::size_t Counts::total() const { + return passed + failed + failedButOk; + } + bool Counts::allPassed() const { + return failed == 0 && failedButOk == 0; + } + bool Counts::allOk() const { + return failed == 0; + } + + Totals Totals::operator - ( Totals const& other ) const { + Totals diff; + diff.assertions = assertions - other.assertions; + diff.testCases = testCases - other.testCases; + return diff; + } + + Totals& Totals::operator += ( Totals const& other ) { + assertions += other.assertions; + testCases += other.testCases; + return *this; + } + + Totals Totals::delta( Totals const& prevTotals ) const { + Totals diff = *this - prevTotals; + if( diff.assertions.failed > 0 ) + ++diff.testCases.failed; + else if( diff.assertions.failedButOk > 0 ) + ++diff.testCases.failedButOk; + else + ++diff.testCases.passed; + return diff; + } + +} +// end catch_totals.cpp +// start catch_uncaught_exceptions.cpp + +#include + +namespace Catch { + bool uncaught_exceptions() { +#if defined(CATCH_CONFIG_CPP17_UNCAUGHT_EXCEPTIONS) + return std::uncaught_exceptions() > 0; +#else + return std::uncaught_exception(); +#endif + } +} // end namespace Catch +// end catch_uncaught_exceptions.cpp +// start catch_version.cpp + +#include + +namespace Catch { + + Version::Version + ( unsigned int _majorVersion, + unsigned int _minorVersion, + unsigned int _patchNumber, + char const * const _branchName, + unsigned int _buildNumber ) + : majorVersion( _majorVersion ), + minorVersion( _minorVersion ), + patchNumber( _patchNumber ), + branchName( _branchName ), + buildNumber( _buildNumber ) + {} + + std::ostream& operator << ( std::ostream& os, Version const& version ) { + os << version.majorVersion << '.' + << version.minorVersion << '.' + << version.patchNumber; + // branchName is never null -> 0th char is \0 if it is empty + if (version.branchName[0]) { + os << '-' << version.branchName + << '.' << version.buildNumber; + } + return os; + } + + Version const& libraryVersion() { + static Version version( 2, 7, 0, "", 0 ); + return version; + } + +} +// end catch_version.cpp +// start catch_wildcard_pattern.cpp + +#include + +namespace Catch { + + WildcardPattern::WildcardPattern( std::string const& pattern, + CaseSensitive::Choice caseSensitivity ) + : m_caseSensitivity( caseSensitivity ), + m_pattern( adjustCase( pattern ) ) + { + if( startsWith( m_pattern, '*' ) ) { + m_pattern = m_pattern.substr( 1 ); + m_wildcard = WildcardAtStart; + } + if( endsWith( m_pattern, '*' ) ) { + m_pattern = m_pattern.substr( 0, m_pattern.size()-1 ); + m_wildcard = static_cast( m_wildcard | WildcardAtEnd ); + } + } + + bool WildcardPattern::matches( std::string const& str ) const { + switch( m_wildcard ) { + case NoWildcard: + return m_pattern == adjustCase( str ); + case WildcardAtStart: + return endsWith( adjustCase( str ), m_pattern ); + case WildcardAtEnd: + return startsWith( adjustCase( str ), m_pattern ); + case WildcardAtBothEnds: + return contains( adjustCase( str ), m_pattern ); + default: + CATCH_INTERNAL_ERROR( "Unknown enum" ); + } + } + + std::string WildcardPattern::adjustCase( std::string const& str ) const { + return m_caseSensitivity == CaseSensitive::No ? toLower( str ) : str; + } +} +// end catch_wildcard_pattern.cpp +// start catch_xmlwriter.cpp + +#include + +using uchar = unsigned char; + +namespace Catch { + +namespace { + + size_t trailingBytes(unsigned char c) { + if ((c & 0xE0) == 0xC0) { + return 2; + } + if ((c & 0xF0) == 0xE0) { + return 3; + } + if ((c & 0xF8) == 0xF0) { + return 4; + } + CATCH_INTERNAL_ERROR("Invalid multibyte utf-8 start byte encountered"); + } + + uint32_t headerValue(unsigned char c) { + if ((c & 0xE0) == 0xC0) { + return c & 0x1F; + } + if ((c & 0xF0) == 0xE0) { + return c & 0x0F; + } + if ((c & 0xF8) == 0xF0) { + return c & 0x07; + } + CATCH_INTERNAL_ERROR("Invalid multibyte utf-8 start byte encountered"); + } + + void hexEscapeChar(std::ostream& os, unsigned char c) { + std::ios_base::fmtflags f(os.flags()); + os << "\\x" + << std::uppercase << std::hex << std::setfill('0') << std::setw(2) + << static_cast(c); + os.flags(f); + } + +} // anonymous namespace + + XmlEncode::XmlEncode( std::string const& str, ForWhat forWhat ) + : m_str( str ), + m_forWhat( forWhat ) + {} + + void XmlEncode::encodeTo( std::ostream& os ) const { + // Apostrophe escaping not necessary if we always use " to write attributes + // (see: http://www.w3.org/TR/xml/#syntax) + + for( std::size_t idx = 0; idx < m_str.size(); ++ idx ) { + uchar c = m_str[idx]; + switch (c) { + case '<': os << "<"; break; + case '&': os << "&"; break; + + case '>': + // See: http://www.w3.org/TR/xml/#syntax + if (idx > 2 && m_str[idx - 1] == ']' && m_str[idx - 2] == ']') + os << ">"; + else + os << c; + break; + + case '\"': + if (m_forWhat == ForAttributes) + os << """; + else + os << c; + break; + + default: + // Check for control characters and invalid utf-8 + + // Escape control characters in standard ascii + // see http://stackoverflow.com/questions/404107/why-are-control-characters-illegal-in-xml-1-0 + if (c < 0x09 || (c > 0x0D && c < 0x20) || c == 0x7F) { + hexEscapeChar(os, c); + break; + } + + // Plain ASCII: Write it to stream + if (c < 0x7F) { + os << c; + break; + } + + // UTF-8 territory + // Check if the encoding is valid and if it is not, hex escape bytes. + // Important: We do not check the exact decoded values for validity, only the encoding format + // First check that this bytes is a valid lead byte: + // This means that it is not encoded as 1111 1XXX + // Or as 10XX XXXX + if (c < 0xC0 || + c >= 0xF8) { + hexEscapeChar(os, c); + break; + } + + auto encBytes = trailingBytes(c); + // Are there enough bytes left to avoid accessing out-of-bounds memory? + if (idx + encBytes - 1 >= m_str.size()) { + hexEscapeChar(os, c); + break; + } + // The header is valid, check data + // The next encBytes bytes must together be a valid utf-8 + // This means: bitpattern 10XX XXXX and the extracted value is sane (ish) + bool valid = true; + uint32_t value = headerValue(c); + for (std::size_t n = 1; n < encBytes; ++n) { + uchar nc = m_str[idx + n]; + valid &= ((nc & 0xC0) == 0x80); + value = (value << 6) | (nc & 0x3F); + } + + if ( + // Wrong bit pattern of following bytes + (!valid) || + // Overlong encodings + (value < 0x80) || + (0x80 <= value && value < 0x800 && encBytes > 2) || + (0x800 < value && value < 0x10000 && encBytes > 3) || + // Encoded value out of range + (value >= 0x110000) + ) { + hexEscapeChar(os, c); + break; + } + + // If we got here, this is in fact a valid(ish) utf-8 sequence + for (std::size_t n = 0; n < encBytes; ++n) { + os << m_str[idx + n]; + } + idx += encBytes - 1; + break; + } + } + } + + std::ostream& operator << ( std::ostream& os, XmlEncode const& xmlEncode ) { + xmlEncode.encodeTo( os ); + return os; + } + + XmlWriter::ScopedElement::ScopedElement( XmlWriter* writer ) + : m_writer( writer ) + {} + + XmlWriter::ScopedElement::ScopedElement( ScopedElement&& other ) noexcept + : m_writer( other.m_writer ){ + other.m_writer = nullptr; + } + XmlWriter::ScopedElement& XmlWriter::ScopedElement::operator=( ScopedElement&& other ) noexcept { + if ( m_writer ) { + m_writer->endElement(); + } + m_writer = other.m_writer; + other.m_writer = nullptr; + return *this; + } + + XmlWriter::ScopedElement::~ScopedElement() { + if( m_writer ) + m_writer->endElement(); + } + + XmlWriter::ScopedElement& XmlWriter::ScopedElement::writeText( std::string const& text, bool indent ) { + m_writer->writeText( text, indent ); + return *this; + } + + XmlWriter::XmlWriter( std::ostream& os ) : m_os( os ) + { + writeDeclaration(); + } + + XmlWriter::~XmlWriter() { + while( !m_tags.empty() ) + endElement(); + } + + XmlWriter& XmlWriter::startElement( std::string const& name ) { + ensureTagClosed(); + newlineIfNecessary(); + m_os << m_indent << '<' << name; + m_tags.push_back( name ); + m_indent += " "; + m_tagIsOpen = true; + return *this; + } + + XmlWriter::ScopedElement XmlWriter::scopedElement( std::string const& name ) { + ScopedElement scoped( this ); + startElement( name ); + return scoped; + } + + XmlWriter& XmlWriter::endElement() { + newlineIfNecessary(); + m_indent = m_indent.substr( 0, m_indent.size()-2 ); + if( m_tagIsOpen ) { + m_os << "/>"; + m_tagIsOpen = false; + } + else { + m_os << m_indent << ""; + } + m_os << std::endl; + m_tags.pop_back(); + return *this; + } + + XmlWriter& XmlWriter::writeAttribute( std::string const& name, std::string const& attribute ) { + if( !name.empty() && !attribute.empty() ) + m_os << ' ' << name << "=\"" << XmlEncode( attribute, XmlEncode::ForAttributes ) << '"'; + return *this; + } + + XmlWriter& XmlWriter::writeAttribute( std::string const& name, bool attribute ) { + m_os << ' ' << name << "=\"" << ( attribute ? "true" : "false" ) << '"'; + return *this; + } + + XmlWriter& XmlWriter::writeText( std::string const& text, bool indent ) { + if( !text.empty() ){ + bool tagWasOpen = m_tagIsOpen; + ensureTagClosed(); + if( tagWasOpen && indent ) + m_os << m_indent; + m_os << XmlEncode( text ); + m_needsNewline = true; + } + return *this; + } + + XmlWriter& XmlWriter::writeComment( std::string const& text ) { + ensureTagClosed(); + m_os << m_indent << ""; + m_needsNewline = true; + return *this; + } + + void XmlWriter::writeStylesheetRef( std::string const& url ) { + m_os << "\n"; + } + + XmlWriter& XmlWriter::writeBlankLine() { + ensureTagClosed(); + m_os << '\n'; + return *this; + } + + void XmlWriter::ensureTagClosed() { + if( m_tagIsOpen ) { + m_os << ">" << std::endl; + m_tagIsOpen = false; + } + } + + void XmlWriter::writeDeclaration() { + m_os << "\n"; + } + + void XmlWriter::newlineIfNecessary() { + if( m_needsNewline ) { + m_os << std::endl; + m_needsNewline = false; + } + } +} +// end catch_xmlwriter.cpp +// start catch_reporter_bases.cpp + +#include +#include +#include +#include +#include + +namespace Catch { + void prepareExpandedExpression(AssertionResult& result) { + result.getExpandedExpression(); + } + + // Because formatting using c++ streams is stateful, drop down to C is required + // Alternatively we could use stringstream, but its performance is... not good. + std::string getFormattedDuration( double duration ) { + // Max exponent + 1 is required to represent the whole part + // + 1 for decimal point + // + 3 for the 3 decimal places + // + 1 for null terminator + const std::size_t maxDoubleSize = DBL_MAX_10_EXP + 1 + 1 + 3 + 1; + char buffer[maxDoubleSize]; + + // Save previous errno, to prevent sprintf from overwriting it + ErrnoGuard guard; +#ifdef _MSC_VER + sprintf_s(buffer, "%.3f", duration); +#else + std::sprintf(buffer, "%.3f", duration); +#endif + return std::string(buffer); + } + + TestEventListenerBase::TestEventListenerBase(ReporterConfig const & _config) + :StreamingReporterBase(_config) {} + + std::set TestEventListenerBase::getSupportedVerbosities() { + return { Verbosity::Quiet, Verbosity::Normal, Verbosity::High }; + } + + void TestEventListenerBase::assertionStarting(AssertionInfo const &) {} + + bool TestEventListenerBase::assertionEnded(AssertionStats const &) { + return false; + } + +} // end namespace Catch +// end catch_reporter_bases.cpp +// start catch_reporter_compact.cpp + +namespace { + +#ifdef CATCH_PLATFORM_MAC + const char* failedString() { return "FAILED"; } + const char* passedString() { return "PASSED"; } +#else + const char* failedString() { return "failed"; } + const char* passedString() { return "passed"; } +#endif + + // Colour::LightGrey + Catch::Colour::Code dimColour() { return Catch::Colour::FileName; } + + std::string bothOrAll( std::size_t count ) { + return count == 1 ? std::string() : + count == 2 ? "both " : "all " ; + } + +} // anon namespace + +namespace Catch { +namespace { +// Colour, message variants: +// - white: No tests ran. +// - red: Failed [both/all] N test cases, failed [both/all] M assertions. +// - white: Passed [both/all] N test cases (no assertions). +// - red: Failed N tests cases, failed M assertions. +// - green: Passed [both/all] N tests cases with M assertions. +void printTotals(std::ostream& out, const Totals& totals) { + if (totals.testCases.total() == 0) { + out << "No tests ran."; + } else if (totals.testCases.failed == totals.testCases.total()) { + Colour colour(Colour::ResultError); + const std::string qualify_assertions_failed = + totals.assertions.failed == totals.assertions.total() ? + bothOrAll(totals.assertions.failed) : std::string(); + out << + "Failed " << bothOrAll(totals.testCases.failed) + << pluralise(totals.testCases.failed, "test case") << ", " + "failed " << qualify_assertions_failed << + pluralise(totals.assertions.failed, "assertion") << '.'; + } else if (totals.assertions.total() == 0) { + out << + "Passed " << bothOrAll(totals.testCases.total()) + << pluralise(totals.testCases.total(), "test case") + << " (no assertions)."; + } else if (totals.assertions.failed) { + Colour colour(Colour::ResultError); + out << + "Failed " << pluralise(totals.testCases.failed, "test case") << ", " + "failed " << pluralise(totals.assertions.failed, "assertion") << '.'; + } else { + Colour colour(Colour::ResultSuccess); + out << + "Passed " << bothOrAll(totals.testCases.passed) + << pluralise(totals.testCases.passed, "test case") << + " with " << pluralise(totals.assertions.passed, "assertion") << '.'; + } +} + +// Implementation of CompactReporter formatting +class AssertionPrinter { +public: + AssertionPrinter& operator= (AssertionPrinter const&) = delete; + AssertionPrinter(AssertionPrinter const&) = delete; + AssertionPrinter(std::ostream& _stream, AssertionStats const& _stats, bool _printInfoMessages) + : stream(_stream) + , result(_stats.assertionResult) + , messages(_stats.infoMessages) + , itMessage(_stats.infoMessages.begin()) + , printInfoMessages(_printInfoMessages) {} + + void print() { + printSourceInfo(); + + itMessage = messages.begin(); + + switch (result.getResultType()) { + case ResultWas::Ok: + printResultType(Colour::ResultSuccess, passedString()); + printOriginalExpression(); + printReconstructedExpression(); + if (!result.hasExpression()) + printRemainingMessages(Colour::None); + else + printRemainingMessages(); + break; + case ResultWas::ExpressionFailed: + if (result.isOk()) + printResultType(Colour::ResultSuccess, failedString() + std::string(" - but was ok")); + else + printResultType(Colour::Error, failedString()); + printOriginalExpression(); + printReconstructedExpression(); + printRemainingMessages(); + break; + case ResultWas::ThrewException: + printResultType(Colour::Error, failedString()); + printIssue("unexpected exception with message:"); + printMessage(); + printExpressionWas(); + printRemainingMessages(); + break; + case ResultWas::FatalErrorCondition: + printResultType(Colour::Error, failedString()); + printIssue("fatal error condition with message:"); + printMessage(); + printExpressionWas(); + printRemainingMessages(); + break; + case ResultWas::DidntThrowException: + printResultType(Colour::Error, failedString()); + printIssue("expected exception, got none"); + printExpressionWas(); + printRemainingMessages(); + break; + case ResultWas::Info: + printResultType(Colour::None, "info"); + printMessage(); + printRemainingMessages(); + break; + case ResultWas::Warning: + printResultType(Colour::None, "warning"); + printMessage(); + printRemainingMessages(); + break; + case ResultWas::ExplicitFailure: + printResultType(Colour::Error, failedString()); + printIssue("explicitly"); + printRemainingMessages(Colour::None); + break; + // These cases are here to prevent compiler warnings + case ResultWas::Unknown: + case ResultWas::FailureBit: + case ResultWas::Exception: + printResultType(Colour::Error, "** internal error **"); + break; + } + } + +private: + void printSourceInfo() const { + Colour colourGuard(Colour::FileName); + stream << result.getSourceInfo() << ':'; + } + + void printResultType(Colour::Code colour, std::string const& passOrFail) const { + if (!passOrFail.empty()) { + { + Colour colourGuard(colour); + stream << ' ' << passOrFail; + } + stream << ':'; + } + } + + void printIssue(std::string const& issue) const { + stream << ' ' << issue; + } + + void printExpressionWas() { + if (result.hasExpression()) { + stream << ';'; + { + Colour colour(dimColour()); + stream << " expression was:"; + } + printOriginalExpression(); + } + } + + void printOriginalExpression() const { + if (result.hasExpression()) { + stream << ' ' << result.getExpression(); + } + } + + void printReconstructedExpression() const { + if (result.hasExpandedExpression()) { + { + Colour colour(dimColour()); + stream << " for: "; + } + stream << result.getExpandedExpression(); + } + } + + void printMessage() { + if (itMessage != messages.end()) { + stream << " '" << itMessage->message << '\''; + ++itMessage; + } + } + + void printRemainingMessages(Colour::Code colour = dimColour()) { + if (itMessage == messages.end()) + return; + + // using messages.end() directly yields (or auto) compilation error: + std::vector::const_iterator itEnd = messages.end(); + const std::size_t N = static_cast(std::distance(itMessage, itEnd)); + + { + Colour colourGuard(colour); + stream << " with " << pluralise(N, "message") << ':'; + } + + for (; itMessage != itEnd; ) { + // If this assertion is a warning ignore any INFO messages + if (printInfoMessages || itMessage->type != ResultWas::Info) { + stream << " '" << itMessage->message << '\''; + if (++itMessage != itEnd) { + Colour colourGuard(dimColour()); + stream << " and"; + } + } + } + } + +private: + std::ostream& stream; + AssertionResult const& result; + std::vector messages; + std::vector::const_iterator itMessage; + bool printInfoMessages; +}; + +} // anon namespace + + std::string CompactReporter::getDescription() { + return "Reports test results on a single line, suitable for IDEs"; + } + + ReporterPreferences CompactReporter::getPreferences() const { + return m_reporterPrefs; + } + + void CompactReporter::noMatchingTestCases( std::string const& spec ) { + stream << "No test cases matched '" << spec << '\'' << std::endl; + } + + void CompactReporter::assertionStarting( AssertionInfo const& ) {} + + bool CompactReporter::assertionEnded( AssertionStats const& _assertionStats ) { + AssertionResult const& result = _assertionStats.assertionResult; + + bool printInfoMessages = true; + + // Drop out if result was successful and we're not printing those + if( !m_config->includeSuccessfulResults() && result.isOk() ) { + if( result.getResultType() != ResultWas::Warning ) + return false; + printInfoMessages = false; + } + + AssertionPrinter printer( stream, _assertionStats, printInfoMessages ); + printer.print(); + + stream << std::endl; + return true; + } + + void CompactReporter::sectionEnded(SectionStats const& _sectionStats) { + if (m_config->showDurations() == ShowDurations::Always) { + stream << getFormattedDuration(_sectionStats.durationInSeconds) << " s: " << _sectionStats.sectionInfo.name << std::endl; + } + } + + void CompactReporter::testRunEnded( TestRunStats const& _testRunStats ) { + printTotals( stream, _testRunStats.totals ); + stream << '\n' << std::endl; + StreamingReporterBase::testRunEnded( _testRunStats ); + } + + CompactReporter::~CompactReporter() {} + + CATCH_REGISTER_REPORTER( "compact", CompactReporter ) + +} // end namespace Catch +// end catch_reporter_compact.cpp +// start catch_reporter_console.cpp + +#include +#include + +#if defined(_MSC_VER) +#pragma warning(push) +#pragma warning(disable:4061) // Not all labels are EXPLICITLY handled in switch + // Note that 4062 (not all labels are handled + // and default is missing) is enabled +#endif + +namespace Catch { + +namespace { + +// Formatter impl for ConsoleReporter +class ConsoleAssertionPrinter { +public: + ConsoleAssertionPrinter& operator= (ConsoleAssertionPrinter const&) = delete; + ConsoleAssertionPrinter(ConsoleAssertionPrinter const&) = delete; + ConsoleAssertionPrinter(std::ostream& _stream, AssertionStats const& _stats, bool _printInfoMessages) + : stream(_stream), + stats(_stats), + result(_stats.assertionResult), + colour(Colour::None), + message(result.getMessage()), + messages(_stats.infoMessages), + printInfoMessages(_printInfoMessages) { + switch (result.getResultType()) { + case ResultWas::Ok: + colour = Colour::Success; + passOrFail = "PASSED"; + //if( result.hasMessage() ) + if (_stats.infoMessages.size() == 1) + messageLabel = "with message"; + if (_stats.infoMessages.size() > 1) + messageLabel = "with messages"; + break; + case ResultWas::ExpressionFailed: + if (result.isOk()) { + colour = Colour::Success; + passOrFail = "FAILED - but was ok"; + } else { + colour = Colour::Error; + passOrFail = "FAILED"; + } + if (_stats.infoMessages.size() == 1) + messageLabel = "with message"; + if (_stats.infoMessages.size() > 1) + messageLabel = "with messages"; + break; + case ResultWas::ThrewException: + colour = Colour::Error; + passOrFail = "FAILED"; + messageLabel = "due to unexpected exception with "; + if (_stats.infoMessages.size() == 1) + messageLabel += "message"; + if (_stats.infoMessages.size() > 1) + messageLabel += "messages"; + break; + case ResultWas::FatalErrorCondition: + colour = Colour::Error; + passOrFail = "FAILED"; + messageLabel = "due to a fatal error condition"; + break; + case ResultWas::DidntThrowException: + colour = Colour::Error; + passOrFail = "FAILED"; + messageLabel = "because no exception was thrown where one was expected"; + break; + case ResultWas::Info: + messageLabel = "info"; + break; + case ResultWas::Warning: + messageLabel = "warning"; + break; + case ResultWas::ExplicitFailure: + passOrFail = "FAILED"; + colour = Colour::Error; + if (_stats.infoMessages.size() == 1) + messageLabel = "explicitly with message"; + if (_stats.infoMessages.size() > 1) + messageLabel = "explicitly with messages"; + break; + // These cases are here to prevent compiler warnings + case ResultWas::Unknown: + case ResultWas::FailureBit: + case ResultWas::Exception: + passOrFail = "** internal error **"; + colour = Colour::Error; + break; + } + } + + void print() const { + printSourceInfo(); + if (stats.totals.assertions.total() > 0) { + printResultType(); + printOriginalExpression(); + printReconstructedExpression(); + } else { + stream << '\n'; + } + printMessage(); + } + +private: + void printResultType() const { + if (!passOrFail.empty()) { + Colour colourGuard(colour); + stream << passOrFail << ":\n"; + } + } + void printOriginalExpression() const { + if (result.hasExpression()) { + Colour colourGuard(Colour::OriginalExpression); + stream << " "; + stream << result.getExpressionInMacro(); + stream << '\n'; + } + } + void printReconstructedExpression() const { + if (result.hasExpandedExpression()) { + stream << "with expansion:\n"; + Colour colourGuard(Colour::ReconstructedExpression); + stream << Column(result.getExpandedExpression()).indent(2) << '\n'; + } + } + void printMessage() const { + if (!messageLabel.empty()) + stream << messageLabel << ':' << '\n'; + for (auto const& msg : messages) { + // If this assertion is a warning ignore any INFO messages + if (printInfoMessages || msg.type != ResultWas::Info) + stream << Column(msg.message).indent(2) << '\n'; + } + } + void printSourceInfo() const { + Colour colourGuard(Colour::FileName); + stream << result.getSourceInfo() << ": "; + } + + std::ostream& stream; + AssertionStats const& stats; + AssertionResult const& result; + Colour::Code colour; + std::string passOrFail; + std::string messageLabel; + std::string message; + std::vector messages; + bool printInfoMessages; +}; + +std::size_t makeRatio(std::size_t number, std::size_t total) { + std::size_t ratio = total > 0 ? CATCH_CONFIG_CONSOLE_WIDTH * number / total : 0; + return (ratio == 0 && number > 0) ? 1 : ratio; +} + +std::size_t& findMax(std::size_t& i, std::size_t& j, std::size_t& k) { + if (i > j && i > k) + return i; + else if (j > k) + return j; + else + return k; +} + +struct ColumnInfo { + enum Justification { Left, Right }; + std::string name; + int width; + Justification justification; +}; +struct ColumnBreak {}; +struct RowBreak {}; + +class Duration { + enum class Unit { + Auto, + Nanoseconds, + Microseconds, + Milliseconds, + Seconds, + Minutes + }; + static const uint64_t s_nanosecondsInAMicrosecond = 1000; + static const uint64_t s_nanosecondsInAMillisecond = 1000 * s_nanosecondsInAMicrosecond; + static const uint64_t s_nanosecondsInASecond = 1000 * s_nanosecondsInAMillisecond; + static const uint64_t s_nanosecondsInAMinute = 60 * s_nanosecondsInASecond; + + uint64_t m_inNanoseconds; + Unit m_units; + +public: + explicit Duration(uint64_t inNanoseconds, Unit units = Unit::Auto) + : m_inNanoseconds(inNanoseconds), + m_units(units) { + if (m_units == Unit::Auto) { + if (m_inNanoseconds < s_nanosecondsInAMicrosecond) + m_units = Unit::Nanoseconds; + else if (m_inNanoseconds < s_nanosecondsInAMillisecond) + m_units = Unit::Microseconds; + else if (m_inNanoseconds < s_nanosecondsInASecond) + m_units = Unit::Milliseconds; + else if (m_inNanoseconds < s_nanosecondsInAMinute) + m_units = Unit::Seconds; + else + m_units = Unit::Minutes; + } + + } + + auto value() const -> double { + switch (m_units) { + case Unit::Microseconds: + return m_inNanoseconds / static_cast(s_nanosecondsInAMicrosecond); + case Unit::Milliseconds: + return m_inNanoseconds / static_cast(s_nanosecondsInAMillisecond); + case Unit::Seconds: + return m_inNanoseconds / static_cast(s_nanosecondsInASecond); + case Unit::Minutes: + return m_inNanoseconds / static_cast(s_nanosecondsInAMinute); + default: + return static_cast(m_inNanoseconds); + } + } + auto unitsAsString() const -> std::string { + switch (m_units) { + case Unit::Nanoseconds: + return "ns"; + case Unit::Microseconds: + return "us"; + case Unit::Milliseconds: + return "ms"; + case Unit::Seconds: + return "s"; + case Unit::Minutes: + return "m"; + default: + return "** internal error **"; + } + + } + friend auto operator << (std::ostream& os, Duration const& duration) -> std::ostream& { + return os << duration.value() << " " << duration.unitsAsString(); + } +}; +} // end anon namespace + +class TablePrinter { + std::ostream& m_os; + std::vector m_columnInfos; + std::ostringstream m_oss; + int m_currentColumn = -1; + bool m_isOpen = false; + +public: + TablePrinter( std::ostream& os, std::vector columnInfos ) + : m_os( os ), + m_columnInfos( std::move( columnInfos ) ) {} + + auto columnInfos() const -> std::vector const& { + return m_columnInfos; + } + + void open() { + if (!m_isOpen) { + m_isOpen = true; + *this << RowBreak(); + for (auto const& info : m_columnInfos) + *this << info.name << ColumnBreak(); + *this << RowBreak(); + m_os << Catch::getLineOfChars<'-'>() << "\n"; + } + } + void close() { + if (m_isOpen) { + *this << RowBreak(); + m_os << std::endl; + m_isOpen = false; + } + } + + template + friend TablePrinter& operator << (TablePrinter& tp, T const& value) { + tp.m_oss << value; + return tp; + } + + friend TablePrinter& operator << (TablePrinter& tp, ColumnBreak) { + auto colStr = tp.m_oss.str(); + // This takes account of utf8 encodings + auto strSize = Catch::StringRef(colStr).numberOfCharacters(); + tp.m_oss.str(""); + tp.open(); + if (tp.m_currentColumn == static_cast(tp.m_columnInfos.size() - 1)) { + tp.m_currentColumn = -1; + tp.m_os << "\n"; + } + tp.m_currentColumn++; + + auto colInfo = tp.m_columnInfos[tp.m_currentColumn]; + auto padding = (strSize + 2 < static_cast(colInfo.width)) + ? std::string(colInfo.width - (strSize + 2), ' ') + : std::string(); + if (colInfo.justification == ColumnInfo::Left) + tp.m_os << colStr << padding << " "; + else + tp.m_os << padding << colStr << " "; + return tp; + } + + friend TablePrinter& operator << (TablePrinter& tp, RowBreak) { + if (tp.m_currentColumn > 0) { + tp.m_os << "\n"; + tp.m_currentColumn = -1; + } + return tp; + } +}; + +ConsoleReporter::ConsoleReporter(ReporterConfig const& config) + : StreamingReporterBase(config), + m_tablePrinter(new TablePrinter(config.stream(), + { + { "benchmark name", CATCH_CONFIG_CONSOLE_WIDTH - 32, ColumnInfo::Left }, + { "iters", 8, ColumnInfo::Right }, + { "elapsed ns", 14, ColumnInfo::Right }, + { "average", 14, ColumnInfo::Right } + })) {} +ConsoleReporter::~ConsoleReporter() = default; + +std::string ConsoleReporter::getDescription() { + return "Reports test results as plain lines of text"; +} + +void ConsoleReporter::noMatchingTestCases(std::string const& spec) { + stream << "No test cases matched '" << spec << '\'' << std::endl; +} + +void ConsoleReporter::assertionStarting(AssertionInfo const&) {} + +bool ConsoleReporter::assertionEnded(AssertionStats const& _assertionStats) { + AssertionResult const& result = _assertionStats.assertionResult; + + bool includeResults = m_config->includeSuccessfulResults() || !result.isOk(); + + // Drop out if result was successful but we're not printing them. + if (!includeResults && result.getResultType() != ResultWas::Warning) + return false; + + lazyPrint(); + + ConsoleAssertionPrinter printer(stream, _assertionStats, includeResults); + printer.print(); + stream << std::endl; + return true; +} + +void ConsoleReporter::sectionStarting(SectionInfo const& _sectionInfo) { + m_headerPrinted = false; + StreamingReporterBase::sectionStarting(_sectionInfo); +} +void ConsoleReporter::sectionEnded(SectionStats const& _sectionStats) { + m_tablePrinter->close(); + if (_sectionStats.missingAssertions) { + lazyPrint(); + Colour colour(Colour::ResultError); + if (m_sectionStack.size() > 1) + stream << "\nNo assertions in section"; + else + stream << "\nNo assertions in test case"; + stream << " '" << _sectionStats.sectionInfo.name << "'\n" << std::endl; + } + if (m_config->showDurations() == ShowDurations::Always) { + stream << getFormattedDuration(_sectionStats.durationInSeconds) << " s: " << _sectionStats.sectionInfo.name << std::endl; + } + if (m_headerPrinted) { + m_headerPrinted = false; + } + StreamingReporterBase::sectionEnded(_sectionStats); +} + +void ConsoleReporter::benchmarkStarting(BenchmarkInfo const& info) { + lazyPrintWithoutClosingBenchmarkTable(); + + auto nameCol = Column( info.name ).width( static_cast( m_tablePrinter->columnInfos()[0].width - 2 ) ); + + bool firstLine = true; + for (auto line : nameCol) { + if (!firstLine) + (*m_tablePrinter) << ColumnBreak() << ColumnBreak() << ColumnBreak(); + else + firstLine = false; + + (*m_tablePrinter) << line << ColumnBreak(); + } +} +void ConsoleReporter::benchmarkEnded(BenchmarkStats const& stats) { + Duration average(stats.elapsedTimeInNanoseconds / stats.iterations); + (*m_tablePrinter) + << stats.iterations << ColumnBreak() + << stats.elapsedTimeInNanoseconds << ColumnBreak() + << average << ColumnBreak(); +} + +void ConsoleReporter::testCaseEnded(TestCaseStats const& _testCaseStats) { + m_tablePrinter->close(); + StreamingReporterBase::testCaseEnded(_testCaseStats); + m_headerPrinted = false; +} +void ConsoleReporter::testGroupEnded(TestGroupStats const& _testGroupStats) { + if (currentGroupInfo.used) { + printSummaryDivider(); + stream << "Summary for group '" << _testGroupStats.groupInfo.name << "':\n"; + printTotals(_testGroupStats.totals); + stream << '\n' << std::endl; + } + StreamingReporterBase::testGroupEnded(_testGroupStats); +} +void ConsoleReporter::testRunEnded(TestRunStats const& _testRunStats) { + printTotalsDivider(_testRunStats.totals); + printTotals(_testRunStats.totals); + stream << std::endl; + StreamingReporterBase::testRunEnded(_testRunStats); +} + +void ConsoleReporter::lazyPrint() { + + m_tablePrinter->close(); + lazyPrintWithoutClosingBenchmarkTable(); +} + +void ConsoleReporter::lazyPrintWithoutClosingBenchmarkTable() { + + if (!currentTestRunInfo.used) + lazyPrintRunInfo(); + if (!currentGroupInfo.used) + lazyPrintGroupInfo(); + + if (!m_headerPrinted) { + printTestCaseAndSectionHeader(); + m_headerPrinted = true; + } +} +void ConsoleReporter::lazyPrintRunInfo() { + stream << '\n' << getLineOfChars<'~'>() << '\n'; + Colour colour(Colour::SecondaryText); + stream << currentTestRunInfo->name + << " is a Catch v" << libraryVersion() << " host application.\n" + << "Run with -? for options\n\n"; + + if (m_config->rngSeed() != 0) + stream << "Randomness seeded to: " << m_config->rngSeed() << "\n\n"; + + currentTestRunInfo.used = true; +} +void ConsoleReporter::lazyPrintGroupInfo() { + if (!currentGroupInfo->name.empty() && currentGroupInfo->groupsCounts > 1) { + printClosedHeader("Group: " + currentGroupInfo->name); + currentGroupInfo.used = true; + } +} +void ConsoleReporter::printTestCaseAndSectionHeader() { + assert(!m_sectionStack.empty()); + printOpenHeader(currentTestCaseInfo->name); + + if (m_sectionStack.size() > 1) { + Colour colourGuard(Colour::Headers); + + auto + it = m_sectionStack.begin() + 1, // Skip first section (test case) + itEnd = m_sectionStack.end(); + for (; it != itEnd; ++it) + printHeaderString(it->name, 2); + } + + SourceLineInfo lineInfo = m_sectionStack.back().lineInfo; + + if (!lineInfo.empty()) { + stream << getLineOfChars<'-'>() << '\n'; + Colour colourGuard(Colour::FileName); + stream << lineInfo << '\n'; + } + stream << getLineOfChars<'.'>() << '\n' << std::endl; +} + +void ConsoleReporter::printClosedHeader(std::string const& _name) { + printOpenHeader(_name); + stream << getLineOfChars<'.'>() << '\n'; +} +void ConsoleReporter::printOpenHeader(std::string const& _name) { + stream << getLineOfChars<'-'>() << '\n'; + { + Colour colourGuard(Colour::Headers); + printHeaderString(_name); + } +} + +// if string has a : in first line will set indent to follow it on +// subsequent lines +void ConsoleReporter::printHeaderString(std::string const& _string, std::size_t indent) { + std::size_t i = _string.find(": "); + if (i != std::string::npos) + i += 2; + else + i = 0; + stream << Column(_string).indent(indent + i).initialIndent(indent) << '\n'; +} + +struct SummaryColumn { + + SummaryColumn( std::string _label, Colour::Code _colour ) + : label( std::move( _label ) ), + colour( _colour ) {} + SummaryColumn addRow( std::size_t count ) { + ReusableStringStream rss; + rss << count; + std::string row = rss.str(); + for (auto& oldRow : rows) { + while (oldRow.size() < row.size()) + oldRow = ' ' + oldRow; + while (oldRow.size() > row.size()) + row = ' ' + row; + } + rows.push_back(row); + return *this; + } + + std::string label; + Colour::Code colour; + std::vector rows; + +}; + +void ConsoleReporter::printTotals( Totals const& totals ) { + if (totals.testCases.total() == 0) { + stream << Colour(Colour::Warning) << "No tests ran\n"; + } else if (totals.assertions.total() > 0 && totals.testCases.allPassed()) { + stream << Colour(Colour::ResultSuccess) << "All tests passed"; + stream << " (" + << pluralise(totals.assertions.passed, "assertion") << " in " + << pluralise(totals.testCases.passed, "test case") << ')' + << '\n'; + } else { + + std::vector columns; + columns.push_back(SummaryColumn("", Colour::None) + .addRow(totals.testCases.total()) + .addRow(totals.assertions.total())); + columns.push_back(SummaryColumn("passed", Colour::Success) + .addRow(totals.testCases.passed) + .addRow(totals.assertions.passed)); + columns.push_back(SummaryColumn("failed", Colour::ResultError) + .addRow(totals.testCases.failed) + .addRow(totals.assertions.failed)); + columns.push_back(SummaryColumn("failed as expected", Colour::ResultExpectedFailure) + .addRow(totals.testCases.failedButOk) + .addRow(totals.assertions.failedButOk)); + + printSummaryRow("test cases", columns, 0); + printSummaryRow("assertions", columns, 1); + } +} +void ConsoleReporter::printSummaryRow(std::string const& label, std::vector const& cols, std::size_t row) { + for (auto col : cols) { + std::string value = col.rows[row]; + if (col.label.empty()) { + stream << label << ": "; + if (value != "0") + stream << value; + else + stream << Colour(Colour::Warning) << "- none -"; + } else if (value != "0") { + stream << Colour(Colour::LightGrey) << " | "; + stream << Colour(col.colour) + << value << ' ' << col.label; + } + } + stream << '\n'; +} + +void ConsoleReporter::printTotalsDivider(Totals const& totals) { + if (totals.testCases.total() > 0) { + std::size_t failedRatio = makeRatio(totals.testCases.failed, totals.testCases.total()); + std::size_t failedButOkRatio = makeRatio(totals.testCases.failedButOk, totals.testCases.total()); + std::size_t passedRatio = makeRatio(totals.testCases.passed, totals.testCases.total()); + while (failedRatio + failedButOkRatio + passedRatio < CATCH_CONFIG_CONSOLE_WIDTH - 1) + findMax(failedRatio, failedButOkRatio, passedRatio)++; + while (failedRatio + failedButOkRatio + passedRatio > CATCH_CONFIG_CONSOLE_WIDTH - 1) + findMax(failedRatio, failedButOkRatio, passedRatio)--; + + stream << Colour(Colour::Error) << std::string(failedRatio, '='); + stream << Colour(Colour::ResultExpectedFailure) << std::string(failedButOkRatio, '='); + if (totals.testCases.allPassed()) + stream << Colour(Colour::ResultSuccess) << std::string(passedRatio, '='); + else + stream << Colour(Colour::Success) << std::string(passedRatio, '='); + } else { + stream << Colour(Colour::Warning) << std::string(CATCH_CONFIG_CONSOLE_WIDTH - 1, '='); + } + stream << '\n'; +} +void ConsoleReporter::printSummaryDivider() { + stream << getLineOfChars<'-'>() << '\n'; +} + +CATCH_REGISTER_REPORTER("console", ConsoleReporter) + +} // end namespace Catch + +#if defined(_MSC_VER) +#pragma warning(pop) +#endif +// end catch_reporter_console.cpp +// start catch_reporter_junit.cpp + +#include +#include +#include +#include + +namespace Catch { + + namespace { + std::string getCurrentTimestamp() { + // Beware, this is not reentrant because of backward compatibility issues + // Also, UTC only, again because of backward compatibility (%z is C++11) + time_t rawtime; + std::time(&rawtime); + auto const timeStampSize = sizeof("2017-01-16T17:06:45Z"); + +#ifdef _MSC_VER + std::tm timeInfo = {}; + gmtime_s(&timeInfo, &rawtime); +#else + std::tm* timeInfo; + timeInfo = std::gmtime(&rawtime); +#endif + + char timeStamp[timeStampSize]; + const char * const fmt = "%Y-%m-%dT%H:%M:%SZ"; + +#ifdef _MSC_VER + std::strftime(timeStamp, timeStampSize, fmt, &timeInfo); +#else + std::strftime(timeStamp, timeStampSize, fmt, timeInfo); +#endif + return std::string(timeStamp); + } + + std::string fileNameTag(const std::vector &tags) { + auto it = std::find_if(begin(tags), + end(tags), + [] (std::string const& tag) {return tag.front() == '#'; }); + if (it != tags.end()) + return it->substr(1); + return std::string(); + } + } // anonymous namespace + + JunitReporter::JunitReporter( ReporterConfig const& _config ) + : CumulativeReporterBase( _config ), + xml( _config.stream() ) + { + m_reporterPrefs.shouldRedirectStdOut = true; + m_reporterPrefs.shouldReportAllAssertions = true; + } + + JunitReporter::~JunitReporter() {} + + std::string JunitReporter::getDescription() { + return "Reports test results in an XML format that looks like Ant's junitreport target"; + } + + void JunitReporter::noMatchingTestCases( std::string const& /*spec*/ ) {} + + void JunitReporter::testRunStarting( TestRunInfo const& runInfo ) { + CumulativeReporterBase::testRunStarting( runInfo ); + xml.startElement( "testsuites" ); + if( m_config->rngSeed() != 0 ) { + xml.startElement( "properties" ); + xml.scopedElement( "property" ) + .writeAttribute( "name", "random-seed" ) + .writeAttribute( "value", m_config->rngSeed() ); + xml.endElement(); + } + } + + void JunitReporter::testGroupStarting( GroupInfo const& groupInfo ) { + suiteTimer.start(); + stdOutForSuite.clear(); + stdErrForSuite.clear(); + unexpectedExceptions = 0; + CumulativeReporterBase::testGroupStarting( groupInfo ); + } + + void JunitReporter::testCaseStarting( TestCaseInfo const& testCaseInfo ) { + m_okToFail = testCaseInfo.okToFail(); + } + + bool JunitReporter::assertionEnded( AssertionStats const& assertionStats ) { + if( assertionStats.assertionResult.getResultType() == ResultWas::ThrewException && !m_okToFail ) + unexpectedExceptions++; + return CumulativeReporterBase::assertionEnded( assertionStats ); + } + + void JunitReporter::testCaseEnded( TestCaseStats const& testCaseStats ) { + stdOutForSuite += testCaseStats.stdOut; + stdErrForSuite += testCaseStats.stdErr; + CumulativeReporterBase::testCaseEnded( testCaseStats ); + } + + void JunitReporter::testGroupEnded( TestGroupStats const& testGroupStats ) { + double suiteTime = suiteTimer.getElapsedSeconds(); + CumulativeReporterBase::testGroupEnded( testGroupStats ); + writeGroup( *m_testGroups.back(), suiteTime ); + } + + void JunitReporter::testRunEndedCumulative() { + xml.endElement(); + } + + void JunitReporter::writeGroup( TestGroupNode const& groupNode, double suiteTime ) { + XmlWriter::ScopedElement e = xml.scopedElement( "testsuite" ); + TestGroupStats const& stats = groupNode.value; + xml.writeAttribute( "name", stats.groupInfo.name ); + xml.writeAttribute( "errors", unexpectedExceptions ); + xml.writeAttribute( "failures", stats.totals.assertions.failed-unexpectedExceptions ); + xml.writeAttribute( "tests", stats.totals.assertions.total() ); + xml.writeAttribute( "hostname", "tbd" ); // !TBD + if( m_config->showDurations() == ShowDurations::Never ) + xml.writeAttribute( "time", "" ); + else + xml.writeAttribute( "time", suiteTime ); + xml.writeAttribute( "timestamp", getCurrentTimestamp() ); + + // Write test cases + for( auto const& child : groupNode.children ) + writeTestCase( *child ); + + xml.scopedElement( "system-out" ).writeText( trim( stdOutForSuite ), false ); + xml.scopedElement( "system-err" ).writeText( trim( stdErrForSuite ), false ); + } + + void JunitReporter::writeTestCase( TestCaseNode const& testCaseNode ) { + TestCaseStats const& stats = testCaseNode.value; + + // All test cases have exactly one section - which represents the + // test case itself. That section may have 0-n nested sections + assert( testCaseNode.children.size() == 1 ); + SectionNode const& rootSection = *testCaseNode.children.front(); + + std::string className = stats.testInfo.className; + + if( className.empty() ) { + className = fileNameTag(stats.testInfo.tags); + if ( className.empty() ) + className = "global"; + } + + if ( !m_config->name().empty() ) + className = m_config->name() + "." + className; + + writeSection( className, "", rootSection ); + } + + void JunitReporter::writeSection( std::string const& className, + std::string const& rootName, + SectionNode const& sectionNode ) { + std::string name = trim( sectionNode.stats.sectionInfo.name ); + if( !rootName.empty() ) + name = rootName + '/' + name; + + if( !sectionNode.assertions.empty() || + !sectionNode.stdOut.empty() || + !sectionNode.stdErr.empty() ) { + XmlWriter::ScopedElement e = xml.scopedElement( "testcase" ); + if( className.empty() ) { + xml.writeAttribute( "classname", name ); + xml.writeAttribute( "name", "root" ); + } + else { + xml.writeAttribute( "classname", className ); + xml.writeAttribute( "name", name ); + } + xml.writeAttribute( "time", ::Catch::Detail::stringify( sectionNode.stats.durationInSeconds ) ); + + writeAssertions( sectionNode ); + + if( !sectionNode.stdOut.empty() ) + xml.scopedElement( "system-out" ).writeText( trim( sectionNode.stdOut ), false ); + if( !sectionNode.stdErr.empty() ) + xml.scopedElement( "system-err" ).writeText( trim( sectionNode.stdErr ), false ); + } + for( auto const& childNode : sectionNode.childSections ) + if( className.empty() ) + writeSection( name, "", *childNode ); + else + writeSection( className, name, *childNode ); + } + + void JunitReporter::writeAssertions( SectionNode const& sectionNode ) { + for( auto const& assertion : sectionNode.assertions ) + writeAssertion( assertion ); + } + + void JunitReporter::writeAssertion( AssertionStats const& stats ) { + AssertionResult const& result = stats.assertionResult; + if( !result.isOk() ) { + std::string elementName; + switch( result.getResultType() ) { + case ResultWas::ThrewException: + case ResultWas::FatalErrorCondition: + elementName = "error"; + break; + case ResultWas::ExplicitFailure: + elementName = "failure"; + break; + case ResultWas::ExpressionFailed: + elementName = "failure"; + break; + case ResultWas::DidntThrowException: + elementName = "failure"; + break; + + // We should never see these here: + case ResultWas::Info: + case ResultWas::Warning: + case ResultWas::Ok: + case ResultWas::Unknown: + case ResultWas::FailureBit: + case ResultWas::Exception: + elementName = "internalError"; + break; + } + + XmlWriter::ScopedElement e = xml.scopedElement( elementName ); + + xml.writeAttribute( "message", result.getExpandedExpression() ); + xml.writeAttribute( "type", result.getTestMacroName() ); + + ReusableStringStream rss; + if( !result.getMessage().empty() ) + rss << result.getMessage() << '\n'; + for( auto const& msg : stats.infoMessages ) + if( msg.type == ResultWas::Info ) + rss << msg.message << '\n'; + + rss << "at " << result.getSourceInfo(); + xml.writeText( rss.str(), false ); + } + } + + CATCH_REGISTER_REPORTER( "junit", JunitReporter ) + +} // end namespace Catch +// end catch_reporter_junit.cpp +// start catch_reporter_listening.cpp + +#include + +namespace Catch { + + ListeningReporter::ListeningReporter() { + // We will assume that listeners will always want all assertions + m_preferences.shouldReportAllAssertions = true; + } + + void ListeningReporter::addListener( IStreamingReporterPtr&& listener ) { + m_listeners.push_back( std::move( listener ) ); + } + + void ListeningReporter::addReporter(IStreamingReporterPtr&& reporter) { + assert(!m_reporter && "Listening reporter can wrap only 1 real reporter"); + m_reporter = std::move( reporter ); + m_preferences.shouldRedirectStdOut = m_reporter->getPreferences().shouldRedirectStdOut; + } + + ReporterPreferences ListeningReporter::getPreferences() const { + return m_preferences; + } + + std::set ListeningReporter::getSupportedVerbosities() { + return std::set{ }; + } + + void ListeningReporter::noMatchingTestCases( std::string const& spec ) { + for ( auto const& listener : m_listeners ) { + listener->noMatchingTestCases( spec ); + } + m_reporter->noMatchingTestCases( spec ); + } + + void ListeningReporter::benchmarkStarting( BenchmarkInfo const& benchmarkInfo ) { + for ( auto const& listener : m_listeners ) { + listener->benchmarkStarting( benchmarkInfo ); + } + m_reporter->benchmarkStarting( benchmarkInfo ); + } + void ListeningReporter::benchmarkEnded( BenchmarkStats const& benchmarkStats ) { + for ( auto const& listener : m_listeners ) { + listener->benchmarkEnded( benchmarkStats ); + } + m_reporter->benchmarkEnded( benchmarkStats ); + } + + void ListeningReporter::testRunStarting( TestRunInfo const& testRunInfo ) { + for ( auto const& listener : m_listeners ) { + listener->testRunStarting( testRunInfo ); + } + m_reporter->testRunStarting( testRunInfo ); + } + + void ListeningReporter::testGroupStarting( GroupInfo const& groupInfo ) { + for ( auto const& listener : m_listeners ) { + listener->testGroupStarting( groupInfo ); + } + m_reporter->testGroupStarting( groupInfo ); + } + + void ListeningReporter::testCaseStarting( TestCaseInfo const& testInfo ) { + for ( auto const& listener : m_listeners ) { + listener->testCaseStarting( testInfo ); + } + m_reporter->testCaseStarting( testInfo ); + } + + void ListeningReporter::sectionStarting( SectionInfo const& sectionInfo ) { + for ( auto const& listener : m_listeners ) { + listener->sectionStarting( sectionInfo ); + } + m_reporter->sectionStarting( sectionInfo ); + } + + void ListeningReporter::assertionStarting( AssertionInfo const& assertionInfo ) { + for ( auto const& listener : m_listeners ) { + listener->assertionStarting( assertionInfo ); + } + m_reporter->assertionStarting( assertionInfo ); + } + + // The return value indicates if the messages buffer should be cleared: + bool ListeningReporter::assertionEnded( AssertionStats const& assertionStats ) { + for( auto const& listener : m_listeners ) { + static_cast( listener->assertionEnded( assertionStats ) ); + } + return m_reporter->assertionEnded( assertionStats ); + } + + void ListeningReporter::sectionEnded( SectionStats const& sectionStats ) { + for ( auto const& listener : m_listeners ) { + listener->sectionEnded( sectionStats ); + } + m_reporter->sectionEnded( sectionStats ); + } + + void ListeningReporter::testCaseEnded( TestCaseStats const& testCaseStats ) { + for ( auto const& listener : m_listeners ) { + listener->testCaseEnded( testCaseStats ); + } + m_reporter->testCaseEnded( testCaseStats ); + } + + void ListeningReporter::testGroupEnded( TestGroupStats const& testGroupStats ) { + for ( auto const& listener : m_listeners ) { + listener->testGroupEnded( testGroupStats ); + } + m_reporter->testGroupEnded( testGroupStats ); + } + + void ListeningReporter::testRunEnded( TestRunStats const& testRunStats ) { + for ( auto const& listener : m_listeners ) { + listener->testRunEnded( testRunStats ); + } + m_reporter->testRunEnded( testRunStats ); + } + + void ListeningReporter::skipTest( TestCaseInfo const& testInfo ) { + for ( auto const& listener : m_listeners ) { + listener->skipTest( testInfo ); + } + m_reporter->skipTest( testInfo ); + } + + bool ListeningReporter::isMulti() const { + return true; + } + +} // end namespace Catch +// end catch_reporter_listening.cpp +// start catch_reporter_xml.cpp + +#if defined(_MSC_VER) +#pragma warning(push) +#pragma warning(disable:4061) // Not all labels are EXPLICITLY handled in switch + // Note that 4062 (not all labels are handled + // and default is missing) is enabled +#endif + +namespace Catch { + XmlReporter::XmlReporter( ReporterConfig const& _config ) + : StreamingReporterBase( _config ), + m_xml(_config.stream()) + { + m_reporterPrefs.shouldRedirectStdOut = true; + m_reporterPrefs.shouldReportAllAssertions = true; + } + + XmlReporter::~XmlReporter() = default; + + std::string XmlReporter::getDescription() { + return "Reports test results as an XML document"; + } + + std::string XmlReporter::getStylesheetRef() const { + return std::string(); + } + + void XmlReporter::writeSourceInfo( SourceLineInfo const& sourceInfo ) { + m_xml + .writeAttribute( "filename", sourceInfo.file ) + .writeAttribute( "line", sourceInfo.line ); + } + + void XmlReporter::noMatchingTestCases( std::string const& s ) { + StreamingReporterBase::noMatchingTestCases( s ); + } + + void XmlReporter::testRunStarting( TestRunInfo const& testInfo ) { + StreamingReporterBase::testRunStarting( testInfo ); + std::string stylesheetRef = getStylesheetRef(); + if( !stylesheetRef.empty() ) + m_xml.writeStylesheetRef( stylesheetRef ); + m_xml.startElement( "Catch" ); + if( !m_config->name().empty() ) + m_xml.writeAttribute( "name", m_config->name() ); + if( m_config->rngSeed() != 0 ) + m_xml.scopedElement( "Randomness" ) + .writeAttribute( "seed", m_config->rngSeed() ); + } + + void XmlReporter::testGroupStarting( GroupInfo const& groupInfo ) { + StreamingReporterBase::testGroupStarting( groupInfo ); + m_xml.startElement( "Group" ) + .writeAttribute( "name", groupInfo.name ); + } + + void XmlReporter::testCaseStarting( TestCaseInfo const& testInfo ) { + StreamingReporterBase::testCaseStarting(testInfo); + m_xml.startElement( "TestCase" ) + .writeAttribute( "name", trim( testInfo.name ) ) + .writeAttribute( "description", testInfo.description ) + .writeAttribute( "tags", testInfo.tagsAsString() ); + + writeSourceInfo( testInfo.lineInfo ); + + if ( m_config->showDurations() == ShowDurations::Always ) + m_testCaseTimer.start(); + m_xml.ensureTagClosed(); + } + + void XmlReporter::sectionStarting( SectionInfo const& sectionInfo ) { + StreamingReporterBase::sectionStarting( sectionInfo ); + if( m_sectionDepth++ > 0 ) { + m_xml.startElement( "Section" ) + .writeAttribute( "name", trim( sectionInfo.name ) ); + writeSourceInfo( sectionInfo.lineInfo ); + m_xml.ensureTagClosed(); + } + } + + void XmlReporter::assertionStarting( AssertionInfo const& ) { } + + bool XmlReporter::assertionEnded( AssertionStats const& assertionStats ) { + + AssertionResult const& result = assertionStats.assertionResult; + + bool includeResults = m_config->includeSuccessfulResults() || !result.isOk(); + + if( includeResults || result.getResultType() == ResultWas::Warning ) { + // Print any info messages in tags. + for( auto const& msg : assertionStats.infoMessages ) { + if( msg.type == ResultWas::Info && includeResults ) { + m_xml.scopedElement( "Info" ) + .writeText( msg.message ); + } else if ( msg.type == ResultWas::Warning ) { + m_xml.scopedElement( "Warning" ) + .writeText( msg.message ); + } + } + } + + // Drop out if result was successful but we're not printing them. + if( !includeResults && result.getResultType() != ResultWas::Warning ) + return true; + + // Print the expression if there is one. + if( result.hasExpression() ) { + m_xml.startElement( "Expression" ) + .writeAttribute( "success", result.succeeded() ) + .writeAttribute( "type", result.getTestMacroName() ); + + writeSourceInfo( result.getSourceInfo() ); + + m_xml.scopedElement( "Original" ) + .writeText( result.getExpression() ); + m_xml.scopedElement( "Expanded" ) + .writeText( result.getExpandedExpression() ); + } + + // And... Print a result applicable to each result type. + switch( result.getResultType() ) { + case ResultWas::ThrewException: + m_xml.startElement( "Exception" ); + writeSourceInfo( result.getSourceInfo() ); + m_xml.writeText( result.getMessage() ); + m_xml.endElement(); + break; + case ResultWas::FatalErrorCondition: + m_xml.startElement( "FatalErrorCondition" ); + writeSourceInfo( result.getSourceInfo() ); + m_xml.writeText( result.getMessage() ); + m_xml.endElement(); + break; + case ResultWas::Info: + m_xml.scopedElement( "Info" ) + .writeText( result.getMessage() ); + break; + case ResultWas::Warning: + // Warning will already have been written + break; + case ResultWas::ExplicitFailure: + m_xml.startElement( "Failure" ); + writeSourceInfo( result.getSourceInfo() ); + m_xml.writeText( result.getMessage() ); + m_xml.endElement(); + break; + default: + break; + } + + if( result.hasExpression() ) + m_xml.endElement(); + + return true; + } + + void XmlReporter::sectionEnded( SectionStats const& sectionStats ) { + StreamingReporterBase::sectionEnded( sectionStats ); + if( --m_sectionDepth > 0 ) { + XmlWriter::ScopedElement e = m_xml.scopedElement( "OverallResults" ); + e.writeAttribute( "successes", sectionStats.assertions.passed ); + e.writeAttribute( "failures", sectionStats.assertions.failed ); + e.writeAttribute( "expectedFailures", sectionStats.assertions.failedButOk ); + + if ( m_config->showDurations() == ShowDurations::Always ) + e.writeAttribute( "durationInSeconds", sectionStats.durationInSeconds ); + + m_xml.endElement(); + } + } + + void XmlReporter::testCaseEnded( TestCaseStats const& testCaseStats ) { + StreamingReporterBase::testCaseEnded( testCaseStats ); + XmlWriter::ScopedElement e = m_xml.scopedElement( "OverallResult" ); + e.writeAttribute( "success", testCaseStats.totals.assertions.allOk() ); + + if ( m_config->showDurations() == ShowDurations::Always ) + e.writeAttribute( "durationInSeconds", m_testCaseTimer.getElapsedSeconds() ); + + if( !testCaseStats.stdOut.empty() ) + m_xml.scopedElement( "StdOut" ).writeText( trim( testCaseStats.stdOut ), false ); + if( !testCaseStats.stdErr.empty() ) + m_xml.scopedElement( "StdErr" ).writeText( trim( testCaseStats.stdErr ), false ); + + m_xml.endElement(); + } + + void XmlReporter::testGroupEnded( TestGroupStats const& testGroupStats ) { + StreamingReporterBase::testGroupEnded( testGroupStats ); + // TODO: Check testGroupStats.aborting and act accordingly. + m_xml.scopedElement( "OverallResults" ) + .writeAttribute( "successes", testGroupStats.totals.assertions.passed ) + .writeAttribute( "failures", testGroupStats.totals.assertions.failed ) + .writeAttribute( "expectedFailures", testGroupStats.totals.assertions.failedButOk ); + m_xml.endElement(); + } + + void XmlReporter::testRunEnded( TestRunStats const& testRunStats ) { + StreamingReporterBase::testRunEnded( testRunStats ); + m_xml.scopedElement( "OverallResults" ) + .writeAttribute( "successes", testRunStats.totals.assertions.passed ) + .writeAttribute( "failures", testRunStats.totals.assertions.failed ) + .writeAttribute( "expectedFailures", testRunStats.totals.assertions.failedButOk ); + m_xml.endElement(); + } + + CATCH_REGISTER_REPORTER( "xml", XmlReporter ) + +} // end namespace Catch + +#if defined(_MSC_VER) +#pragma warning(pop) +#endif +// end catch_reporter_xml.cpp + +namespace Catch { + LeakDetector leakDetector; +} + +#ifdef __clang__ +#pragma clang diagnostic pop +#endif + +// end catch_impl.hpp +#endif + +#ifdef CATCH_CONFIG_MAIN +// start catch_default_main.hpp + +#ifndef __OBJC__ + +#if defined(CATCH_CONFIG_WCHAR) && defined(WIN32) && defined(_UNICODE) && !defined(DO_NOT_USE_WMAIN) +// Standard C/C++ Win32 Unicode wmain entry point +extern "C" int wmain (int argc, wchar_t * argv[], wchar_t * []) { +#else +// Standard C/C++ main entry point +int main (int argc, char * argv[]) { +#endif + + return Catch::Session().run( argc, argv ); +} + +#else // __OBJC__ + +// Objective-C entry point +int main (int argc, char * const argv[]) { +#if !CATCH_ARC_ENABLED + NSAutoreleasePool * pool = [[NSAutoreleasePool alloc] init]; +#endif + + Catch::registerTestMethods(); + int result = Catch::Session().run( argc, (char**)argv ); + +#if !CATCH_ARC_ENABLED + [pool drain]; +#endif + + return result; +} + +#endif // __OBJC__ + +// end catch_default_main.hpp +#endif + +#if !defined(CATCH_CONFIG_IMPL_ONLY) + +#ifdef CLARA_CONFIG_MAIN_NOT_DEFINED +# undef CLARA_CONFIG_MAIN +#endif + +#if !defined(CATCH_CONFIG_DISABLE) +////// +// If this config identifier is defined then all CATCH macros are prefixed with CATCH_ +#ifdef CATCH_CONFIG_PREFIX_ALL + +#define CATCH_REQUIRE( ... ) INTERNAL_CATCH_TEST( "CATCH_REQUIRE", Catch::ResultDisposition::Normal, __VA_ARGS__ ) +#define CATCH_REQUIRE_FALSE( ... ) INTERNAL_CATCH_TEST( "CATCH_REQUIRE_FALSE", Catch::ResultDisposition::Normal | Catch::ResultDisposition::FalseTest, __VA_ARGS__ ) + +#define CATCH_REQUIRE_THROWS( ... ) INTERNAL_CATCH_THROWS( "CATCH_REQUIRE_THROWS", Catch::ResultDisposition::Normal, __VA_ARGS__ ) +#define CATCH_REQUIRE_THROWS_AS( expr, exceptionType ) INTERNAL_CATCH_THROWS_AS( "CATCH_REQUIRE_THROWS_AS", exceptionType, Catch::ResultDisposition::Normal, expr ) +#define CATCH_REQUIRE_THROWS_WITH( expr, matcher ) INTERNAL_CATCH_THROWS_STR_MATCHES( "CATCH_REQUIRE_THROWS_WITH", Catch::ResultDisposition::Normal, matcher, expr ) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CATCH_REQUIRE_THROWS_MATCHES( expr, exceptionType, matcher ) INTERNAL_CATCH_THROWS_MATCHES( "CATCH_REQUIRE_THROWS_MATCHES", exceptionType, Catch::ResultDisposition::Normal, matcher, expr ) +#endif// CATCH_CONFIG_DISABLE_MATCHERS +#define CATCH_REQUIRE_NOTHROW( ... ) INTERNAL_CATCH_NO_THROW( "CATCH_REQUIRE_NOTHROW", Catch::ResultDisposition::Normal, __VA_ARGS__ ) + +#define CATCH_CHECK( ... ) INTERNAL_CATCH_TEST( "CATCH_CHECK", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CATCH_CHECK_FALSE( ... ) INTERNAL_CATCH_TEST( "CATCH_CHECK_FALSE", Catch::ResultDisposition::ContinueOnFailure | Catch::ResultDisposition::FalseTest, __VA_ARGS__ ) +#define CATCH_CHECKED_IF( ... ) INTERNAL_CATCH_IF( "CATCH_CHECKED_IF", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CATCH_CHECKED_ELSE( ... ) INTERNAL_CATCH_ELSE( "CATCH_CHECKED_ELSE", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CATCH_CHECK_NOFAIL( ... ) INTERNAL_CATCH_TEST( "CATCH_CHECK_NOFAIL", Catch::ResultDisposition::ContinueOnFailure | Catch::ResultDisposition::SuppressFail, __VA_ARGS__ ) + +#define CATCH_CHECK_THROWS( ... ) INTERNAL_CATCH_THROWS( "CATCH_CHECK_THROWS", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CATCH_CHECK_THROWS_AS( expr, exceptionType ) INTERNAL_CATCH_THROWS_AS( "CATCH_CHECK_THROWS_AS", exceptionType, Catch::ResultDisposition::ContinueOnFailure, expr ) +#define CATCH_CHECK_THROWS_WITH( expr, matcher ) INTERNAL_CATCH_THROWS_STR_MATCHES( "CATCH_CHECK_THROWS_WITH", Catch::ResultDisposition::ContinueOnFailure, matcher, expr ) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CATCH_CHECK_THROWS_MATCHES( expr, exceptionType, matcher ) INTERNAL_CATCH_THROWS_MATCHES( "CATCH_CHECK_THROWS_MATCHES", exceptionType, Catch::ResultDisposition::ContinueOnFailure, matcher, expr ) +#endif // CATCH_CONFIG_DISABLE_MATCHERS +#define CATCH_CHECK_NOTHROW( ... ) INTERNAL_CATCH_NO_THROW( "CATCH_CHECK_NOTHROW", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) + +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CATCH_CHECK_THAT( arg, matcher ) INTERNAL_CHECK_THAT( "CATCH_CHECK_THAT", matcher, Catch::ResultDisposition::ContinueOnFailure, arg ) + +#define CATCH_REQUIRE_THAT( arg, matcher ) INTERNAL_CHECK_THAT( "CATCH_REQUIRE_THAT", matcher, Catch::ResultDisposition::Normal, arg ) +#endif // CATCH_CONFIG_DISABLE_MATCHERS + +#define CATCH_INFO( msg ) INTERNAL_CATCH_INFO( "CATCH_INFO", msg ) +#define CATCH_WARN( msg ) INTERNAL_CATCH_MSG( "CATCH_WARN", Catch::ResultWas::Warning, Catch::ResultDisposition::ContinueOnFailure, msg ) +#define CATCH_CAPTURE( ... ) INTERNAL_CATCH_CAPTURE( INTERNAL_CATCH_UNIQUE_NAME(capturer), "CATCH_CAPTURE",__VA_ARGS__ ) + +#define CATCH_TEST_CASE( ... ) INTERNAL_CATCH_TESTCASE( __VA_ARGS__ ) +#define CATCH_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#define CATCH_METHOD_AS_TEST_CASE( method, ... ) INTERNAL_CATCH_METHOD_AS_TEST_CASE( method, __VA_ARGS__ ) +#define CATCH_REGISTER_TEST_CASE( Function, ... ) INTERNAL_CATCH_REGISTER_TESTCASE( Function, __VA_ARGS__ ) +#define CATCH_SECTION( ... ) INTERNAL_CATCH_SECTION( __VA_ARGS__ ) +#define CATCH_DYNAMIC_SECTION( ... ) INTERNAL_CATCH_DYNAMIC_SECTION( __VA_ARGS__ ) +#define CATCH_FAIL( ... ) INTERNAL_CATCH_MSG( "CATCH_FAIL", Catch::ResultWas::ExplicitFailure, Catch::ResultDisposition::Normal, __VA_ARGS__ ) +#define CATCH_FAIL_CHECK( ... ) INTERNAL_CATCH_MSG( "CATCH_FAIL_CHECK", Catch::ResultWas::ExplicitFailure, Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CATCH_SUCCEED( ... ) INTERNAL_CATCH_MSG( "CATCH_SUCCEED", Catch::ResultWas::Ok, Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) + +#define CATCH_ANON_TEST_CASE() INTERNAL_CATCH_TESTCASE() + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define CATCH_TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE( __VA_ARGS__ ) +#define CATCH_TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE( ... ) INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE( __VA_ARGS__ ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#else +#define CATCH_TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE( __VA_ARGS__ ) ) +#define CATCH_TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE( ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE( __VA_ARGS__ ) ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, __VA_ARGS__ ) ) +#endif + +#if !defined(CATCH_CONFIG_RUNTIME_STATIC_REQUIRE) +#define CATCH_STATIC_REQUIRE( ... ) static_assert( __VA_ARGS__ , #__VA_ARGS__ ); CATCH_SUCCEED( #__VA_ARGS__ ) +#define CATCH_STATIC_REQUIRE_FALSE( ... ) static_assert( !(__VA_ARGS__), "!(" #__VA_ARGS__ ")" ); CATCH_SUCCEED( #__VA_ARGS__ ) +#else +#define CATCH_STATIC_REQUIRE( ... ) CATCH_REQUIRE( __VA_ARGS__ ) +#define CATCH_STATIC_REQUIRE_FALSE( ... ) CATCH_REQUIRE_FALSE( __VA_ARGS__ ) +#endif + +// "BDD-style" convenience wrappers +#define CATCH_SCENARIO( ... ) CATCH_TEST_CASE( "Scenario: " __VA_ARGS__ ) +#define CATCH_SCENARIO_METHOD( className, ... ) INTERNAL_CATCH_TEST_CASE_METHOD( className, "Scenario: " __VA_ARGS__ ) +#define CATCH_GIVEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " Given: " << desc ) +#define CATCH_AND_GIVEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( "And given: " << desc ) +#define CATCH_WHEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " When: " << desc ) +#define CATCH_AND_WHEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " And when: " << desc ) +#define CATCH_THEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " Then: " << desc ) +#define CATCH_AND_THEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " And: " << desc ) + +// If CATCH_CONFIG_PREFIX_ALL is not defined then the CATCH_ prefix is not required +#else + +#define REQUIRE( ... ) INTERNAL_CATCH_TEST( "REQUIRE", Catch::ResultDisposition::Normal, __VA_ARGS__ ) +#define REQUIRE_FALSE( ... ) INTERNAL_CATCH_TEST( "REQUIRE_FALSE", Catch::ResultDisposition::Normal | Catch::ResultDisposition::FalseTest, __VA_ARGS__ ) + +#define REQUIRE_THROWS( ... ) INTERNAL_CATCH_THROWS( "REQUIRE_THROWS", Catch::ResultDisposition::Normal, __VA_ARGS__ ) +#define REQUIRE_THROWS_AS( expr, exceptionType ) INTERNAL_CATCH_THROWS_AS( "REQUIRE_THROWS_AS", exceptionType, Catch::ResultDisposition::Normal, expr ) +#define REQUIRE_THROWS_WITH( expr, matcher ) INTERNAL_CATCH_THROWS_STR_MATCHES( "REQUIRE_THROWS_WITH", Catch::ResultDisposition::Normal, matcher, expr ) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define REQUIRE_THROWS_MATCHES( expr, exceptionType, matcher ) INTERNAL_CATCH_THROWS_MATCHES( "REQUIRE_THROWS_MATCHES", exceptionType, Catch::ResultDisposition::Normal, matcher, expr ) +#endif // CATCH_CONFIG_DISABLE_MATCHERS +#define REQUIRE_NOTHROW( ... ) INTERNAL_CATCH_NO_THROW( "REQUIRE_NOTHROW", Catch::ResultDisposition::Normal, __VA_ARGS__ ) + +#define CHECK( ... ) INTERNAL_CATCH_TEST( "CHECK", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CHECK_FALSE( ... ) INTERNAL_CATCH_TEST( "CHECK_FALSE", Catch::ResultDisposition::ContinueOnFailure | Catch::ResultDisposition::FalseTest, __VA_ARGS__ ) +#define CHECKED_IF( ... ) INTERNAL_CATCH_IF( "CHECKED_IF", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CHECKED_ELSE( ... ) INTERNAL_CATCH_ELSE( "CHECKED_ELSE", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CHECK_NOFAIL( ... ) INTERNAL_CATCH_TEST( "CHECK_NOFAIL", Catch::ResultDisposition::ContinueOnFailure | Catch::ResultDisposition::SuppressFail, __VA_ARGS__ ) + +#define CHECK_THROWS( ... ) INTERNAL_CATCH_THROWS( "CHECK_THROWS", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CHECK_THROWS_AS( expr, exceptionType ) INTERNAL_CATCH_THROWS_AS( "CHECK_THROWS_AS", exceptionType, Catch::ResultDisposition::ContinueOnFailure, expr ) +#define CHECK_THROWS_WITH( expr, matcher ) INTERNAL_CATCH_THROWS_STR_MATCHES( "CHECK_THROWS_WITH", Catch::ResultDisposition::ContinueOnFailure, matcher, expr ) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CHECK_THROWS_MATCHES( expr, exceptionType, matcher ) INTERNAL_CATCH_THROWS_MATCHES( "CHECK_THROWS_MATCHES", exceptionType, Catch::ResultDisposition::ContinueOnFailure, matcher, expr ) +#endif // CATCH_CONFIG_DISABLE_MATCHERS +#define CHECK_NOTHROW( ... ) INTERNAL_CATCH_NO_THROW( "CHECK_NOTHROW", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) + +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CHECK_THAT( arg, matcher ) INTERNAL_CHECK_THAT( "CHECK_THAT", matcher, Catch::ResultDisposition::ContinueOnFailure, arg ) + +#define REQUIRE_THAT( arg, matcher ) INTERNAL_CHECK_THAT( "REQUIRE_THAT", matcher, Catch::ResultDisposition::Normal, arg ) +#endif // CATCH_CONFIG_DISABLE_MATCHERS + +#define INFO( msg ) INTERNAL_CATCH_INFO( "INFO", msg ) +#define UNSCOPED_INFO( msg ) INTERNAL_CATCH_UNSCOPED_INFO( "UNSCOPED_INFO", msg ) +#define WARN( msg ) INTERNAL_CATCH_MSG( "WARN", Catch::ResultWas::Warning, Catch::ResultDisposition::ContinueOnFailure, msg ) +#define CAPTURE( ... ) INTERNAL_CATCH_CAPTURE( INTERNAL_CATCH_UNIQUE_NAME(capturer), "CAPTURE",__VA_ARGS__ ) + +#define TEST_CASE( ... ) INTERNAL_CATCH_TESTCASE( __VA_ARGS__ ) +#define TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#define METHOD_AS_TEST_CASE( method, ... ) INTERNAL_CATCH_METHOD_AS_TEST_CASE( method, __VA_ARGS__ ) +#define REGISTER_TEST_CASE( Function, ... ) INTERNAL_CATCH_REGISTER_TESTCASE( Function, __VA_ARGS__ ) +#define SECTION( ... ) INTERNAL_CATCH_SECTION( __VA_ARGS__ ) +#define DYNAMIC_SECTION( ... ) INTERNAL_CATCH_DYNAMIC_SECTION( __VA_ARGS__ ) +#define FAIL( ... ) INTERNAL_CATCH_MSG( "FAIL", Catch::ResultWas::ExplicitFailure, Catch::ResultDisposition::Normal, __VA_ARGS__ ) +#define FAIL_CHECK( ... ) INTERNAL_CATCH_MSG( "FAIL_CHECK", Catch::ResultWas::ExplicitFailure, Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define SUCCEED( ... ) INTERNAL_CATCH_MSG( "SUCCEED", Catch::ResultWas::Ok, Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define ANON_TEST_CASE() INTERNAL_CATCH_TESTCASE() + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE( __VA_ARGS__ ) +#define TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#define TEMPLATE_PRODUCT_TEST_CASE( ... ) INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE( __VA_ARGS__ ) +#define TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#else +#define TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE( __VA_ARGS__ ) ) +#define TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) ) +#define TEMPLATE_PRODUCT_TEST_CASE( ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE( __VA_ARGS__ ) ) +#define TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, __VA_ARGS__ ) ) +#endif + +#if !defined(CATCH_CONFIG_RUNTIME_STATIC_REQUIRE) +#define STATIC_REQUIRE( ... ) static_assert( __VA_ARGS__, #__VA_ARGS__ ); SUCCEED( #__VA_ARGS__ ) +#define STATIC_REQUIRE_FALSE( ... ) static_assert( !(__VA_ARGS__), "!(" #__VA_ARGS__ ")" ); SUCCEED( "!(" #__VA_ARGS__ ")" ) +#else +#define STATIC_REQUIRE( ... ) REQUIRE( __VA_ARGS__ ) +#define STATIC_REQUIRE_FALSE( ... ) REQUIRE_FALSE( __VA_ARGS__ ) +#endif + +#endif + +#define CATCH_TRANSLATE_EXCEPTION( signature ) INTERNAL_CATCH_TRANSLATE_EXCEPTION( signature ) + +// "BDD-style" convenience wrappers +#define SCENARIO( ... ) TEST_CASE( "Scenario: " __VA_ARGS__ ) +#define SCENARIO_METHOD( className, ... ) INTERNAL_CATCH_TEST_CASE_METHOD( className, "Scenario: " __VA_ARGS__ ) + +#define GIVEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " Given: " << desc ) +#define AND_GIVEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( "And given: " << desc ) +#define WHEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " When: " << desc ) +#define AND_WHEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " And when: " << desc ) +#define THEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " Then: " << desc ) +#define AND_THEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " And: " << desc ) + +using Catch::Detail::Approx; + +#else // CATCH_CONFIG_DISABLE + +////// +// If this config identifier is defined then all CATCH macros are prefixed with CATCH_ +#ifdef CATCH_CONFIG_PREFIX_ALL + +#define CATCH_REQUIRE( ... ) (void)(0) +#define CATCH_REQUIRE_FALSE( ... ) (void)(0) + +#define CATCH_REQUIRE_THROWS( ... ) (void)(0) +#define CATCH_REQUIRE_THROWS_AS( expr, exceptionType ) (void)(0) +#define CATCH_REQUIRE_THROWS_WITH( expr, matcher ) (void)(0) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CATCH_REQUIRE_THROWS_MATCHES( expr, exceptionType, matcher ) (void)(0) +#endif// CATCH_CONFIG_DISABLE_MATCHERS +#define CATCH_REQUIRE_NOTHROW( ... ) (void)(0) + +#define CATCH_CHECK( ... ) (void)(0) +#define CATCH_CHECK_FALSE( ... ) (void)(0) +#define CATCH_CHECKED_IF( ... ) if (__VA_ARGS__) +#define CATCH_CHECKED_ELSE( ... ) if (!(__VA_ARGS__)) +#define CATCH_CHECK_NOFAIL( ... ) (void)(0) + +#define CATCH_CHECK_THROWS( ... ) (void)(0) +#define CATCH_CHECK_THROWS_AS( expr, exceptionType ) (void)(0) +#define CATCH_CHECK_THROWS_WITH( expr, matcher ) (void)(0) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CATCH_CHECK_THROWS_MATCHES( expr, exceptionType, matcher ) (void)(0) +#endif // CATCH_CONFIG_DISABLE_MATCHERS +#define CATCH_CHECK_NOTHROW( ... ) (void)(0) + +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CATCH_CHECK_THAT( arg, matcher ) (void)(0) + +#define CATCH_REQUIRE_THAT( arg, matcher ) (void)(0) +#endif // CATCH_CONFIG_DISABLE_MATCHERS + +#define CATCH_INFO( msg ) (void)(0) +#define CATCH_WARN( msg ) (void)(0) +#define CATCH_CAPTURE( msg ) (void)(0) + +#define CATCH_TEST_CASE( ... ) INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )) +#define CATCH_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )) +#define CATCH_METHOD_AS_TEST_CASE( method, ... ) +#define CATCH_REGISTER_TEST_CASE( Function, ... ) (void)(0) +#define CATCH_SECTION( ... ) +#define CATCH_DYNAMIC_SECTION( ... ) +#define CATCH_FAIL( ... ) (void)(0) +#define CATCH_FAIL_CHECK( ... ) (void)(0) +#define CATCH_SUCCEED( ... ) (void)(0) + +#define CATCH_ANON_TEST_CASE() INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )) + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define CATCH_TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ) ) +#define CATCH_TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), className ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE( ... ) CATCH_TEMPLATE_TEST_CASE( __VA_ARGS__ ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) CATCH_TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#else +#define CATCH_TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ) ) ) +#define CATCH_TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), className ) ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE( ... ) CATCH_TEMPLATE_TEST_CASE( __VA_ARGS__ ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) CATCH_TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#endif + +// "BDD-style" convenience wrappers +#define CATCH_SCENARIO( ... ) INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )) +#define CATCH_SCENARIO_METHOD( className, ... ) INTERNAL_CATCH_TESTCASE_METHOD_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ ), className ) +#define CATCH_GIVEN( desc ) +#define CATCH_AND_GIVEN( desc ) +#define CATCH_WHEN( desc ) +#define CATCH_AND_WHEN( desc ) +#define CATCH_THEN( desc ) +#define CATCH_AND_THEN( desc ) + +#define CATCH_STATIC_REQUIRE( ... ) (void)(0) +#define CATCH_STATIC_REQUIRE_FALSE( ... ) (void)(0) + +// If CATCH_CONFIG_PREFIX_ALL is not defined then the CATCH_ prefix is not required +#else + +#define REQUIRE( ... ) (void)(0) +#define REQUIRE_FALSE( ... ) (void)(0) + +#define REQUIRE_THROWS( ... ) (void)(0) +#define REQUIRE_THROWS_AS( expr, exceptionType ) (void)(0) +#define REQUIRE_THROWS_WITH( expr, matcher ) (void)(0) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define REQUIRE_THROWS_MATCHES( expr, exceptionType, matcher ) (void)(0) +#endif // CATCH_CONFIG_DISABLE_MATCHERS +#define REQUIRE_NOTHROW( ... ) (void)(0) + +#define CHECK( ... ) (void)(0) +#define CHECK_FALSE( ... ) (void)(0) +#define CHECKED_IF( ... ) if (__VA_ARGS__) +#define CHECKED_ELSE( ... ) if (!(__VA_ARGS__)) +#define CHECK_NOFAIL( ... ) (void)(0) + +#define CHECK_THROWS( ... ) (void)(0) +#define CHECK_THROWS_AS( expr, exceptionType ) (void)(0) +#define CHECK_THROWS_WITH( expr, matcher ) (void)(0) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CHECK_THROWS_MATCHES( expr, exceptionType, matcher ) (void)(0) +#endif // CATCH_CONFIG_DISABLE_MATCHERS +#define CHECK_NOTHROW( ... ) (void)(0) + +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CHECK_THAT( arg, matcher ) (void)(0) + +#define REQUIRE_THAT( arg, matcher ) (void)(0) +#endif // CATCH_CONFIG_DISABLE_MATCHERS + +#define INFO( msg ) (void)(0) +#define WARN( msg ) (void)(0) +#define CAPTURE( msg ) (void)(0) + +#define TEST_CASE( ... ) INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )) +#define TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )) +#define METHOD_AS_TEST_CASE( method, ... ) +#define REGISTER_TEST_CASE( Function, ... ) (void)(0) +#define SECTION( ... ) +#define DYNAMIC_SECTION( ... ) +#define FAIL( ... ) (void)(0) +#define FAIL_CHECK( ... ) (void)(0) +#define SUCCEED( ... ) (void)(0) +#define ANON_TEST_CASE() INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )) + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ) ) +#define TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), className ) +#define TEMPLATE_PRODUCT_TEST_CASE( ... ) TEMPLATE_TEST_CASE( __VA_ARGS__ ) +#define TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#else +#define TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ) ) ) +#define TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), className ) ) +#define TEMPLATE_PRODUCT_TEST_CASE( ... ) TEMPLATE_TEST_CASE( __VA_ARGS__ ) +#define TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#endif + +#define STATIC_REQUIRE( ... ) (void)(0) +#define STATIC_REQUIRE_FALSE( ... ) (void)(0) + +#endif + +#define CATCH_TRANSLATE_EXCEPTION( signature ) INTERNAL_CATCH_TRANSLATE_EXCEPTION_NO_REG( INTERNAL_CATCH_UNIQUE_NAME( catch_internal_ExceptionTranslator ), signature ) + +// "BDD-style" convenience wrappers +#define SCENARIO( ... ) INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ ) ) +#define SCENARIO_METHOD( className, ... ) INTERNAL_CATCH_TESTCASE_METHOD_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ ), className ) + +#define GIVEN( desc ) +#define AND_GIVEN( desc ) +#define WHEN( desc ) +#define AND_WHEN( desc ) +#define THEN( desc ) +#define AND_THEN( desc ) + +using Catch::Detail::Approx; + +#endif + +#endif // ! CATCH_CONFIG_IMPL_ONLY + +// start catch_reenable_warnings.h + + +#ifdef __clang__ +# ifdef __ICC // icpc defines the __clang__ macro +# pragma warning(pop) +# else +# pragma clang diagnostic pop +# endif +#elif defined __GNUC__ +# pragma GCC diagnostic pop +#endif + +// end catch_reenable_warnings.h +// end catch.hpp +#endif // TWOBLUECUBES_SINGLE_INCLUDE_CATCH_HPP_INCLUDED + diff --git a/exercises/nucleotide-count/CMakeLists.txt b/exercises/nucleotide-count/CMakeLists.txt index 97f8615d..b81b3564 100644 --- a/exercises/nucleotide-count/CMakeLists.txt +++ b/exercises/nucleotide-count/CMakeLists.txt @@ -7,12 +7,6 @@ cmake_minimum_required(VERSION 3.1.3) # Name the project after the exercise project(${exercise} CXX) -# Locate Boost libraries: unit_test_framework and date_time -set(Boost_USE_STATIC_LIBS ON) -set(Boost_USE_MULTITHREADED ON) -set(Boost_USE_STATIC_RUNTIME OFF) -find_package(Boost 1.59 REQUIRED COMPONENTS unit_test_framework date_time) - # Get a source filename from the exercise name by replacing -'s with _'s string(REPLACE "-" "_" file ${exercise}) @@ -38,13 +32,6 @@ if("${CMAKE_CXX_COMPILER_ID}" MATCHES "(GNU|Clang)") ) endif() -# We need boost libraries -target_link_libraries(${exercise} - PRIVATE - Boost::unit_test_framework - Boost::date_time -) - # Configure to run all the tests? if(${EXERCISM_RUN_ALL_TESTS}) target_compile_definitions(${exercise} PRIVATE EXERCISM_RUN_ALL_TESTS) diff --git a/exercises/nucleotide-count/nucleotide_count_test.cpp b/exercises/nucleotide-count/nucleotide_count_test.cpp index 35fd5876..9cb335f8 100644 --- a/exercises/nucleotide-count/nucleotide_count_test.cpp +++ b/exercises/nucleotide-count/nucleotide_count_test.cpp @@ -1,79 +1,79 @@ #include "nucleotide_count.h" -#define BOOST_TEST_MAIN -#include +#define CATCH_CONFIG_MAIN +#include "test/catch.hpp" #include #include -BOOST_AUTO_TEST_CASE(has_no_nucleotides) +TEST_CASE("has_no_nucleotides") { const dna::counter dna(""); const std::map expected{ {'A', 0}, {'T', 0}, {'C', 0}, {'G', 0} }; const auto actual = dna.nucleotide_counts(); - BOOST_TEST(expected == actual); + REQUIRE(expected == actual); } #if defined(EXERCISM_RUN_ALL_TESTS) -BOOST_AUTO_TEST_CASE(has_no_adenosine) +TEST_CASE("has_no_adenosine") { const dna::counter dna(""); - BOOST_REQUIRE_EQUAL(0, dna.count('A')); + REQUIRE(0 == dna.count('A')); } -BOOST_AUTO_TEST_CASE(repetitive_cytidine_gets_counts) +TEST_CASE("repetitive_cytidine_gets_counts") { const dna::counter dna("CCCCC"); - BOOST_REQUIRE_EQUAL(5, dna.count('C')); + REQUIRE(5 == dna.count('C')); } -BOOST_AUTO_TEST_CASE(repetitive_sequence_has_only_guanosine) +TEST_CASE("repetitive_sequence_has_only_guanosine") { const dna::counter dna("GGGGGGGG"); const std::map expected{ {'A', 0}, {'T', 0}, {'C', 0}, {'G', 8} }; const auto actual = dna.nucleotide_counts(); - BOOST_TEST(expected == actual); + REQUIRE(expected == actual); } -BOOST_AUTO_TEST_CASE(counts_only_thymidine) +TEST_CASE("counts_only_thymidine") { const dna::counter dna("GGGGTAACCCGG"); - BOOST_REQUIRE_EQUAL(1, dna.count('T')); + REQUIRE(1 == dna.count('T')); } -BOOST_AUTO_TEST_CASE(counts_a_nucleotide_only_once) +TEST_CASE("counts_a_nucleotide_only_once") { const dna::counter dna("GGTTGG"); dna.count('T'); - BOOST_REQUIRE_EQUAL(2, dna.count('T')); + REQUIRE(2 == dna.count('T')); } -BOOST_AUTO_TEST_CASE(validates_nucleotides) +TEST_CASE("validates_nucleotides") { const dna::counter dna("GGTTGG"); - BOOST_REQUIRE_THROW(dna.count('X'), std::invalid_argument); + REQUIRE_THROWS_AS(dna.count('X'), std::invalid_argument); } -BOOST_AUTO_TEST_CASE(validates_nucleotides_on_construction) +TEST_CASE("validates_nucleotides_on_construction") { - BOOST_REQUIRE_THROW(dna::counter("GGTTGGX"), std::invalid_argument); + REQUIRE_THROWS_AS(dna::counter("GGTTGGX"), std::invalid_argument); } -BOOST_AUTO_TEST_CASE(counts_all_nucleotides) +TEST_CASE("counts_all_nucleotides") { const dna::counter dna("AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"); std::map expected{ {'A', 20}, {'T', 21}, {'G', 17}, {'C', 12} }; auto actual = dna.nucleotide_counts(); - BOOST_TEST(expected == actual); + REQUIRE(expected == actual); } #endif diff --git a/exercises/nucleotide-count/test/catch.hpp b/exercises/nucleotide-count/test/catch.hpp new file mode 100644 index 00000000..1850fff1 --- /dev/null +++ b/exercises/nucleotide-count/test/catch.hpp @@ -0,0 +1,14934 @@ +/* + * Catch v2.7.0 + * Generated: 2019-03-07 21:34:30.252164 + * ---------------------------------------------------------- + * This file has been merged from multiple headers. Please don't edit it directly + * Copyright (c) 2019 Two Blue Cubes Ltd. All rights reserved. + * + * Distributed under the Boost Software License, Version 1.0. (See accompanying + * file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt) + */ +#ifndef TWOBLUECUBES_SINGLE_INCLUDE_CATCH_HPP_INCLUDED +#define TWOBLUECUBES_SINGLE_INCLUDE_CATCH_HPP_INCLUDED +// start catch.hpp + + +#define CATCH_VERSION_MAJOR 2 +#define CATCH_VERSION_MINOR 7 +#define CATCH_VERSION_PATCH 0 + +#ifdef __clang__ +# pragma clang system_header +#elif defined __GNUC__ +# pragma GCC system_header +#endif + +// start catch_suppress_warnings.h + +#ifdef __clang__ +# ifdef __ICC // icpc defines the __clang__ macro +# pragma warning(push) +# pragma warning(disable: 161 1682) +# else // __ICC +# pragma clang diagnostic push +# pragma clang diagnostic ignored "-Wpadded" +# pragma clang diagnostic ignored "-Wswitch-enum" +# pragma clang diagnostic ignored "-Wcovered-switch-default" +# endif +#elif defined __GNUC__ + // Because REQUIREs trigger GCC's -Wparentheses, and because still + // supported version of g++ have only buggy support for _Pragmas, + // Wparentheses have to be suppressed globally. +# pragma GCC diagnostic ignored "-Wparentheses" // See #674 for details + +# pragma GCC diagnostic push +# pragma GCC diagnostic ignored "-Wunused-variable" +# pragma GCC diagnostic ignored "-Wpadded" +#endif +// end catch_suppress_warnings.h +#if defined(CATCH_CONFIG_MAIN) || defined(CATCH_CONFIG_RUNNER) +# define CATCH_IMPL +# define CATCH_CONFIG_ALL_PARTS +#endif + +// In the impl file, we want to have access to all parts of the headers +// Can also be used to sanely support PCHs +#if defined(CATCH_CONFIG_ALL_PARTS) +# define CATCH_CONFIG_EXTERNAL_INTERFACES +# if defined(CATCH_CONFIG_DISABLE_MATCHERS) +# undef CATCH_CONFIG_DISABLE_MATCHERS +# endif +# if !defined(CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER) +# define CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER +# endif +#endif + +#if !defined(CATCH_CONFIG_IMPL_ONLY) +// start catch_platform.h + +#ifdef __APPLE__ +# include +# if TARGET_OS_OSX == 1 +# define CATCH_PLATFORM_MAC +# elif TARGET_OS_IPHONE == 1 +# define CATCH_PLATFORM_IPHONE +# endif + +#elif defined(linux) || defined(__linux) || defined(__linux__) +# define CATCH_PLATFORM_LINUX + +#elif defined(WIN32) || defined(__WIN32__) || defined(_WIN32) || defined(_MSC_VER) || defined(__MINGW32__) +# define CATCH_PLATFORM_WINDOWS +#endif + +// end catch_platform.h + +#ifdef CATCH_IMPL +# ifndef CLARA_CONFIG_MAIN +# define CLARA_CONFIG_MAIN_NOT_DEFINED +# define CLARA_CONFIG_MAIN +# endif +#endif + +// start catch_user_interfaces.h + +namespace Catch { + unsigned int rngSeed(); +} + +// end catch_user_interfaces.h +// start catch_tag_alias_autoregistrar.h + +// start catch_common.h + +// start catch_compiler_capabilities.h + +// Detect a number of compiler features - by compiler +// The following features are defined: +// +// CATCH_CONFIG_COUNTER : is the __COUNTER__ macro supported? +// CATCH_CONFIG_WINDOWS_SEH : is Windows SEH supported? +// CATCH_CONFIG_POSIX_SIGNALS : are POSIX signals supported? +// CATCH_CONFIG_DISABLE_EXCEPTIONS : Are exceptions enabled? +// **************** +// Note to maintainers: if new toggles are added please document them +// in configuration.md, too +// **************** + +// In general each macro has a _NO_ form +// (e.g. CATCH_CONFIG_NO_POSIX_SIGNALS) which disables the feature. +// Many features, at point of detection, define an _INTERNAL_ macro, so they +// can be combined, en-mass, with the _NO_ forms later. + +#ifdef __cplusplus + +# if (__cplusplus >= 201402L) || (defined(_MSVC_LANG) && _MSVC_LANG >= 201402L) +# define CATCH_CPP14_OR_GREATER +# endif + +# if (__cplusplus >= 201703L) || (defined(_MSVC_LANG) && _MSVC_LANG >= 201703L) +# define CATCH_CPP17_OR_GREATER +# endif + +#endif + +#if defined(CATCH_CPP17_OR_GREATER) +# define CATCH_INTERNAL_CONFIG_CPP17_UNCAUGHT_EXCEPTIONS +#endif + +#ifdef __clang__ + +# define CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + _Pragma( "clang diagnostic push" ) \ + _Pragma( "clang diagnostic ignored \"-Wexit-time-destructors\"" ) \ + _Pragma( "clang diagnostic ignored \"-Wglobal-constructors\"") +# define CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS \ + _Pragma( "clang diagnostic pop" ) + +# define CATCH_INTERNAL_SUPPRESS_PARENTHESES_WARNINGS \ + _Pragma( "clang diagnostic push" ) \ + _Pragma( "clang diagnostic ignored \"-Wparentheses\"" ) +# define CATCH_INTERNAL_UNSUPPRESS_PARENTHESES_WARNINGS \ + _Pragma( "clang diagnostic pop" ) + +# define CATCH_INTERNAL_SUPPRESS_UNUSED_WARNINGS \ + _Pragma( "clang diagnostic push" ) \ + _Pragma( "clang diagnostic ignored \"-Wunused-variable\"" ) +# define CATCH_INTERNAL_UNSUPPRESS_UNUSED_WARNINGS \ + _Pragma( "clang diagnostic pop" ) + +#endif // __clang__ + +//////////////////////////////////////////////////////////////////////////////// +// Assume that non-Windows platforms support posix signals by default +#if !defined(CATCH_PLATFORM_WINDOWS) + #define CATCH_INTERNAL_CONFIG_POSIX_SIGNALS +#endif + +//////////////////////////////////////////////////////////////////////////////// +// We know some environments not to support full POSIX signals +#if defined(__CYGWIN__) || defined(__QNX__) || defined(__EMSCRIPTEN__) || defined(__DJGPP__) + #define CATCH_INTERNAL_CONFIG_NO_POSIX_SIGNALS +#endif + +#ifdef __OS400__ +# define CATCH_INTERNAL_CONFIG_NO_POSIX_SIGNALS +# define CATCH_CONFIG_COLOUR_NONE +#endif + +//////////////////////////////////////////////////////////////////////////////// +// Android somehow still does not support std::to_string +#if defined(__ANDROID__) +# define CATCH_INTERNAL_CONFIG_NO_CPP11_TO_STRING +#endif + +//////////////////////////////////////////////////////////////////////////////// +// Not all Windows environments support SEH properly +#if defined(__MINGW32__) +# define CATCH_INTERNAL_CONFIG_NO_WINDOWS_SEH +#endif + +//////////////////////////////////////////////////////////////////////////////// +// PS4 +#if defined(__ORBIS__) +# define CATCH_INTERNAL_CONFIG_NO_NEW_CAPTURE +#endif + +//////////////////////////////////////////////////////////////////////////////// +// Cygwin +#ifdef __CYGWIN__ + +// Required for some versions of Cygwin to declare gettimeofday +// see: http://stackoverflow.com/questions/36901803/gettimeofday-not-declared-in-this-scope-cygwin +# define _BSD_SOURCE +// some versions of cygwin (most) do not support std::to_string. Use the libstd check. +// https://gcc.gnu.org/onlinedocs/gcc-4.8.2/libstdc++/api/a01053_source.html line 2812-2813 +# if !((__cplusplus >= 201103L) && defined(_GLIBCXX_USE_C99) \ + && !defined(_GLIBCXX_HAVE_BROKEN_VSWPRINTF)) + +# define CATCH_INTERNAL_CONFIG_NO_CPP11_TO_STRING + +# endif +#endif // __CYGWIN__ + +//////////////////////////////////////////////////////////////////////////////// +// Visual C++ +#ifdef _MSC_VER + +# if _MSC_VER >= 1900 // Visual Studio 2015 or newer +# define CATCH_INTERNAL_CONFIG_CPP17_UNCAUGHT_EXCEPTIONS +# endif + +// Universal Windows platform does not support SEH +// Or console colours (or console at all...) +# if defined(WINAPI_FAMILY) && (WINAPI_FAMILY == WINAPI_FAMILY_APP) +# define CATCH_CONFIG_COLOUR_NONE +# else +# define CATCH_INTERNAL_CONFIG_WINDOWS_SEH +# endif + +// MSVC traditional preprocessor needs some workaround for __VA_ARGS__ +// _MSVC_TRADITIONAL == 0 means new conformant preprocessor +// _MSVC_TRADITIONAL == 1 means old traditional non-conformant preprocessor +# if !defined(_MSVC_TRADITIONAL) || (defined(_MSVC_TRADITIONAL) && _MSVC_TRADITIONAL) +# define CATCH_INTERNAL_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +# endif + +#endif // _MSC_VER + +//////////////////////////////////////////////////////////////////////////////// +// Check if we are compiled with -fno-exceptions or equivalent +#if defined(__EXCEPTIONS) || defined(__cpp_exceptions) || defined(_CPPUNWIND) +# define CATCH_INTERNAL_CONFIG_EXCEPTIONS_ENABLED +#endif + +//////////////////////////////////////////////////////////////////////////////// +// DJGPP +#ifdef __DJGPP__ +# define CATCH_INTERNAL_CONFIG_NO_WCHAR +#endif // __DJGPP__ + +//////////////////////////////////////////////////////////////////////////////// +// Embarcadero C++Build +#if defined(__BORLANDC__) + #define CATCH_INTERNAL_CONFIG_POLYFILL_ISNAN +#endif + +//////////////////////////////////////////////////////////////////////////////// + +// Use of __COUNTER__ is suppressed during code analysis in +// CLion/AppCode 2017.2.x and former, because __COUNTER__ is not properly +// handled by it. +// Otherwise all supported compilers support COUNTER macro, +// but user still might want to turn it off +#if ( !defined(__JETBRAINS_IDE__) || __JETBRAINS_IDE__ >= 20170300L ) + #define CATCH_INTERNAL_CONFIG_COUNTER +#endif + +//////////////////////////////////////////////////////////////////////////////// +// Check if string_view is available and usable +// The check is split apart to work around v140 (VS2015) preprocessor issue... +#if defined(__has_include) +#if __has_include() && defined(CATCH_CPP17_OR_GREATER) +# define CATCH_INTERNAL_CONFIG_CPP17_STRING_VIEW +#endif +#endif + +//////////////////////////////////////////////////////////////////////////////// +// Check if optional is available and usable +#if defined(__has_include) +# if __has_include() && defined(CATCH_CPP17_OR_GREATER) +# define CATCH_INTERNAL_CONFIG_CPP17_OPTIONAL +# endif // __has_include() && defined(CATCH_CPP17_OR_GREATER) +#endif // __has_include + +//////////////////////////////////////////////////////////////////////////////// +// Check if variant is available and usable +#if defined(__has_include) +# if __has_include() && defined(CATCH_CPP17_OR_GREATER) +# if defined(__clang__) && (__clang_major__ < 8) + // work around clang bug with libstdc++ https://bugs.llvm.org/show_bug.cgi?id=31852 + // fix should be in clang 8, workaround in libstdc++ 8.2 +# include +# if defined(__GLIBCXX__) && defined(_GLIBCXX_RELEASE) && (_GLIBCXX_RELEASE < 9) +# define CATCH_CONFIG_NO_CPP17_VARIANT +# else +# define CATCH_INTERNAL_CONFIG_CPP17_VARIANT +# endif // defined(__GLIBCXX__) && defined(_GLIBCXX_RELEASE) && (_GLIBCXX_RELEASE < 9) +# else +# define CATCH_INTERNAL_CONFIG_CPP17_VARIANT +# endif // defined(__clang__) && (__clang_major__ < 8) +# endif // __has_include() && defined(CATCH_CPP17_OR_GREATER) +#endif // __has_include + +#if defined(CATCH_INTERNAL_CONFIG_COUNTER) && !defined(CATCH_CONFIG_NO_COUNTER) && !defined(CATCH_CONFIG_COUNTER) +# define CATCH_CONFIG_COUNTER +#endif +#if defined(CATCH_INTERNAL_CONFIG_WINDOWS_SEH) && !defined(CATCH_CONFIG_NO_WINDOWS_SEH) && !defined(CATCH_CONFIG_WINDOWS_SEH) && !defined(CATCH_INTERNAL_CONFIG_NO_WINDOWS_SEH) +# define CATCH_CONFIG_WINDOWS_SEH +#endif +// This is set by default, because we assume that unix compilers are posix-signal-compatible by default. +#if defined(CATCH_INTERNAL_CONFIG_POSIX_SIGNALS) && !defined(CATCH_INTERNAL_CONFIG_NO_POSIX_SIGNALS) && !defined(CATCH_CONFIG_NO_POSIX_SIGNALS) && !defined(CATCH_CONFIG_POSIX_SIGNALS) +# define CATCH_CONFIG_POSIX_SIGNALS +#endif +// This is set by default, because we assume that compilers with no wchar_t support are just rare exceptions. +#if !defined(CATCH_INTERNAL_CONFIG_NO_WCHAR) && !defined(CATCH_CONFIG_NO_WCHAR) && !defined(CATCH_CONFIG_WCHAR) +# define CATCH_CONFIG_WCHAR +#endif + +#if !defined(CATCH_INTERNAL_CONFIG_NO_CPP11_TO_STRING) && !defined(CATCH_CONFIG_NO_CPP11_TO_STRING) && !defined(CATCH_CONFIG_CPP11_TO_STRING) +# define CATCH_CONFIG_CPP11_TO_STRING +#endif + +#if defined(CATCH_INTERNAL_CONFIG_CPP17_OPTIONAL) && !defined(CATCH_CONFIG_NO_CPP17_OPTIONAL) && !defined(CATCH_CONFIG_CPP17_OPTIONAL) +# define CATCH_CONFIG_CPP17_OPTIONAL +#endif + +#if defined(CATCH_INTERNAL_CONFIG_CPP17_UNCAUGHT_EXCEPTIONS) && !defined(CATCH_CONFIG_NO_CPP17_UNCAUGHT_EXCEPTIONS) && !defined(CATCH_CONFIG_CPP17_UNCAUGHT_EXCEPTIONS) +# define CATCH_CONFIG_CPP17_UNCAUGHT_EXCEPTIONS +#endif + +#if defined(CATCH_INTERNAL_CONFIG_CPP17_STRING_VIEW) && !defined(CATCH_CONFIG_NO_CPP17_STRING_VIEW) && !defined(CATCH_CONFIG_CPP17_STRING_VIEW) +# define CATCH_CONFIG_CPP17_STRING_VIEW +#endif + +#if defined(CATCH_INTERNAL_CONFIG_CPP17_VARIANT) && !defined(CATCH_CONFIG_NO_CPP17_VARIANT) && !defined(CATCH_CONFIG_CPP17_VARIANT) +# define CATCH_CONFIG_CPP17_VARIANT +#endif + +#if defined(CATCH_CONFIG_EXPERIMENTAL_REDIRECT) +# define CATCH_INTERNAL_CONFIG_NEW_CAPTURE +#endif + +#if defined(CATCH_INTERNAL_CONFIG_NEW_CAPTURE) && !defined(CATCH_INTERNAL_CONFIG_NO_NEW_CAPTURE) && !defined(CATCH_CONFIG_NO_NEW_CAPTURE) && !defined(CATCH_CONFIG_NEW_CAPTURE) +# define CATCH_CONFIG_NEW_CAPTURE +#endif + +#if !defined(CATCH_INTERNAL_CONFIG_EXCEPTIONS_ENABLED) && !defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) +# define CATCH_CONFIG_DISABLE_EXCEPTIONS +#endif + +#if defined(CATCH_INTERNAL_CONFIG_POLYFILL_ISNAN) && !defined(CATCH_CONFIG_NO_POLYFILL_ISNAN) && !defined(CATCH_CONFIG_POLYFILL_ISNAN) +# define CATCH_CONFIG_POLYFILL_ISNAN +#endif + +#if !defined(CATCH_INTERNAL_SUPPRESS_PARENTHESES_WARNINGS) +# define CATCH_INTERNAL_SUPPRESS_PARENTHESES_WARNINGS +# define CATCH_INTERNAL_UNSUPPRESS_PARENTHESES_WARNINGS +#endif +#if !defined(CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS) +# define CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS +# define CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS +#endif +#if !defined(CATCH_INTERNAL_SUPPRESS_UNUSED_WARNINGS) +# define CATCH_INTERNAL_SUPPRESS_UNUSED_WARNINGS +# define CATCH_INTERNAL_UNSUPPRESS_UNUSED_WARNINGS +#endif + +#if defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) +#define CATCH_TRY if ((true)) +#define CATCH_CATCH_ALL if ((false)) +#define CATCH_CATCH_ANON(type) if ((false)) +#else +#define CATCH_TRY try +#define CATCH_CATCH_ALL catch (...) +#define CATCH_CATCH_ANON(type) catch (type) +#endif + +#if defined(CATCH_INTERNAL_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR) && !defined(CATCH_CONFIG_NO_TRADITIONAL_MSVC_PREPROCESSOR) && !defined(CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR) +#define CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#endif + +// end catch_compiler_capabilities.h +#define INTERNAL_CATCH_UNIQUE_NAME_LINE2( name, line ) name##line +#define INTERNAL_CATCH_UNIQUE_NAME_LINE( name, line ) INTERNAL_CATCH_UNIQUE_NAME_LINE2( name, line ) +#ifdef CATCH_CONFIG_COUNTER +# define INTERNAL_CATCH_UNIQUE_NAME( name ) INTERNAL_CATCH_UNIQUE_NAME_LINE( name, __COUNTER__ ) +#else +# define INTERNAL_CATCH_UNIQUE_NAME( name ) INTERNAL_CATCH_UNIQUE_NAME_LINE( name, __LINE__ ) +#endif + +#include +#include +#include + +// We need a dummy global operator<< so we can bring it into Catch namespace later +struct Catch_global_namespace_dummy {}; +std::ostream& operator<<(std::ostream&, Catch_global_namespace_dummy); + +namespace Catch { + + struct CaseSensitive { enum Choice { + Yes, + No + }; }; + + class NonCopyable { + NonCopyable( NonCopyable const& ) = delete; + NonCopyable( NonCopyable && ) = delete; + NonCopyable& operator = ( NonCopyable const& ) = delete; + NonCopyable& operator = ( NonCopyable && ) = delete; + + protected: + NonCopyable(); + virtual ~NonCopyable(); + }; + + struct SourceLineInfo { + + SourceLineInfo() = delete; + SourceLineInfo( char const* _file, std::size_t _line ) noexcept + : file( _file ), + line( _line ) + {} + + SourceLineInfo( SourceLineInfo const& other ) = default; + SourceLineInfo& operator = ( SourceLineInfo const& ) = default; + SourceLineInfo( SourceLineInfo&& ) noexcept = default; + SourceLineInfo& operator = ( SourceLineInfo&& ) noexcept = default; + + bool empty() const noexcept; + bool operator == ( SourceLineInfo const& other ) const noexcept; + bool operator < ( SourceLineInfo const& other ) const noexcept; + + char const* file; + std::size_t line; + }; + + std::ostream& operator << ( std::ostream& os, SourceLineInfo const& info ); + + // Bring in operator<< from global namespace into Catch namespace + // This is necessary because the overload of operator<< above makes + // lookup stop at namespace Catch + using ::operator<<; + + // Use this in variadic streaming macros to allow + // >> +StreamEndStop + // as well as + // >> stuff +StreamEndStop + struct StreamEndStop { + std::string operator+() const; + }; + template + T const& operator + ( T const& value, StreamEndStop ) { + return value; + } +} + +#define CATCH_INTERNAL_LINEINFO \ + ::Catch::SourceLineInfo( __FILE__, static_cast( __LINE__ ) ) + +// end catch_common.h +namespace Catch { + + struct RegistrarForTagAliases { + RegistrarForTagAliases( char const* alias, char const* tag, SourceLineInfo const& lineInfo ); + }; + +} // end namespace Catch + +#define CATCH_REGISTER_TAG_ALIAS( alias, spec ) \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ Catch::RegistrarForTagAliases INTERNAL_CATCH_UNIQUE_NAME( AutoRegisterTagAlias )( alias, spec, CATCH_INTERNAL_LINEINFO ); } \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS + +// end catch_tag_alias_autoregistrar.h +// start catch_test_registry.h + +// start catch_interfaces_testcase.h + +#include + +namespace Catch { + + class TestSpec; + + struct ITestInvoker { + virtual void invoke () const = 0; + virtual ~ITestInvoker(); + }; + + class TestCase; + struct IConfig; + + struct ITestCaseRegistry { + virtual ~ITestCaseRegistry(); + virtual std::vector const& getAllTests() const = 0; + virtual std::vector const& getAllTestsSorted( IConfig const& config ) const = 0; + }; + + bool matchTest( TestCase const& testCase, TestSpec const& testSpec, IConfig const& config ); + std::vector filterTests( std::vector const& testCases, TestSpec const& testSpec, IConfig const& config ); + std::vector const& getAllTestCasesSorted( IConfig const& config ); + +} + +// end catch_interfaces_testcase.h +// start catch_stringref.h + +#include +#include +#include + +namespace Catch { + + /// A non-owning string class (similar to the forthcoming std::string_view) + /// Note that, because a StringRef may be a substring of another string, + /// it may not be null terminated. c_str() must return a null terminated + /// string, however, and so the StringRef will internally take ownership + /// (taking a copy), if necessary. In theory this ownership is not externally + /// visible - but it does mean (substring) StringRefs should not be shared between + /// threads. + class StringRef { + public: + using size_type = std::size_t; + + private: + friend struct StringRefTestAccess; + + char const* m_start; + size_type m_size; + + char* m_data = nullptr; + + void takeOwnership(); + + static constexpr char const* const s_empty = ""; + + public: // construction/ assignment + StringRef() noexcept + : StringRef( s_empty, 0 ) + {} + + StringRef( StringRef const& other ) noexcept + : m_start( other.m_start ), + m_size( other.m_size ) + {} + + StringRef( StringRef&& other ) noexcept + : m_start( other.m_start ), + m_size( other.m_size ), + m_data( other.m_data ) + { + other.m_data = nullptr; + } + + StringRef( char const* rawChars ) noexcept; + + StringRef( char const* rawChars, size_type size ) noexcept + : m_start( rawChars ), + m_size( size ) + {} + + StringRef( std::string const& stdString ) noexcept + : m_start( stdString.c_str() ), + m_size( stdString.size() ) + {} + + ~StringRef() noexcept { + delete[] m_data; + } + + auto operator = ( StringRef const &other ) noexcept -> StringRef& { + delete[] m_data; + m_data = nullptr; + m_start = other.m_start; + m_size = other.m_size; + return *this; + } + + operator std::string() const; + + void swap( StringRef& other ) noexcept; + + public: // operators + auto operator == ( StringRef const& other ) const noexcept -> bool; + auto operator != ( StringRef const& other ) const noexcept -> bool; + + auto operator[] ( size_type index ) const noexcept -> char; + + public: // named queries + auto empty() const noexcept -> bool { + return m_size == 0; + } + auto size() const noexcept -> size_type { + return m_size; + } + + auto numberOfCharacters() const noexcept -> size_type; + auto c_str() const -> char const*; + + public: // substrings and searches + auto substr( size_type start, size_type size ) const noexcept -> StringRef; + + // Returns the current start pointer. + // Note that the pointer can change when if the StringRef is a substring + auto currentData() const noexcept -> char const*; + + private: // ownership queries - may not be consistent between calls + auto isOwned() const noexcept -> bool; + auto isSubstring() const noexcept -> bool; + }; + + auto operator + ( StringRef const& lhs, StringRef const& rhs ) -> std::string; + auto operator + ( StringRef const& lhs, char const* rhs ) -> std::string; + auto operator + ( char const* lhs, StringRef const& rhs ) -> std::string; + + auto operator += ( std::string& lhs, StringRef const& sr ) -> std::string&; + auto operator << ( std::ostream& os, StringRef const& sr ) -> std::ostream&; + + inline auto operator "" _sr( char const* rawChars, std::size_t size ) noexcept -> StringRef { + return StringRef( rawChars, size ); + } + +} // namespace Catch + +inline auto operator "" _catch_sr( char const* rawChars, std::size_t size ) noexcept -> Catch::StringRef { + return Catch::StringRef( rawChars, size ); +} + +// end catch_stringref.h +// start catch_type_traits.hpp + + +#include + +namespace Catch{ + +#ifdef CATCH_CPP17_OR_GREATER + template + inline constexpr auto is_unique = std::true_type{}; + + template + inline constexpr auto is_unique = std::bool_constant< + (!std::is_same_v && ...) && is_unique + >{}; +#else + +template +struct is_unique : std::true_type{}; + +template +struct is_unique : std::integral_constant +::value + && is_unique::value + && is_unique::value +>{}; + +#endif +} + +// end catch_type_traits.hpp +// start catch_preprocessor.hpp + + +#define CATCH_RECURSION_LEVEL0(...) __VA_ARGS__ +#define CATCH_RECURSION_LEVEL1(...) CATCH_RECURSION_LEVEL0(CATCH_RECURSION_LEVEL0(CATCH_RECURSION_LEVEL0(__VA_ARGS__))) +#define CATCH_RECURSION_LEVEL2(...) CATCH_RECURSION_LEVEL1(CATCH_RECURSION_LEVEL1(CATCH_RECURSION_LEVEL1(__VA_ARGS__))) +#define CATCH_RECURSION_LEVEL3(...) CATCH_RECURSION_LEVEL2(CATCH_RECURSION_LEVEL2(CATCH_RECURSION_LEVEL2(__VA_ARGS__))) +#define CATCH_RECURSION_LEVEL4(...) CATCH_RECURSION_LEVEL3(CATCH_RECURSION_LEVEL3(CATCH_RECURSION_LEVEL3(__VA_ARGS__))) +#define CATCH_RECURSION_LEVEL5(...) CATCH_RECURSION_LEVEL4(CATCH_RECURSION_LEVEL4(CATCH_RECURSION_LEVEL4(__VA_ARGS__))) + +#ifdef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define INTERNAL_CATCH_EXPAND_VARGS(...) __VA_ARGS__ +// MSVC needs more evaluations +#define CATCH_RECURSION_LEVEL6(...) CATCH_RECURSION_LEVEL5(CATCH_RECURSION_LEVEL5(CATCH_RECURSION_LEVEL5(__VA_ARGS__))) +#define CATCH_RECURSE(...) CATCH_RECURSION_LEVEL6(CATCH_RECURSION_LEVEL6(__VA_ARGS__)) +#else +#define CATCH_RECURSE(...) CATCH_RECURSION_LEVEL5(__VA_ARGS__) +#endif + +#define CATCH_REC_END(...) +#define CATCH_REC_OUT + +#define CATCH_EMPTY() +#define CATCH_DEFER(id) id CATCH_EMPTY() + +#define CATCH_REC_GET_END2() 0, CATCH_REC_END +#define CATCH_REC_GET_END1(...) CATCH_REC_GET_END2 +#define CATCH_REC_GET_END(...) CATCH_REC_GET_END1 +#define CATCH_REC_NEXT0(test, next, ...) next CATCH_REC_OUT +#define CATCH_REC_NEXT1(test, next) CATCH_DEFER ( CATCH_REC_NEXT0 ) ( test, next, 0) +#define CATCH_REC_NEXT(test, next) CATCH_REC_NEXT1(CATCH_REC_GET_END test, next) + +#define CATCH_REC_LIST0(f, x, peek, ...) , f(x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST1) ) ( f, peek, __VA_ARGS__ ) +#define CATCH_REC_LIST1(f, x, peek, ...) , f(x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST0) ) ( f, peek, __VA_ARGS__ ) +#define CATCH_REC_LIST2(f, x, peek, ...) f(x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST1) ) ( f, peek, __VA_ARGS__ ) + +#define CATCH_REC_LIST0_UD(f, userdata, x, peek, ...) , f(userdata, x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST1_UD) ) ( f, userdata, peek, __VA_ARGS__ ) +#define CATCH_REC_LIST1_UD(f, userdata, x, peek, ...) , f(userdata, x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST0_UD) ) ( f, userdata, peek, __VA_ARGS__ ) +#define CATCH_REC_LIST2_UD(f, userdata, x, peek, ...) f(userdata, x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST1_UD) ) ( f, userdata, peek, __VA_ARGS__ ) + +// Applies the function macro `f` to each of the remaining parameters, inserts commas between the results, +// and passes userdata as the first parameter to each invocation, +// e.g. CATCH_REC_LIST_UD(f, x, a, b, c) evaluates to f(x, a), f(x, b), f(x, c) +#define CATCH_REC_LIST_UD(f, userdata, ...) CATCH_RECURSE(CATCH_REC_LIST2_UD(f, userdata, __VA_ARGS__, ()()(), ()()(), ()()(), 0)) + +#define CATCH_REC_LIST(f, ...) CATCH_RECURSE(CATCH_REC_LIST2(f, __VA_ARGS__, ()()(), ()()(), ()()(), 0)) + +#define INTERNAL_CATCH_EXPAND1(param) INTERNAL_CATCH_EXPAND2(param) +#define INTERNAL_CATCH_EXPAND2(...) INTERNAL_CATCH_NO## __VA_ARGS__ +#define INTERNAL_CATCH_DEF(...) INTERNAL_CATCH_DEF __VA_ARGS__ +#define INTERNAL_CATCH_NOINTERNAL_CATCH_DEF +#define INTERNAL_CATCH_STRINGIZE(...) INTERNAL_CATCH_STRINGIZE2(__VA_ARGS__) +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define INTERNAL_CATCH_STRINGIZE2(...) #__VA_ARGS__ +#define INTERNAL_CATCH_STRINGIZE_WITHOUT_PARENS(param) INTERNAL_CATCH_STRINGIZE(INTERNAL_CATCH_REMOVE_PARENS(param)) +#else +// MSVC is adding extra space and needs another indirection to expand INTERNAL_CATCH_NOINTERNAL_CATCH_DEF +#define INTERNAL_CATCH_STRINGIZE2(...) INTERNAL_CATCH_STRINGIZE3(__VA_ARGS__) +#define INTERNAL_CATCH_STRINGIZE3(...) #__VA_ARGS__ +#define INTERNAL_CATCH_STRINGIZE_WITHOUT_PARENS(param) (INTERNAL_CATCH_STRINGIZE(INTERNAL_CATCH_REMOVE_PARENS(param)) + 1) +#endif + +#define INTERNAL_CATCH_REMOVE_PARENS(...) INTERNAL_CATCH_EXPAND1(INTERNAL_CATCH_DEF __VA_ARGS__) + +#define INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME2(Name, ...) INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME3(Name, __VA_ARGS__) +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME3(Name,...) Name " - " #__VA_ARGS__ +#define INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME(Name,...) INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME2(Name, INTERNAL_CATCH_REMOVE_PARENS(__VA_ARGS__)) +#else +// MSVC is adding extra space and needs more calls to properly remove () +#define INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME3(Name,...) Name " -" #__VA_ARGS__ +#define INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME1(Name, ...) INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME2(Name, __VA_ARGS__) +#define INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME(Name, ...) INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME1(Name, INTERNAL_CATCH_EXPAND_VARGS(INTERNAL_CATCH_REMOVE_PARENS(__VA_ARGS__))) +#endif + +#define INTERNAL_CATCH_MAKE_TYPE_LIST(types) Catch::TypeList + +#define INTERNAL_CATCH_MAKE_TYPE_LISTS_FROM_TYPES(types)\ + CATCH_REC_LIST(INTERNAL_CATCH_MAKE_TYPE_LIST,INTERNAL_CATCH_REMOVE_PARENS(types)) + +// end catch_preprocessor.hpp +// start catch_meta.hpp + + +#include + +namespace Catch { +template< typename... > +struct TypeList {}; + +template< typename... > +struct append; + +template< template class L1 + , typename...E1 + , template class L2 + , typename...E2 +> +struct append< L1, L2 > { + using type = L1; +}; + +template< template class L1 + , typename...E1 + , template class L2 + , typename...E2 + , typename...Rest +> +struct append< L1, L2, Rest...> { + using type = typename append< L1, Rest... >::type; +}; + +template< template class + , typename... +> +struct rewrap; + +template< template class Container + , template class List + , typename...elems +> +struct rewrap> { + using type = TypeList< Container< elems... > >; +}; + +template< template class Container + , template class List + , class...Elems + , typename...Elements> + struct rewrap, Elements...> { + using type = typename append>, typename rewrap::type>::type; +}; + +template< template class...Containers > +struct combine { + template< typename...Types > + struct with_types { + template< template class Final > + struct into { + using type = typename append, typename rewrap::type...>::type; + }; + }; +}; + +template +struct always_false : std::false_type {}; + +} // namespace Catch + +// end catch_meta.hpp +namespace Catch { + +template +class TestInvokerAsMethod : public ITestInvoker { + void (C::*m_testAsMethod)(); +public: + TestInvokerAsMethod( void (C::*testAsMethod)() ) noexcept : m_testAsMethod( testAsMethod ) {} + + void invoke() const override { + C obj; + (obj.*m_testAsMethod)(); + } +}; + +auto makeTestInvoker( void(*testAsFunction)() ) noexcept -> ITestInvoker*; + +template +auto makeTestInvoker( void (C::*testAsMethod)() ) noexcept -> ITestInvoker* { + return new(std::nothrow) TestInvokerAsMethod( testAsMethod ); +} + +struct NameAndTags { + NameAndTags( StringRef const& name_ = StringRef(), StringRef const& tags_ = StringRef() ) noexcept; + StringRef name; + StringRef tags; +}; + +struct AutoReg : NonCopyable { + AutoReg( ITestInvoker* invoker, SourceLineInfo const& lineInfo, StringRef const& classOrMethod, NameAndTags const& nameAndTags ) noexcept; + ~AutoReg(); +}; + +} // end namespace Catch + +#if defined(CATCH_CONFIG_DISABLE) + #define INTERNAL_CATCH_TESTCASE_NO_REGISTRATION( TestName, ... ) \ + static void TestName() + #define INTERNAL_CATCH_TESTCASE_METHOD_NO_REGISTRATION( TestName, ClassName, ... ) \ + namespace{ \ + struct TestName : INTERNAL_CATCH_REMOVE_PARENS(ClassName) { \ + void test(); \ + }; \ + } \ + void TestName::test() + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE_NO_REGISTRATION( TestName, ... ) \ + template \ + static void TestName() + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_NO_REGISTRATION( TestName, ClassName, ... ) \ + namespace{ \ + template \ + struct TestName : INTERNAL_CATCH_REMOVE_PARENS(ClassName ) { \ + void test(); \ + }; \ + } \ + template \ + void TestName::test() +#endif + + /////////////////////////////////////////////////////////////////////////////// + #define INTERNAL_CATCH_TESTCASE2( TestName, ... ) \ + static void TestName(); \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ Catch::AutoReg INTERNAL_CATCH_UNIQUE_NAME( autoRegistrar )( Catch::makeTestInvoker( &TestName ), CATCH_INTERNAL_LINEINFO, Catch::StringRef(), Catch::NameAndTags{ __VA_ARGS__ } ); } /* NOLINT */ \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS \ + static void TestName() + #define INTERNAL_CATCH_TESTCASE( ... ) \ + INTERNAL_CATCH_TESTCASE2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ ), __VA_ARGS__ ) + + /////////////////////////////////////////////////////////////////////////////// + #define INTERNAL_CATCH_METHOD_AS_TEST_CASE( QualifiedMethod, ... ) \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ Catch::AutoReg INTERNAL_CATCH_UNIQUE_NAME( autoRegistrar )( Catch::makeTestInvoker( &QualifiedMethod ), CATCH_INTERNAL_LINEINFO, "&" #QualifiedMethod, Catch::NameAndTags{ __VA_ARGS__ } ); } /* NOLINT */ \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS + + /////////////////////////////////////////////////////////////////////////////// + #define INTERNAL_CATCH_TEST_CASE_METHOD2( TestName, ClassName, ... )\ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ \ + struct TestName : INTERNAL_CATCH_REMOVE_PARENS(ClassName) { \ + void test(); \ + }; \ + Catch::AutoReg INTERNAL_CATCH_UNIQUE_NAME( autoRegistrar ) ( Catch::makeTestInvoker( &TestName::test ), CATCH_INTERNAL_LINEINFO, #ClassName, Catch::NameAndTags{ __VA_ARGS__ } ); /* NOLINT */ \ + } \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS \ + void TestName::test() + #define INTERNAL_CATCH_TEST_CASE_METHOD( ClassName, ... ) \ + INTERNAL_CATCH_TEST_CASE_METHOD2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ ), ClassName, __VA_ARGS__ ) + + /////////////////////////////////////////////////////////////////////////////// + #define INTERNAL_CATCH_REGISTER_TESTCASE( Function, ... ) \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + Catch::AutoReg INTERNAL_CATCH_UNIQUE_NAME( autoRegistrar )( Catch::makeTestInvoker( Function ), CATCH_INTERNAL_LINEINFO, Catch::StringRef(), Catch::NameAndTags{ __VA_ARGS__ } ); /* NOLINT */ \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS + + /////////////////////////////////////////////////////////////////////////////// + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE_2(TestName, TestFunc, Name, Tags, ... )\ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + template \ + static void TestFunc();\ + namespace {\ + template \ + struct TestName{\ + template \ + TestName(Ts...names){\ + CATCH_INTERNAL_CHECK_UNIQUE_TYPES(CATCH_REC_LIST(INTERNAL_CATCH_REMOVE_PARENS, __VA_ARGS__)) \ + using expander = int[];\ + (void)expander{(Catch::AutoReg( Catch::makeTestInvoker( &TestFunc ), CATCH_INTERNAL_LINEINFO, Catch::StringRef(), Catch::NameAndTags{ names, Tags } ), 0)... };/* NOLINT */ \ + }\ + };\ + INTERNAL_CATCH_TEMPLATE_REGISTRY_INITIATE(TestName, Name, __VA_ARGS__) \ + }\ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS \ + template \ + static void TestFunc() + +#if defined(CATCH_CPP17_OR_GREATER) +#define CATCH_INTERNAL_CHECK_UNIQUE_TYPES(...) static_assert(Catch::is_unique<__VA_ARGS__>,"Duplicate type detected in declaration of template test case"); +#else +#define CATCH_INTERNAL_CHECK_UNIQUE_TYPES(...) static_assert(Catch::is_unique<__VA_ARGS__>::value,"Duplicate type detected in declaration of template test case"); +#endif + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE(Name, Tags, ...) \ + INTERNAL_CATCH_TEMPLATE_TEST_CASE_2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____F_U_N_C____ ), Name, Tags, __VA_ARGS__ ) +#else + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE(Name, Tags, ...) \ + INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____F_U_N_C____ ), Name, Tags, __VA_ARGS__ ) ) +#endif + + #define INTERNAL_CATCH_TEMPLATE_REGISTRY_INITIATE(TestName, Name, ...)\ + static int INTERNAL_CATCH_UNIQUE_NAME( globalRegistrar ) = [](){\ + TestName(CATCH_REC_LIST_UD(INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME,Name, __VA_ARGS__));\ + return 0;\ + }(); + + #define INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE2(TestName, TestFuncName, Name, Tags, TmplTypes, TypesList) \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + template static void TestFuncName(); \ + namespace { \ + template \ + struct TestName { \ + TestName() { \ + CATCH_INTERNAL_CHECK_UNIQUE_TYPES(Types...) \ + int index = 0; \ + using expander = int[]; \ + constexpr char const* tmpl_types[] = {CATCH_REC_LIST(INTERNAL_CATCH_STRINGIZE_WITHOUT_PARENS, INTERNAL_CATCH_REMOVE_PARENS(TmplTypes))};\ + constexpr char const* types_list[] = {CATCH_REC_LIST(INTERNAL_CATCH_STRINGIZE_WITHOUT_PARENS, INTERNAL_CATCH_REMOVE_PARENS(TypesList))};\ + constexpr auto num_types = sizeof(types_list) / sizeof(types_list[0]);\ + (void)expander{(Catch::AutoReg( Catch::makeTestInvoker( &TestFuncName ), CATCH_INTERNAL_LINEINFO, Catch::StringRef(), Catch::NameAndTags{ Name " - " + std::string(tmpl_types[index / num_types]) + "<" + std::string(types_list[index % num_types]) + ">", Tags } ), index++, 0)... };/* NOLINT */\ + } \ + }; \ + static int INTERNAL_CATCH_UNIQUE_NAME( globalRegistrar ) = [](){ \ + using TestInit = Catch::combine \ + ::with_types::into::type; \ + TestInit(); \ + return 0; \ + }(); \ + } \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS \ + template \ + static void TestFuncName() + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR + #define INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE(Name, Tags, ...)\ + INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE2(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____F_U_N_C____ ),Name,Tags,__VA_ARGS__) +#else + #define INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE(Name, Tags, ...)\ + INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____F_U_N_C____ ), Name, Tags, __VA_ARGS__ ) ) +#endif + + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_2( TestNameClass, TestName, ClassName, Name, Tags, ... ) \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ \ + template \ + struct TestName : INTERNAL_CATCH_REMOVE_PARENS(ClassName ) { \ + void test();\ + };\ + template \ + struct TestNameClass{\ + template \ + TestNameClass(Ts...names){\ + CATCH_INTERNAL_CHECK_UNIQUE_TYPES(CATCH_REC_LIST(INTERNAL_CATCH_REMOVE_PARENS, __VA_ARGS__)) \ + using expander = int[];\ + (void)expander{(Catch::AutoReg( Catch::makeTestInvoker( &TestName::test ), CATCH_INTERNAL_LINEINFO, #ClassName, Catch::NameAndTags{ names, Tags } ), 0)... };/* NOLINT */ \ + }\ + };\ + INTERNAL_CATCH_TEMPLATE_REGISTRY_INITIATE(TestNameClass, Name, __VA_ARGS__)\ + }\ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS\ + template \ + void TestName::test() + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD( ClassName, Name, Tags,... ) \ + INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____C_L_A_S_S____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ) , ClassName, Name, Tags, __VA_ARGS__ ) +#else + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD( ClassName, Name, Tags,... ) \ + INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____C_L_A_S_S____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ) , ClassName, Name, Tags, __VA_ARGS__ ) ) +#endif + + #define INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD_2(TestNameClass, TestName, ClassName, Name, Tags, TmplTypes, TypesList)\ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + template \ + struct TestName : INTERNAL_CATCH_REMOVE_PARENS(ClassName ) { \ + void test();\ + };\ + namespace {\ + template\ + struct TestNameClass{\ + TestNameClass(){\ + CATCH_INTERNAL_CHECK_UNIQUE_TYPES(Types...)\ + int index = 0;\ + using expander = int[];\ + constexpr char const* tmpl_types[] = {CATCH_REC_LIST(INTERNAL_CATCH_STRINGIZE_WITHOUT_PARENS, INTERNAL_CATCH_REMOVE_PARENS(TmplTypes))};\ + constexpr char const* types_list[] = {CATCH_REC_LIST(INTERNAL_CATCH_STRINGIZE_WITHOUT_PARENS, INTERNAL_CATCH_REMOVE_PARENS(TypesList))};\ + constexpr auto num_types = sizeof(types_list) / sizeof(types_list[0]);\ + (void)expander{(Catch::AutoReg( Catch::makeTestInvoker( &TestName::test ), CATCH_INTERNAL_LINEINFO, #ClassName, Catch::NameAndTags{ Name " - " + std::string(tmpl_types[index / num_types]) + "<" + std::string(types_list[index % num_types]) + ">", Tags } ), index++, 0)... };/* NOLINT */ \ + }\ + };\ + static int INTERNAL_CATCH_UNIQUE_NAME( globalRegistrar ) = [](){\ + using TestInit = Catch::combine\ + ::with_types::into::type;\ + TestInit();\ + return 0;\ + }(); \ + }\ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS \ + template \ + void TestName::test() + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR + #define INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( ClassName, Name, Tags, ... )\ + INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD_2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____F_U_N_C____ ), ClassName, Name, Tags, __VA_ARGS__ ) +#else + #define INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( ClassName, Name, Tags, ... )\ + INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD_2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____F_U_N_C____ ), ClassName, Name, Tags, __VA_ARGS__ ) ) +#endif + +// end catch_test_registry.h +// start catch_capture.hpp + +// start catch_assertionhandler.h + +// start catch_assertioninfo.h + +// start catch_result_type.h + +namespace Catch { + + // ResultWas::OfType enum + struct ResultWas { enum OfType { + Unknown = -1, + Ok = 0, + Info = 1, + Warning = 2, + + FailureBit = 0x10, + + ExpressionFailed = FailureBit | 1, + ExplicitFailure = FailureBit | 2, + + Exception = 0x100 | FailureBit, + + ThrewException = Exception | 1, + DidntThrowException = Exception | 2, + + FatalErrorCondition = 0x200 | FailureBit + + }; }; + + bool isOk( ResultWas::OfType resultType ); + bool isJustInfo( int flags ); + + // ResultDisposition::Flags enum + struct ResultDisposition { enum Flags { + Normal = 0x01, + + ContinueOnFailure = 0x02, // Failures fail test, but execution continues + FalseTest = 0x04, // Prefix expression with ! + SuppressFail = 0x08 // Failures are reported but do not fail the test + }; }; + + ResultDisposition::Flags operator | ( ResultDisposition::Flags lhs, ResultDisposition::Flags rhs ); + + bool shouldContinueOnFailure( int flags ); + inline bool isFalseTest( int flags ) { return ( flags & ResultDisposition::FalseTest ) != 0; } + bool shouldSuppressFailure( int flags ); + +} // end namespace Catch + +// end catch_result_type.h +namespace Catch { + + struct AssertionInfo + { + StringRef macroName; + SourceLineInfo lineInfo; + StringRef capturedExpression; + ResultDisposition::Flags resultDisposition; + + // We want to delete this constructor but a compiler bug in 4.8 means + // the struct is then treated as non-aggregate + //AssertionInfo() = delete; + }; + +} // end namespace Catch + +// end catch_assertioninfo.h +// start catch_decomposer.h + +// start catch_tostring.h + +#include +#include +#include +#include +// start catch_stream.h + +#include +#include +#include + +namespace Catch { + + std::ostream& cout(); + std::ostream& cerr(); + std::ostream& clog(); + + class StringRef; + + struct IStream { + virtual ~IStream(); + virtual std::ostream& stream() const = 0; + }; + + auto makeStream( StringRef const &filename ) -> IStream const*; + + class ReusableStringStream { + std::size_t m_index; + std::ostream* m_oss; + public: + ReusableStringStream(); + ~ReusableStringStream(); + + auto str() const -> std::string; + + template + auto operator << ( T const& value ) -> ReusableStringStream& { + *m_oss << value; + return *this; + } + auto get() -> std::ostream& { return *m_oss; } + }; +} + +// end catch_stream.h + +#ifdef CATCH_CONFIG_CPP17_STRING_VIEW +#include +#endif + +#ifdef __OBJC__ +// start catch_objc_arc.hpp + +#import + +#ifdef __has_feature +#define CATCH_ARC_ENABLED __has_feature(objc_arc) +#else +#define CATCH_ARC_ENABLED 0 +#endif + +void arcSafeRelease( NSObject* obj ); +id performOptionalSelector( id obj, SEL sel ); + +#if !CATCH_ARC_ENABLED +inline void arcSafeRelease( NSObject* obj ) { + [obj release]; +} +inline id performOptionalSelector( id obj, SEL sel ) { + if( [obj respondsToSelector: sel] ) + return [obj performSelector: sel]; + return nil; +} +#define CATCH_UNSAFE_UNRETAINED +#define CATCH_ARC_STRONG +#else +inline void arcSafeRelease( NSObject* ){} +inline id performOptionalSelector( id obj, SEL sel ) { +#ifdef __clang__ +#pragma clang diagnostic push +#pragma clang diagnostic ignored "-Warc-performSelector-leaks" +#endif + if( [obj respondsToSelector: sel] ) + return [obj performSelector: sel]; +#ifdef __clang__ +#pragma clang diagnostic pop +#endif + return nil; +} +#define CATCH_UNSAFE_UNRETAINED __unsafe_unretained +#define CATCH_ARC_STRONG __strong +#endif + +// end catch_objc_arc.hpp +#endif + +#ifdef _MSC_VER +#pragma warning(push) +#pragma warning(disable:4180) // We attempt to stream a function (address) by const&, which MSVC complains about but is harmless +#endif + +namespace Catch { + namespace Detail { + + extern const std::string unprintableString; + + std::string rawMemoryToString( const void *object, std::size_t size ); + + template + std::string rawMemoryToString( const T& object ) { + return rawMemoryToString( &object, sizeof(object) ); + } + + template + class IsStreamInsertable { + template + static auto test(int) + -> decltype(std::declval() << std::declval(), std::true_type()); + + template + static auto test(...)->std::false_type; + + public: + static const bool value = decltype(test(0))::value; + }; + + template + std::string convertUnknownEnumToString( E e ); + + template + typename std::enable_if< + !std::is_enum::value && !std::is_base_of::value, + std::string>::type convertUnstreamable( T const& ) { + return Detail::unprintableString; + } + template + typename std::enable_if< + !std::is_enum::value && std::is_base_of::value, + std::string>::type convertUnstreamable(T const& ex) { + return ex.what(); + } + + template + typename std::enable_if< + std::is_enum::value + , std::string>::type convertUnstreamable( T const& value ) { + return convertUnknownEnumToString( value ); + } + +#if defined(_MANAGED) + //! Convert a CLR string to a utf8 std::string + template + std::string clrReferenceToString( T^ ref ) { + if (ref == nullptr) + return std::string("null"); + auto bytes = System::Text::Encoding::UTF8->GetBytes(ref->ToString()); + cli::pin_ptr p = &bytes[0]; + return std::string(reinterpret_cast(p), bytes->Length); + } +#endif + + } // namespace Detail + + // If we decide for C++14, change these to enable_if_ts + template + struct StringMaker { + template + static + typename std::enable_if<::Catch::Detail::IsStreamInsertable::value, std::string>::type + convert(const Fake& value) { + ReusableStringStream rss; + // NB: call using the function-like syntax to avoid ambiguity with + // user-defined templated operator<< under clang. + rss.operator<<(value); + return rss.str(); + } + + template + static + typename std::enable_if::value, std::string>::type + convert( const Fake& value ) { +#if !defined(CATCH_CONFIG_FALLBACK_STRINGIFIER) + return Detail::convertUnstreamable(value); +#else + return CATCH_CONFIG_FALLBACK_STRINGIFIER(value); +#endif + } + }; + + namespace Detail { + + // This function dispatches all stringification requests inside of Catch. + // Should be preferably called fully qualified, like ::Catch::Detail::stringify + template + std::string stringify(const T& e) { + return ::Catch::StringMaker::type>::type>::convert(e); + } + + template + std::string convertUnknownEnumToString( E e ) { + return ::Catch::Detail::stringify(static_cast::type>(e)); + } + +#if defined(_MANAGED) + template + std::string stringify( T^ e ) { + return ::Catch::StringMaker::convert(e); + } +#endif + + } // namespace Detail + + // Some predefined specializations + + template<> + struct StringMaker { + static std::string convert(const std::string& str); + }; + +#ifdef CATCH_CONFIG_CPP17_STRING_VIEW + template<> + struct StringMaker { + static std::string convert(std::string_view str); + }; +#endif + + template<> + struct StringMaker { + static std::string convert(char const * str); + }; + template<> + struct StringMaker { + static std::string convert(char * str); + }; + +#ifdef CATCH_CONFIG_WCHAR + template<> + struct StringMaker { + static std::string convert(const std::wstring& wstr); + }; + +# ifdef CATCH_CONFIG_CPP17_STRING_VIEW + template<> + struct StringMaker { + static std::string convert(std::wstring_view str); + }; +# endif + + template<> + struct StringMaker { + static std::string convert(wchar_t const * str); + }; + template<> + struct StringMaker { + static std::string convert(wchar_t * str); + }; +#endif + + // TBD: Should we use `strnlen` to ensure that we don't go out of the buffer, + // while keeping string semantics? + template + struct StringMaker { + static std::string convert(char const* str) { + return ::Catch::Detail::stringify(std::string{ str }); + } + }; + template + struct StringMaker { + static std::string convert(signed char const* str) { + return ::Catch::Detail::stringify(std::string{ reinterpret_cast(str) }); + } + }; + template + struct StringMaker { + static std::string convert(unsigned char const* str) { + return ::Catch::Detail::stringify(std::string{ reinterpret_cast(str) }); + } + }; + + template<> + struct StringMaker { + static std::string convert(int value); + }; + template<> + struct StringMaker { + static std::string convert(long value); + }; + template<> + struct StringMaker { + static std::string convert(long long value); + }; + template<> + struct StringMaker { + static std::string convert(unsigned int value); + }; + template<> + struct StringMaker { + static std::string convert(unsigned long value); + }; + template<> + struct StringMaker { + static std::string convert(unsigned long long value); + }; + + template<> + struct StringMaker { + static std::string convert(bool b); + }; + + template<> + struct StringMaker { + static std::string convert(char c); + }; + template<> + struct StringMaker { + static std::string convert(signed char c); + }; + template<> + struct StringMaker { + static std::string convert(unsigned char c); + }; + + template<> + struct StringMaker { + static std::string convert(std::nullptr_t); + }; + + template<> + struct StringMaker { + static std::string convert(float value); + }; + template<> + struct StringMaker { + static std::string convert(double value); + }; + + template + struct StringMaker { + template + static std::string convert(U* p) { + if (p) { + return ::Catch::Detail::rawMemoryToString(p); + } else { + return "nullptr"; + } + } + }; + + template + struct StringMaker { + static std::string convert(R C::* p) { + if (p) { + return ::Catch::Detail::rawMemoryToString(p); + } else { + return "nullptr"; + } + } + }; + +#if defined(_MANAGED) + template + struct StringMaker { + static std::string convert( T^ ref ) { + return ::Catch::Detail::clrReferenceToString(ref); + } + }; +#endif + + namespace Detail { + template + std::string rangeToString(InputIterator first, InputIterator last) { + ReusableStringStream rss; + rss << "{ "; + if (first != last) { + rss << ::Catch::Detail::stringify(*first); + for (++first; first != last; ++first) + rss << ", " << ::Catch::Detail::stringify(*first); + } + rss << " }"; + return rss.str(); + } + } + +#ifdef __OBJC__ + template<> + struct StringMaker { + static std::string convert(NSString * nsstring) { + if (!nsstring) + return "nil"; + return std::string("@") + [nsstring UTF8String]; + } + }; + template<> + struct StringMaker { + static std::string convert(NSObject* nsObject) { + return ::Catch::Detail::stringify([nsObject description]); + } + + }; + namespace Detail { + inline std::string stringify( NSString* nsstring ) { + return StringMaker::convert( nsstring ); + } + + } // namespace Detail +#endif // __OBJC__ + +} // namespace Catch + +////////////////////////////////////////////////////// +// Separate std-lib types stringification, so it can be selectively enabled +// This means that we do not bring in + +#if defined(CATCH_CONFIG_ENABLE_ALL_STRINGMAKERS) +# define CATCH_CONFIG_ENABLE_PAIR_STRINGMAKER +# define CATCH_CONFIG_ENABLE_TUPLE_STRINGMAKER +# define CATCH_CONFIG_ENABLE_VARIANT_STRINGMAKER +# define CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER +# define CATCH_CONFIG_ENABLE_OPTIONAL_STRINGMAKER +#endif + +// Separate std::pair specialization +#if defined(CATCH_CONFIG_ENABLE_PAIR_STRINGMAKER) +#include +namespace Catch { + template + struct StringMaker > { + static std::string convert(const std::pair& pair) { + ReusableStringStream rss; + rss << "{ " + << ::Catch::Detail::stringify(pair.first) + << ", " + << ::Catch::Detail::stringify(pair.second) + << " }"; + return rss.str(); + } + }; +} +#endif // CATCH_CONFIG_ENABLE_PAIR_STRINGMAKER + +#if defined(CATCH_CONFIG_ENABLE_OPTIONAL_STRINGMAKER) && defined(CATCH_CONFIG_CPP17_OPTIONAL) +#include +namespace Catch { + template + struct StringMaker > { + static std::string convert(const std::optional& optional) { + ReusableStringStream rss; + if (optional.has_value()) { + rss << ::Catch::Detail::stringify(*optional); + } else { + rss << "{ }"; + } + return rss.str(); + } + }; +} +#endif // CATCH_CONFIG_ENABLE_OPTIONAL_STRINGMAKER + +// Separate std::tuple specialization +#if defined(CATCH_CONFIG_ENABLE_TUPLE_STRINGMAKER) +#include +namespace Catch { + namespace Detail { + template< + typename Tuple, + std::size_t N = 0, + bool = (N < std::tuple_size::value) + > + struct TupleElementPrinter { + static void print(const Tuple& tuple, std::ostream& os) { + os << (N ? ", " : " ") + << ::Catch::Detail::stringify(std::get(tuple)); + TupleElementPrinter::print(tuple, os); + } + }; + + template< + typename Tuple, + std::size_t N + > + struct TupleElementPrinter { + static void print(const Tuple&, std::ostream&) {} + }; + + } + + template + struct StringMaker> { + static std::string convert(const std::tuple& tuple) { + ReusableStringStream rss; + rss << '{'; + Detail::TupleElementPrinter>::print(tuple, rss.get()); + rss << " }"; + return rss.str(); + } + }; +} +#endif // CATCH_CONFIG_ENABLE_TUPLE_STRINGMAKER + +#if defined(CATCH_CONFIG_ENABLE_VARIANT_STRINGMAKER) && defined(CATCH_CONFIG_CPP17_VARIANT) +#include +namespace Catch { + template<> + struct StringMaker { + static std::string convert(const std::monostate&) { + return "{ }"; + } + }; + + template + struct StringMaker> { + static std::string convert(const std::variant& variant) { + if (variant.valueless_by_exception()) { + return "{valueless variant}"; + } else { + return std::visit( + [](const auto& value) { + return ::Catch::Detail::stringify(value); + }, + variant + ); + } + } + }; +} +#endif // CATCH_CONFIG_ENABLE_VARIANT_STRINGMAKER + +namespace Catch { + struct not_this_one {}; // Tag type for detecting which begin/ end are being selected + + // Import begin/ end from std here so they are considered alongside the fallback (...) overloads in this namespace + using std::begin; + using std::end; + + not_this_one begin( ... ); + not_this_one end( ... ); + + template + struct is_range { + static const bool value = + !std::is_same())), not_this_one>::value && + !std::is_same())), not_this_one>::value; + }; + +#if defined(_MANAGED) // Managed types are never ranges + template + struct is_range { + static const bool value = false; + }; +#endif + + template + std::string rangeToString( Range const& range ) { + return ::Catch::Detail::rangeToString( begin( range ), end( range ) ); + } + + // Handle vector specially + template + std::string rangeToString( std::vector const& v ) { + ReusableStringStream rss; + rss << "{ "; + bool first = true; + for( bool b : v ) { + if( first ) + first = false; + else + rss << ", "; + rss << ::Catch::Detail::stringify( b ); + } + rss << " }"; + return rss.str(); + } + + template + struct StringMaker::value && !::Catch::Detail::IsStreamInsertable::value>::type> { + static std::string convert( R const& range ) { + return rangeToString( range ); + } + }; + + template + struct StringMaker { + static std::string convert(T const(&arr)[SZ]) { + return rangeToString(arr); + } + }; + +} // namespace Catch + +// Separate std::chrono::duration specialization +#if defined(CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER) +#include +#include +#include + +namespace Catch { + +template +struct ratio_string { + static std::string symbol(); +}; + +template +std::string ratio_string::symbol() { + Catch::ReusableStringStream rss; + rss << '[' << Ratio::num << '/' + << Ratio::den << ']'; + return rss.str(); +} +template <> +struct ratio_string { + static std::string symbol(); +}; +template <> +struct ratio_string { + static std::string symbol(); +}; +template <> +struct ratio_string { + static std::string symbol(); +}; +template <> +struct ratio_string { + static std::string symbol(); +}; +template <> +struct ratio_string { + static std::string symbol(); +}; +template <> +struct ratio_string { + static std::string symbol(); +}; + + //////////// + // std::chrono::duration specializations + template + struct StringMaker> { + static std::string convert(std::chrono::duration const& duration) { + ReusableStringStream rss; + rss << duration.count() << ' ' << ratio_string::symbol() << 's'; + return rss.str(); + } + }; + template + struct StringMaker>> { + static std::string convert(std::chrono::duration> const& duration) { + ReusableStringStream rss; + rss << duration.count() << " s"; + return rss.str(); + } + }; + template + struct StringMaker>> { + static std::string convert(std::chrono::duration> const& duration) { + ReusableStringStream rss; + rss << duration.count() << " m"; + return rss.str(); + } + }; + template + struct StringMaker>> { + static std::string convert(std::chrono::duration> const& duration) { + ReusableStringStream rss; + rss << duration.count() << " h"; + return rss.str(); + } + }; + + //////////// + // std::chrono::time_point specialization + // Generic time_point cannot be specialized, only std::chrono::time_point + template + struct StringMaker> { + static std::string convert(std::chrono::time_point const& time_point) { + return ::Catch::Detail::stringify(time_point.time_since_epoch()) + " since epoch"; + } + }; + // std::chrono::time_point specialization + template + struct StringMaker> { + static std::string convert(std::chrono::time_point const& time_point) { + auto converted = std::chrono::system_clock::to_time_t(time_point); + +#ifdef _MSC_VER + std::tm timeInfo = {}; + gmtime_s(&timeInfo, &converted); +#else + std::tm* timeInfo = std::gmtime(&converted); +#endif + + auto const timeStampSize = sizeof("2017-01-16T17:06:45Z"); + char timeStamp[timeStampSize]; + const char * const fmt = "%Y-%m-%dT%H:%M:%SZ"; + +#ifdef _MSC_VER + std::strftime(timeStamp, timeStampSize, fmt, &timeInfo); +#else + std::strftime(timeStamp, timeStampSize, fmt, timeInfo); +#endif + return std::string(timeStamp); + } + }; +} +#endif // CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER + +#ifdef _MSC_VER +#pragma warning(pop) +#endif + +// end catch_tostring.h +#include + +#ifdef _MSC_VER +#pragma warning(push) +#pragma warning(disable:4389) // '==' : signed/unsigned mismatch +#pragma warning(disable:4018) // more "signed/unsigned mismatch" +#pragma warning(disable:4312) // Converting int to T* using reinterpret_cast (issue on x64 platform) +#pragma warning(disable:4180) // qualifier applied to function type has no meaning +#pragma warning(disable:4800) // Forcing result to true or false +#endif + +namespace Catch { + + struct ITransientExpression { + auto isBinaryExpression() const -> bool { return m_isBinaryExpression; } + auto getResult() const -> bool { return m_result; } + virtual void streamReconstructedExpression( std::ostream &os ) const = 0; + + ITransientExpression( bool isBinaryExpression, bool result ) + : m_isBinaryExpression( isBinaryExpression ), + m_result( result ) + {} + + // We don't actually need a virtual destructor, but many static analysers + // complain if it's not here :-( + virtual ~ITransientExpression(); + + bool m_isBinaryExpression; + bool m_result; + + }; + + void formatReconstructedExpression( std::ostream &os, std::string const& lhs, StringRef op, std::string const& rhs ); + + template + class BinaryExpr : public ITransientExpression { + LhsT m_lhs; + StringRef m_op; + RhsT m_rhs; + + void streamReconstructedExpression( std::ostream &os ) const override { + formatReconstructedExpression + ( os, Catch::Detail::stringify( m_lhs ), m_op, Catch::Detail::stringify( m_rhs ) ); + } + + public: + BinaryExpr( bool comparisonResult, LhsT lhs, StringRef op, RhsT rhs ) + : ITransientExpression{ true, comparisonResult }, + m_lhs( lhs ), + m_op( op ), + m_rhs( rhs ) + {} + + template + auto operator && ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator || ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator == ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator != ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator > ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator < ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator >= ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator <= ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + }; + + template + class UnaryExpr : public ITransientExpression { + LhsT m_lhs; + + void streamReconstructedExpression( std::ostream &os ) const override { + os << Catch::Detail::stringify( m_lhs ); + } + + public: + explicit UnaryExpr( LhsT lhs ) + : ITransientExpression{ false, static_cast(lhs) }, + m_lhs( lhs ) + {} + }; + + // Specialised comparison functions to handle equality comparisons between ints and pointers (NULL deduces as an int) + template + auto compareEqual( LhsT const& lhs, RhsT const& rhs ) -> bool { return static_cast(lhs == rhs); } + template + auto compareEqual( T* const& lhs, int rhs ) -> bool { return lhs == reinterpret_cast( rhs ); } + template + auto compareEqual( T* const& lhs, long rhs ) -> bool { return lhs == reinterpret_cast( rhs ); } + template + auto compareEqual( int lhs, T* const& rhs ) -> bool { return reinterpret_cast( lhs ) == rhs; } + template + auto compareEqual( long lhs, T* const& rhs ) -> bool { return reinterpret_cast( lhs ) == rhs; } + + template + auto compareNotEqual( LhsT const& lhs, RhsT&& rhs ) -> bool { return static_cast(lhs != rhs); } + template + auto compareNotEqual( T* const& lhs, int rhs ) -> bool { return lhs != reinterpret_cast( rhs ); } + template + auto compareNotEqual( T* const& lhs, long rhs ) -> bool { return lhs != reinterpret_cast( rhs ); } + template + auto compareNotEqual( int lhs, T* const& rhs ) -> bool { return reinterpret_cast( lhs ) != rhs; } + template + auto compareNotEqual( long lhs, T* const& rhs ) -> bool { return reinterpret_cast( lhs ) != rhs; } + + template + class ExprLhs { + LhsT m_lhs; + public: + explicit ExprLhs( LhsT lhs ) : m_lhs( lhs ) {} + + template + auto operator == ( RhsT const& rhs ) -> BinaryExpr const { + return { compareEqual( m_lhs, rhs ), m_lhs, "==", rhs }; + } + auto operator == ( bool rhs ) -> BinaryExpr const { + return { m_lhs == rhs, m_lhs, "==", rhs }; + } + + template + auto operator != ( RhsT const& rhs ) -> BinaryExpr const { + return { compareNotEqual( m_lhs, rhs ), m_lhs, "!=", rhs }; + } + auto operator != ( bool rhs ) -> BinaryExpr const { + return { m_lhs != rhs, m_lhs, "!=", rhs }; + } + + template + auto operator > ( RhsT const& rhs ) -> BinaryExpr const { + return { static_cast(m_lhs > rhs), m_lhs, ">", rhs }; + } + template + auto operator < ( RhsT const& rhs ) -> BinaryExpr const { + return { static_cast(m_lhs < rhs), m_lhs, "<", rhs }; + } + template + auto operator >= ( RhsT const& rhs ) -> BinaryExpr const { + return { static_cast(m_lhs >= rhs), m_lhs, ">=", rhs }; + } + template + auto operator <= ( RhsT const& rhs ) -> BinaryExpr const { + return { static_cast(m_lhs <= rhs), m_lhs, "<=", rhs }; + } + + template + auto operator && ( RhsT const& ) -> BinaryExpr const { + static_assert(always_false::value, + "operator&& is not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator || ( RhsT const& ) -> BinaryExpr const { + static_assert(always_false::value, + "operator|| is not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + auto makeUnaryExpr() const -> UnaryExpr { + return UnaryExpr{ m_lhs }; + } + }; + + void handleExpression( ITransientExpression const& expr ); + + template + void handleExpression( ExprLhs const& expr ) { + handleExpression( expr.makeUnaryExpr() ); + } + + struct Decomposer { + template + auto operator <= ( T const& lhs ) -> ExprLhs { + return ExprLhs{ lhs }; + } + + auto operator <=( bool value ) -> ExprLhs { + return ExprLhs{ value }; + } + }; + +} // end namespace Catch + +#ifdef _MSC_VER +#pragma warning(pop) +#endif + +// end catch_decomposer.h +// start catch_interfaces_capture.h + +#include + +namespace Catch { + + class AssertionResult; + struct AssertionInfo; + struct SectionInfo; + struct SectionEndInfo; + struct MessageInfo; + struct MessageBuilder; + struct Counts; + struct BenchmarkInfo; + struct BenchmarkStats; + struct AssertionReaction; + struct SourceLineInfo; + + struct ITransientExpression; + struct IGeneratorTracker; + + struct IResultCapture { + + virtual ~IResultCapture(); + + virtual bool sectionStarted( SectionInfo const& sectionInfo, + Counts& assertions ) = 0; + virtual void sectionEnded( SectionEndInfo const& endInfo ) = 0; + virtual void sectionEndedEarly( SectionEndInfo const& endInfo ) = 0; + + virtual auto acquireGeneratorTracker( SourceLineInfo const& lineInfo ) -> IGeneratorTracker& = 0; + + virtual void benchmarkStarting( BenchmarkInfo const& info ) = 0; + virtual void benchmarkEnded( BenchmarkStats const& stats ) = 0; + + virtual void pushScopedMessage( MessageInfo const& message ) = 0; + virtual void popScopedMessage( MessageInfo const& message ) = 0; + + virtual void emplaceUnscopedMessage( MessageBuilder const& builder ) = 0; + + virtual void handleFatalErrorCondition( StringRef message ) = 0; + + virtual void handleExpr + ( AssertionInfo const& info, + ITransientExpression const& expr, + AssertionReaction& reaction ) = 0; + virtual void handleMessage + ( AssertionInfo const& info, + ResultWas::OfType resultType, + StringRef const& message, + AssertionReaction& reaction ) = 0; + virtual void handleUnexpectedExceptionNotThrown + ( AssertionInfo const& info, + AssertionReaction& reaction ) = 0; + virtual void handleUnexpectedInflightException + ( AssertionInfo const& info, + std::string const& message, + AssertionReaction& reaction ) = 0; + virtual void handleIncomplete + ( AssertionInfo const& info ) = 0; + virtual void handleNonExpr + ( AssertionInfo const &info, + ResultWas::OfType resultType, + AssertionReaction &reaction ) = 0; + + virtual bool lastAssertionPassed() = 0; + virtual void assertionPassed() = 0; + + // Deprecated, do not use: + virtual std::string getCurrentTestName() const = 0; + virtual const AssertionResult* getLastResult() const = 0; + virtual void exceptionEarlyReported() = 0; + }; + + IResultCapture& getResultCapture(); +} + +// end catch_interfaces_capture.h +namespace Catch { + + struct TestFailureException{}; + struct AssertionResultData; + struct IResultCapture; + class RunContext; + + class LazyExpression { + friend class AssertionHandler; + friend struct AssertionStats; + friend class RunContext; + + ITransientExpression const* m_transientExpression = nullptr; + bool m_isNegated; + public: + LazyExpression( bool isNegated ); + LazyExpression( LazyExpression const& other ); + LazyExpression& operator = ( LazyExpression const& ) = delete; + + explicit operator bool() const; + + friend auto operator << ( std::ostream& os, LazyExpression const& lazyExpr ) -> std::ostream&; + }; + + struct AssertionReaction { + bool shouldDebugBreak = false; + bool shouldThrow = false; + }; + + class AssertionHandler { + AssertionInfo m_assertionInfo; + AssertionReaction m_reaction; + bool m_completed = false; + IResultCapture& m_resultCapture; + + public: + AssertionHandler + ( StringRef const& macroName, + SourceLineInfo const& lineInfo, + StringRef capturedExpression, + ResultDisposition::Flags resultDisposition ); + ~AssertionHandler() { + if ( !m_completed ) { + m_resultCapture.handleIncomplete( m_assertionInfo ); + } + } + + template + void handleExpr( ExprLhs const& expr ) { + handleExpr( expr.makeUnaryExpr() ); + } + void handleExpr( ITransientExpression const& expr ); + + void handleMessage(ResultWas::OfType resultType, StringRef const& message); + + void handleExceptionThrownAsExpected(); + void handleUnexpectedExceptionNotThrown(); + void handleExceptionNotThrownAsExpected(); + void handleThrowingCallSkipped(); + void handleUnexpectedInflightException(); + + void complete(); + void setCompleted(); + + // query + auto allowThrows() const -> bool; + }; + + void handleExceptionMatchExpr( AssertionHandler& handler, std::string const& str, StringRef const& matcherString ); + +} // namespace Catch + +// end catch_assertionhandler.h +// start catch_message.h + +#include +#include + +namespace Catch { + + struct MessageInfo { + MessageInfo( StringRef const& _macroName, + SourceLineInfo const& _lineInfo, + ResultWas::OfType _type ); + + StringRef macroName; + std::string message; + SourceLineInfo lineInfo; + ResultWas::OfType type; + unsigned int sequence; + + bool operator == ( MessageInfo const& other ) const; + bool operator < ( MessageInfo const& other ) const; + private: + static unsigned int globalCount; + }; + + struct MessageStream { + + template + MessageStream& operator << ( T const& value ) { + m_stream << value; + return *this; + } + + ReusableStringStream m_stream; + }; + + struct MessageBuilder : MessageStream { + MessageBuilder( StringRef const& macroName, + SourceLineInfo const& lineInfo, + ResultWas::OfType type ); + + template + MessageBuilder& operator << ( T const& value ) { + m_stream << value; + return *this; + } + + MessageInfo m_info; + }; + + class ScopedMessage { + public: + explicit ScopedMessage( MessageBuilder const& builder ); + ScopedMessage( ScopedMessage& duplicate ) = delete; + ScopedMessage( ScopedMessage&& old ); + ~ScopedMessage(); + + MessageInfo m_info; + bool m_moved; + }; + + class Capturer { + std::vector m_messages; + IResultCapture& m_resultCapture = getResultCapture(); + size_t m_captured = 0; + public: + Capturer( StringRef macroName, SourceLineInfo const& lineInfo, ResultWas::OfType resultType, StringRef names ); + ~Capturer(); + + void captureValue( size_t index, std::string const& value ); + + template + void captureValues( size_t index, T const& value ) { + captureValue( index, Catch::Detail::stringify( value ) ); + } + + template + void captureValues( size_t index, T const& value, Ts const&... values ) { + captureValue( index, Catch::Detail::stringify(value) ); + captureValues( index+1, values... ); + } + }; + +} // end namespace Catch + +// end catch_message.h +#if !defined(CATCH_CONFIG_DISABLE) + +#if !defined(CATCH_CONFIG_DISABLE_STRINGIFICATION) + #define CATCH_INTERNAL_STRINGIFY(...) #__VA_ARGS__ +#else + #define CATCH_INTERNAL_STRINGIFY(...) "Disabled by CATCH_CONFIG_DISABLE_STRINGIFICATION" +#endif + +#if defined(CATCH_CONFIG_FAST_COMPILE) || defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) + +/////////////////////////////////////////////////////////////////////////////// +// Another way to speed-up compilation is to omit local try-catch for REQUIRE* +// macros. +#define INTERNAL_CATCH_TRY +#define INTERNAL_CATCH_CATCH( capturer ) + +#else // CATCH_CONFIG_FAST_COMPILE + +#define INTERNAL_CATCH_TRY try +#define INTERNAL_CATCH_CATCH( handler ) catch(...) { handler.handleUnexpectedInflightException(); } + +#endif + +#define INTERNAL_CATCH_REACT( handler ) handler.complete(); + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_TEST( macroName, resultDisposition, ... ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, CATCH_INTERNAL_STRINGIFY(__VA_ARGS__), resultDisposition ); \ + INTERNAL_CATCH_TRY { \ + CATCH_INTERNAL_SUPPRESS_PARENTHESES_WARNINGS \ + catchAssertionHandler.handleExpr( Catch::Decomposer() <= __VA_ARGS__ ); \ + CATCH_INTERNAL_UNSUPPRESS_PARENTHESES_WARNINGS \ + } INTERNAL_CATCH_CATCH( catchAssertionHandler ) \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( (void)0, (false) && static_cast( !!(__VA_ARGS__) ) ) // the expression here is never evaluated at runtime but it forces the compiler to give it a look + // The double negation silences MSVC's C4800 warning, the static_cast forces short-circuit evaluation if the type has overloaded &&. + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_IF( macroName, resultDisposition, ... ) \ + INTERNAL_CATCH_TEST( macroName, resultDisposition, __VA_ARGS__ ); \ + if( Catch::getResultCapture().lastAssertionPassed() ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_ELSE( macroName, resultDisposition, ... ) \ + INTERNAL_CATCH_TEST( macroName, resultDisposition, __VA_ARGS__ ); \ + if( !Catch::getResultCapture().lastAssertionPassed() ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_NO_THROW( macroName, resultDisposition, ... ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, CATCH_INTERNAL_STRINGIFY(__VA_ARGS__), resultDisposition ); \ + try { \ + static_cast(__VA_ARGS__); \ + catchAssertionHandler.handleExceptionNotThrownAsExpected(); \ + } \ + catch( ... ) { \ + catchAssertionHandler.handleUnexpectedInflightException(); \ + } \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( false ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_THROWS( macroName, resultDisposition, ... ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, CATCH_INTERNAL_STRINGIFY(__VA_ARGS__), resultDisposition); \ + if( catchAssertionHandler.allowThrows() ) \ + try { \ + static_cast(__VA_ARGS__); \ + catchAssertionHandler.handleUnexpectedExceptionNotThrown(); \ + } \ + catch( ... ) { \ + catchAssertionHandler.handleExceptionThrownAsExpected(); \ + } \ + else \ + catchAssertionHandler.handleThrowingCallSkipped(); \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( false ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_THROWS_AS( macroName, exceptionType, resultDisposition, expr ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, CATCH_INTERNAL_STRINGIFY(expr) ", " CATCH_INTERNAL_STRINGIFY(exceptionType), resultDisposition ); \ + if( catchAssertionHandler.allowThrows() ) \ + try { \ + static_cast(expr); \ + catchAssertionHandler.handleUnexpectedExceptionNotThrown(); \ + } \ + catch( exceptionType const& ) { \ + catchAssertionHandler.handleExceptionThrownAsExpected(); \ + } \ + catch( ... ) { \ + catchAssertionHandler.handleUnexpectedInflightException(); \ + } \ + else \ + catchAssertionHandler.handleThrowingCallSkipped(); \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( false ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_MSG( macroName, messageType, resultDisposition, ... ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, Catch::StringRef(), resultDisposition ); \ + catchAssertionHandler.handleMessage( messageType, ( Catch::MessageStream() << __VA_ARGS__ + ::Catch::StreamEndStop() ).m_stream.str() ); \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( false ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_CAPTURE( varName, macroName, ... ) \ + auto varName = Catch::Capturer( macroName, CATCH_INTERNAL_LINEINFO, Catch::ResultWas::Info, #__VA_ARGS__ ); \ + varName.captureValues( 0, __VA_ARGS__ ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_INFO( macroName, log ) \ + Catch::ScopedMessage INTERNAL_CATCH_UNIQUE_NAME( scopedMessage )( Catch::MessageBuilder( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, Catch::ResultWas::Info ) << log ); + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_UNSCOPED_INFO( macroName, log ) \ + Catch::getResultCapture().emplaceUnscopedMessage( Catch::MessageBuilder( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, Catch::ResultWas::Info ) << log ) + +/////////////////////////////////////////////////////////////////////////////// +// Although this is matcher-based, it can be used with just a string +#define INTERNAL_CATCH_THROWS_STR_MATCHES( macroName, resultDisposition, matcher, ... ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, CATCH_INTERNAL_STRINGIFY(__VA_ARGS__) ", " CATCH_INTERNAL_STRINGIFY(matcher), resultDisposition ); \ + if( catchAssertionHandler.allowThrows() ) \ + try { \ + static_cast(__VA_ARGS__); \ + catchAssertionHandler.handleUnexpectedExceptionNotThrown(); \ + } \ + catch( ... ) { \ + Catch::handleExceptionMatchExpr( catchAssertionHandler, matcher, #matcher##_catch_sr ); \ + } \ + else \ + catchAssertionHandler.handleThrowingCallSkipped(); \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( false ) + +#endif // CATCH_CONFIG_DISABLE + +// end catch_capture.hpp +// start catch_section.h + +// start catch_section_info.h + +// start catch_totals.h + +#include + +namespace Catch { + + struct Counts { + Counts operator - ( Counts const& other ) const; + Counts& operator += ( Counts const& other ); + + std::size_t total() const; + bool allPassed() const; + bool allOk() const; + + std::size_t passed = 0; + std::size_t failed = 0; + std::size_t failedButOk = 0; + }; + + struct Totals { + + Totals operator - ( Totals const& other ) const; + Totals& operator += ( Totals const& other ); + + Totals delta( Totals const& prevTotals ) const; + + int error = 0; + Counts assertions; + Counts testCases; + }; +} + +// end catch_totals.h +#include + +namespace Catch { + + struct SectionInfo { + SectionInfo + ( SourceLineInfo const& _lineInfo, + std::string const& _name ); + + // Deprecated + SectionInfo + ( SourceLineInfo const& _lineInfo, + std::string const& _name, + std::string const& ) : SectionInfo( _lineInfo, _name ) {} + + std::string name; + std::string description; // !Deprecated: this will always be empty + SourceLineInfo lineInfo; + }; + + struct SectionEndInfo { + SectionInfo sectionInfo; + Counts prevAssertions; + double durationInSeconds; + }; + +} // end namespace Catch + +// end catch_section_info.h +// start catch_timer.h + +#include + +namespace Catch { + + auto getCurrentNanosecondsSinceEpoch() -> uint64_t; + auto getEstimatedClockResolution() -> uint64_t; + + class Timer { + uint64_t m_nanoseconds = 0; + public: + void start(); + auto getElapsedNanoseconds() const -> uint64_t; + auto getElapsedMicroseconds() const -> uint64_t; + auto getElapsedMilliseconds() const -> unsigned int; + auto getElapsedSeconds() const -> double; + }; + +} // namespace Catch + +// end catch_timer.h +#include + +namespace Catch { + + class Section : NonCopyable { + public: + Section( SectionInfo const& info ); + ~Section(); + + // This indicates whether the section should be executed or not + explicit operator bool() const; + + private: + SectionInfo m_info; + + std::string m_name; + Counts m_assertions; + bool m_sectionIncluded; + Timer m_timer; + }; + +} // end namespace Catch + +#define INTERNAL_CATCH_SECTION( ... ) \ + CATCH_INTERNAL_SUPPRESS_UNUSED_WARNINGS \ + if( Catch::Section const& INTERNAL_CATCH_UNIQUE_NAME( catch_internal_Section ) = Catch::SectionInfo( CATCH_INTERNAL_LINEINFO, __VA_ARGS__ ) ) \ + CATCH_INTERNAL_UNSUPPRESS_UNUSED_WARNINGS + +#define INTERNAL_CATCH_DYNAMIC_SECTION( ... ) \ + CATCH_INTERNAL_SUPPRESS_UNUSED_WARNINGS \ + if( Catch::Section const& INTERNAL_CATCH_UNIQUE_NAME( catch_internal_Section ) = Catch::SectionInfo( CATCH_INTERNAL_LINEINFO, (Catch::ReusableStringStream() << __VA_ARGS__).str() ) ) \ + CATCH_INTERNAL_UNSUPPRESS_UNUSED_WARNINGS + +// end catch_section.h +// start catch_benchmark.h + +#include +#include + +namespace Catch { + + class BenchmarkLooper { + + std::string m_name; + std::size_t m_count = 0; + std::size_t m_iterationsToRun = 1; + uint64_t m_resolution; + Timer m_timer; + + static auto getResolution() -> uint64_t; + public: + // Keep most of this inline as it's on the code path that is being timed + BenchmarkLooper( StringRef name ) + : m_name( name ), + m_resolution( getResolution() ) + { + reportStart(); + m_timer.start(); + } + + explicit operator bool() { + if( m_count < m_iterationsToRun ) + return true; + return needsMoreIterations(); + } + + void increment() { + ++m_count; + } + + void reportStart(); + auto needsMoreIterations() -> bool; + }; + +} // end namespace Catch + +#define BENCHMARK( name ) \ + for( Catch::BenchmarkLooper looper( name ); looper; looper.increment() ) + +// end catch_benchmark.h +// start catch_interfaces_exception.h + +// start catch_interfaces_registry_hub.h + +#include +#include + +namespace Catch { + + class TestCase; + struct ITestCaseRegistry; + struct IExceptionTranslatorRegistry; + struct IExceptionTranslator; + struct IReporterRegistry; + struct IReporterFactory; + struct ITagAliasRegistry; + class StartupExceptionRegistry; + + using IReporterFactoryPtr = std::shared_ptr; + + struct IRegistryHub { + virtual ~IRegistryHub(); + + virtual IReporterRegistry const& getReporterRegistry() const = 0; + virtual ITestCaseRegistry const& getTestCaseRegistry() const = 0; + virtual ITagAliasRegistry const& getTagAliasRegistry() const = 0; + + virtual IExceptionTranslatorRegistry const& getExceptionTranslatorRegistry() const = 0; + + virtual StartupExceptionRegistry const& getStartupExceptionRegistry() const = 0; + }; + + struct IMutableRegistryHub { + virtual ~IMutableRegistryHub(); + virtual void registerReporter( std::string const& name, IReporterFactoryPtr const& factory ) = 0; + virtual void registerListener( IReporterFactoryPtr const& factory ) = 0; + virtual void registerTest( TestCase const& testInfo ) = 0; + virtual void registerTranslator( const IExceptionTranslator* translator ) = 0; + virtual void registerTagAlias( std::string const& alias, std::string const& tag, SourceLineInfo const& lineInfo ) = 0; + virtual void registerStartupException() noexcept = 0; + }; + + IRegistryHub const& getRegistryHub(); + IMutableRegistryHub& getMutableRegistryHub(); + void cleanUp(); + std::string translateActiveException(); + +} + +// end catch_interfaces_registry_hub.h +#if defined(CATCH_CONFIG_DISABLE) + #define INTERNAL_CATCH_TRANSLATE_EXCEPTION_NO_REG( translatorName, signature) \ + static std::string translatorName( signature ) +#endif + +#include +#include +#include + +namespace Catch { + using exceptionTranslateFunction = std::string(*)(); + + struct IExceptionTranslator; + using ExceptionTranslators = std::vector>; + + struct IExceptionTranslator { + virtual ~IExceptionTranslator(); + virtual std::string translate( ExceptionTranslators::const_iterator it, ExceptionTranslators::const_iterator itEnd ) const = 0; + }; + + struct IExceptionTranslatorRegistry { + virtual ~IExceptionTranslatorRegistry(); + + virtual std::string translateActiveException() const = 0; + }; + + class ExceptionTranslatorRegistrar { + template + class ExceptionTranslator : public IExceptionTranslator { + public: + + ExceptionTranslator( std::string(*translateFunction)( T& ) ) + : m_translateFunction( translateFunction ) + {} + + std::string translate( ExceptionTranslators::const_iterator it, ExceptionTranslators::const_iterator itEnd ) const override { + try { + if( it == itEnd ) + std::rethrow_exception(std::current_exception()); + else + return (*it)->translate( it+1, itEnd ); + } + catch( T& ex ) { + return m_translateFunction( ex ); + } + } + + protected: + std::string(*m_translateFunction)( T& ); + }; + + public: + template + ExceptionTranslatorRegistrar( std::string(*translateFunction)( T& ) ) { + getMutableRegistryHub().registerTranslator + ( new ExceptionTranslator( translateFunction ) ); + } + }; +} + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_TRANSLATE_EXCEPTION2( translatorName, signature ) \ + static std::string translatorName( signature ); \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ Catch::ExceptionTranslatorRegistrar INTERNAL_CATCH_UNIQUE_NAME( catch_internal_ExceptionRegistrar )( &translatorName ); } \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS \ + static std::string translatorName( signature ) + +#define INTERNAL_CATCH_TRANSLATE_EXCEPTION( signature ) INTERNAL_CATCH_TRANSLATE_EXCEPTION2( INTERNAL_CATCH_UNIQUE_NAME( catch_internal_ExceptionTranslator ), signature ) + +// end catch_interfaces_exception.h +// start catch_approx.h + +#include + +namespace Catch { +namespace Detail { + + class Approx { + private: + bool equalityComparisonImpl(double other) const; + // Validates the new margin (margin >= 0) + // out-of-line to avoid including stdexcept in the header + void setMargin(double margin); + // Validates the new epsilon (0 < epsilon < 1) + // out-of-line to avoid including stdexcept in the header + void setEpsilon(double epsilon); + + public: + explicit Approx ( double value ); + + static Approx custom(); + + Approx operator-() const; + + template ::value>::type> + Approx operator()( T const& value ) { + Approx approx( static_cast(value) ); + approx.m_epsilon = m_epsilon; + approx.m_margin = m_margin; + approx.m_scale = m_scale; + return approx; + } + + template ::value>::type> + explicit Approx( T const& value ): Approx(static_cast(value)) + {} + + template ::value>::type> + friend bool operator == ( const T& lhs, Approx const& rhs ) { + auto lhs_v = static_cast(lhs); + return rhs.equalityComparisonImpl(lhs_v); + } + + template ::value>::type> + friend bool operator == ( Approx const& lhs, const T& rhs ) { + return operator==( rhs, lhs ); + } + + template ::value>::type> + friend bool operator != ( T const& lhs, Approx const& rhs ) { + return !operator==( lhs, rhs ); + } + + template ::value>::type> + friend bool operator != ( Approx const& lhs, T const& rhs ) { + return !operator==( rhs, lhs ); + } + + template ::value>::type> + friend bool operator <= ( T const& lhs, Approx const& rhs ) { + return static_cast(lhs) < rhs.m_value || lhs == rhs; + } + + template ::value>::type> + friend bool operator <= ( Approx const& lhs, T const& rhs ) { + return lhs.m_value < static_cast(rhs) || lhs == rhs; + } + + template ::value>::type> + friend bool operator >= ( T const& lhs, Approx const& rhs ) { + return static_cast(lhs) > rhs.m_value || lhs == rhs; + } + + template ::value>::type> + friend bool operator >= ( Approx const& lhs, T const& rhs ) { + return lhs.m_value > static_cast(rhs) || lhs == rhs; + } + + template ::value>::type> + Approx& epsilon( T const& newEpsilon ) { + double epsilonAsDouble = static_cast(newEpsilon); + setEpsilon(epsilonAsDouble); + return *this; + } + + template ::value>::type> + Approx& margin( T const& newMargin ) { + double marginAsDouble = static_cast(newMargin); + setMargin(marginAsDouble); + return *this; + } + + template ::value>::type> + Approx& scale( T const& newScale ) { + m_scale = static_cast(newScale); + return *this; + } + + std::string toString() const; + + private: + double m_epsilon; + double m_margin; + double m_scale; + double m_value; + }; +} // end namespace Detail + +namespace literals { + Detail::Approx operator "" _a(long double val); + Detail::Approx operator "" _a(unsigned long long val); +} // end namespace literals + +template<> +struct StringMaker { + static std::string convert(Catch::Detail::Approx const& value); +}; + +} // end namespace Catch + +// end catch_approx.h +// start catch_string_manip.h + +#include +#include + +namespace Catch { + + bool startsWith( std::string const& s, std::string const& prefix ); + bool startsWith( std::string const& s, char prefix ); + bool endsWith( std::string const& s, std::string const& suffix ); + bool endsWith( std::string const& s, char suffix ); + bool contains( std::string const& s, std::string const& infix ); + void toLowerInPlace( std::string& s ); + std::string toLower( std::string const& s ); + std::string trim( std::string const& str ); + bool replaceInPlace( std::string& str, std::string const& replaceThis, std::string const& withThis ); + + struct pluralise { + pluralise( std::size_t count, std::string const& label ); + + friend std::ostream& operator << ( std::ostream& os, pluralise const& pluraliser ); + + std::size_t m_count; + std::string m_label; + }; +} + +// end catch_string_manip.h +#ifndef CATCH_CONFIG_DISABLE_MATCHERS +// start catch_capture_matchers.h + +// start catch_matchers.h + +#include +#include + +namespace Catch { +namespace Matchers { + namespace Impl { + + template struct MatchAllOf; + template struct MatchAnyOf; + template struct MatchNotOf; + + class MatcherUntypedBase { + public: + MatcherUntypedBase() = default; + MatcherUntypedBase ( MatcherUntypedBase const& ) = default; + MatcherUntypedBase& operator = ( MatcherUntypedBase const& ) = delete; + std::string toString() const; + + protected: + virtual ~MatcherUntypedBase(); + virtual std::string describe() const = 0; + mutable std::string m_cachedToString; + }; + +#ifdef __clang__ +# pragma clang diagnostic push +# pragma clang diagnostic ignored "-Wnon-virtual-dtor" +#endif + + template + struct MatcherMethod { + virtual bool match( ObjectT const& arg ) const = 0; + }; + +#ifdef __clang__ +# pragma clang diagnostic pop +#endif + + template + struct MatcherBase : MatcherUntypedBase, MatcherMethod { + + MatchAllOf operator && ( MatcherBase const& other ) const; + MatchAnyOf operator || ( MatcherBase const& other ) const; + MatchNotOf operator ! () const; + }; + + template + struct MatchAllOf : MatcherBase { + bool match( ArgT const& arg ) const override { + for( auto matcher : m_matchers ) { + if (!matcher->match(arg)) + return false; + } + return true; + } + std::string describe() const override { + std::string description; + description.reserve( 4 + m_matchers.size()*32 ); + description += "( "; + bool first = true; + for( auto matcher : m_matchers ) { + if( first ) + first = false; + else + description += " and "; + description += matcher->toString(); + } + description += " )"; + return description; + } + + MatchAllOf& operator && ( MatcherBase const& other ) { + m_matchers.push_back( &other ); + return *this; + } + + std::vector const*> m_matchers; + }; + template + struct MatchAnyOf : MatcherBase { + + bool match( ArgT const& arg ) const override { + for( auto matcher : m_matchers ) { + if (matcher->match(arg)) + return true; + } + return false; + } + std::string describe() const override { + std::string description; + description.reserve( 4 + m_matchers.size()*32 ); + description += "( "; + bool first = true; + for( auto matcher : m_matchers ) { + if( first ) + first = false; + else + description += " or "; + description += matcher->toString(); + } + description += " )"; + return description; + } + + MatchAnyOf& operator || ( MatcherBase const& other ) { + m_matchers.push_back( &other ); + return *this; + } + + std::vector const*> m_matchers; + }; + + template + struct MatchNotOf : MatcherBase { + + MatchNotOf( MatcherBase const& underlyingMatcher ) : m_underlyingMatcher( underlyingMatcher ) {} + + bool match( ArgT const& arg ) const override { + return !m_underlyingMatcher.match( arg ); + } + + std::string describe() const override { + return "not " + m_underlyingMatcher.toString(); + } + MatcherBase const& m_underlyingMatcher; + }; + + template + MatchAllOf MatcherBase::operator && ( MatcherBase const& other ) const { + return MatchAllOf() && *this && other; + } + template + MatchAnyOf MatcherBase::operator || ( MatcherBase const& other ) const { + return MatchAnyOf() || *this || other; + } + template + MatchNotOf MatcherBase::operator ! () const { + return MatchNotOf( *this ); + } + + } // namespace Impl + +} // namespace Matchers + +using namespace Matchers; +using Matchers::Impl::MatcherBase; + +} // namespace Catch + +// end catch_matchers.h +// start catch_matchers_floating.h + +#include +#include + +namespace Catch { +namespace Matchers { + + namespace Floating { + + enum class FloatingPointKind : uint8_t; + + struct WithinAbsMatcher : MatcherBase { + WithinAbsMatcher(double target, double margin); + bool match(double const& matchee) const override; + std::string describe() const override; + private: + double m_target; + double m_margin; + }; + + struct WithinUlpsMatcher : MatcherBase { + WithinUlpsMatcher(double target, int ulps, FloatingPointKind baseType); + bool match(double const& matchee) const override; + std::string describe() const override; + private: + double m_target; + int m_ulps; + FloatingPointKind m_type; + }; + + } // namespace Floating + + // The following functions create the actual matcher objects. + // This allows the types to be inferred + Floating::WithinUlpsMatcher WithinULP(double target, int maxUlpDiff); + Floating::WithinUlpsMatcher WithinULP(float target, int maxUlpDiff); + Floating::WithinAbsMatcher WithinAbs(double target, double margin); + +} // namespace Matchers +} // namespace Catch + +// end catch_matchers_floating.h +// start catch_matchers_generic.hpp + +#include +#include + +namespace Catch { +namespace Matchers { +namespace Generic { + +namespace Detail { + std::string finalizeDescription(const std::string& desc); +} + +template +class PredicateMatcher : public MatcherBase { + std::function m_predicate; + std::string m_description; +public: + + PredicateMatcher(std::function const& elem, std::string const& descr) + :m_predicate(std::move(elem)), + m_description(Detail::finalizeDescription(descr)) + {} + + bool match( T const& item ) const override { + return m_predicate(item); + } + + std::string describe() const override { + return m_description; + } +}; + +} // namespace Generic + + // The following functions create the actual matcher objects. + // The user has to explicitly specify type to the function, because + // infering std::function is hard (but possible) and + // requires a lot of TMP. + template + Generic::PredicateMatcher Predicate(std::function const& predicate, std::string const& description = "") { + return Generic::PredicateMatcher(predicate, description); + } + +} // namespace Matchers +} // namespace Catch + +// end catch_matchers_generic.hpp +// start catch_matchers_string.h + +#include + +namespace Catch { +namespace Matchers { + + namespace StdString { + + struct CasedString + { + CasedString( std::string const& str, CaseSensitive::Choice caseSensitivity ); + std::string adjustString( std::string const& str ) const; + std::string caseSensitivitySuffix() const; + + CaseSensitive::Choice m_caseSensitivity; + std::string m_str; + }; + + struct StringMatcherBase : MatcherBase { + StringMatcherBase( std::string const& operation, CasedString const& comparator ); + std::string describe() const override; + + CasedString m_comparator; + std::string m_operation; + }; + + struct EqualsMatcher : StringMatcherBase { + EqualsMatcher( CasedString const& comparator ); + bool match( std::string const& source ) const override; + }; + struct ContainsMatcher : StringMatcherBase { + ContainsMatcher( CasedString const& comparator ); + bool match( std::string const& source ) const override; + }; + struct StartsWithMatcher : StringMatcherBase { + StartsWithMatcher( CasedString const& comparator ); + bool match( std::string const& source ) const override; + }; + struct EndsWithMatcher : StringMatcherBase { + EndsWithMatcher( CasedString const& comparator ); + bool match( std::string const& source ) const override; + }; + + struct RegexMatcher : MatcherBase { + RegexMatcher( std::string regex, CaseSensitive::Choice caseSensitivity ); + bool match( std::string const& matchee ) const override; + std::string describe() const override; + + private: + std::string m_regex; + CaseSensitive::Choice m_caseSensitivity; + }; + + } // namespace StdString + + // The following functions create the actual matcher objects. + // This allows the types to be inferred + + StdString::EqualsMatcher Equals( std::string const& str, CaseSensitive::Choice caseSensitivity = CaseSensitive::Yes ); + StdString::ContainsMatcher Contains( std::string const& str, CaseSensitive::Choice caseSensitivity = CaseSensitive::Yes ); + StdString::EndsWithMatcher EndsWith( std::string const& str, CaseSensitive::Choice caseSensitivity = CaseSensitive::Yes ); + StdString::StartsWithMatcher StartsWith( std::string const& str, CaseSensitive::Choice caseSensitivity = CaseSensitive::Yes ); + StdString::RegexMatcher Matches( std::string const& regex, CaseSensitive::Choice caseSensitivity = CaseSensitive::Yes ); + +} // namespace Matchers +} // namespace Catch + +// end catch_matchers_string.h +// start catch_matchers_vector.h + +#include + +namespace Catch { +namespace Matchers { + + namespace Vector { + namespace Detail { + template + size_t count(InputIterator first, InputIterator last, T const& item) { + size_t cnt = 0; + for (; first != last; ++first) { + if (*first == item) { + ++cnt; + } + } + return cnt; + } + template + bool contains(InputIterator first, InputIterator last, T const& item) { + for (; first != last; ++first) { + if (*first == item) { + return true; + } + } + return false; + } + } + + template + struct ContainsElementMatcher : MatcherBase> { + + ContainsElementMatcher(T const &comparator) : m_comparator( comparator) {} + + bool match(std::vector const &v) const override { + for (auto const& el : v) { + if (el == m_comparator) { + return true; + } + } + return false; + } + + std::string describe() const override { + return "Contains: " + ::Catch::Detail::stringify( m_comparator ); + } + + T const& m_comparator; + }; + + template + struct ContainsMatcher : MatcherBase> { + + ContainsMatcher(std::vector const &comparator) : m_comparator( comparator ) {} + + bool match(std::vector const &v) const override { + // !TBD: see note in EqualsMatcher + if (m_comparator.size() > v.size()) + return false; + for (auto const& comparator : m_comparator) { + auto present = false; + for (const auto& el : v) { + if (el == comparator) { + present = true; + break; + } + } + if (!present) { + return false; + } + } + return true; + } + std::string describe() const override { + return "Contains: " + ::Catch::Detail::stringify( m_comparator ); + } + + std::vector const& m_comparator; + }; + + template + struct EqualsMatcher : MatcherBase> { + + EqualsMatcher(std::vector const &comparator) : m_comparator( comparator ) {} + + bool match(std::vector const &v) const override { + // !TBD: This currently works if all elements can be compared using != + // - a more general approach would be via a compare template that defaults + // to using !=. but could be specialised for, e.g. std::vector etc + // - then just call that directly + if (m_comparator.size() != v.size()) + return false; + for (std::size_t i = 0; i < v.size(); ++i) + if (m_comparator[i] != v[i]) + return false; + return true; + } + std::string describe() const override { + return "Equals: " + ::Catch::Detail::stringify( m_comparator ); + } + std::vector const& m_comparator; + }; + + template + struct UnorderedEqualsMatcher : MatcherBase> { + UnorderedEqualsMatcher(std::vector const& target) : m_target(target) {} + bool match(std::vector const& vec) const override { + // Note: This is a reimplementation of std::is_permutation, + // because I don't want to include inside the common path + if (m_target.size() != vec.size()) { + return false; + } + auto lfirst = m_target.begin(), llast = m_target.end(); + auto rfirst = vec.begin(), rlast = vec.end(); + // Cut common prefix to optimize checking of permuted parts + while (lfirst != llast && *lfirst == *rfirst) { + ++lfirst; ++rfirst; + } + if (lfirst == llast) { + return true; + } + + for (auto mid = lfirst; mid != llast; ++mid) { + // Skip already counted items + if (Detail::contains(lfirst, mid, *mid)) { + continue; + } + size_t num_vec = Detail::count(rfirst, rlast, *mid); + if (num_vec == 0 || Detail::count(lfirst, llast, *mid) != num_vec) { + return false; + } + } + + return true; + } + + std::string describe() const override { + return "UnorderedEquals: " + ::Catch::Detail::stringify(m_target); + } + private: + std::vector const& m_target; + }; + + } // namespace Vector + + // The following functions create the actual matcher objects. + // This allows the types to be inferred + + template + Vector::ContainsMatcher Contains( std::vector const& comparator ) { + return Vector::ContainsMatcher( comparator ); + } + + template + Vector::ContainsElementMatcher VectorContains( T const& comparator ) { + return Vector::ContainsElementMatcher( comparator ); + } + + template + Vector::EqualsMatcher Equals( std::vector const& comparator ) { + return Vector::EqualsMatcher( comparator ); + } + + template + Vector::UnorderedEqualsMatcher UnorderedEquals(std::vector const& target) { + return Vector::UnorderedEqualsMatcher(target); + } + +} // namespace Matchers +} // namespace Catch + +// end catch_matchers_vector.h +namespace Catch { + + template + class MatchExpr : public ITransientExpression { + ArgT const& m_arg; + MatcherT m_matcher; + StringRef m_matcherString; + public: + MatchExpr( ArgT const& arg, MatcherT const& matcher, StringRef const& matcherString ) + : ITransientExpression{ true, matcher.match( arg ) }, + m_arg( arg ), + m_matcher( matcher ), + m_matcherString( matcherString ) + {} + + void streamReconstructedExpression( std::ostream &os ) const override { + auto matcherAsString = m_matcher.toString(); + os << Catch::Detail::stringify( m_arg ) << ' '; + if( matcherAsString == Detail::unprintableString ) + os << m_matcherString; + else + os << matcherAsString; + } + }; + + using StringMatcher = Matchers::Impl::MatcherBase; + + void handleExceptionMatchExpr( AssertionHandler& handler, StringMatcher const& matcher, StringRef const& matcherString ); + + template + auto makeMatchExpr( ArgT const& arg, MatcherT const& matcher, StringRef const& matcherString ) -> MatchExpr { + return MatchExpr( arg, matcher, matcherString ); + } + +} // namespace Catch + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CHECK_THAT( macroName, matcher, resultDisposition, arg ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, CATCH_INTERNAL_STRINGIFY(arg) ", " CATCH_INTERNAL_STRINGIFY(matcher), resultDisposition ); \ + INTERNAL_CATCH_TRY { \ + catchAssertionHandler.handleExpr( Catch::makeMatchExpr( arg, matcher, #matcher##_catch_sr ) ); \ + } INTERNAL_CATCH_CATCH( catchAssertionHandler ) \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( false ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_THROWS_MATCHES( macroName, exceptionType, resultDisposition, matcher, ... ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, CATCH_INTERNAL_STRINGIFY(__VA_ARGS__) ", " CATCH_INTERNAL_STRINGIFY(exceptionType) ", " CATCH_INTERNAL_STRINGIFY(matcher), resultDisposition ); \ + if( catchAssertionHandler.allowThrows() ) \ + try { \ + static_cast(__VA_ARGS__ ); \ + catchAssertionHandler.handleUnexpectedExceptionNotThrown(); \ + } \ + catch( exceptionType const& ex ) { \ + catchAssertionHandler.handleExpr( Catch::makeMatchExpr( ex, matcher, #matcher##_catch_sr ) ); \ + } \ + catch( ... ) { \ + catchAssertionHandler.handleUnexpectedInflightException(); \ + } \ + else \ + catchAssertionHandler.handleThrowingCallSkipped(); \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( false ) + +// end catch_capture_matchers.h +#endif +// start catch_generators.hpp + +// start catch_interfaces_generatortracker.h + + +#include + +namespace Catch { + + namespace Generators { + class GeneratorUntypedBase { + public: + GeneratorUntypedBase() = default; + virtual ~GeneratorUntypedBase(); + // Attempts to move the generator to the next element + // + // Returns true iff the move succeeded (and a valid element + // can be retrieved). + virtual bool next() = 0; + }; + using GeneratorBasePtr = std::unique_ptr; + + } // namespace Generators + + struct IGeneratorTracker { + virtual ~IGeneratorTracker(); + virtual auto hasGenerator() const -> bool = 0; + virtual auto getGenerator() const -> Generators::GeneratorBasePtr const& = 0; + virtual void setGenerator( Generators::GeneratorBasePtr&& generator ) = 0; + }; + +} // namespace Catch + +// end catch_interfaces_generatortracker.h +// start catch_enforce.h + +#include + +namespace Catch { +#if !defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) + template + [[noreturn]] + void throw_exception(Ex const& e) { + throw e; + } +#else // ^^ Exceptions are enabled // Exceptions are disabled vv + [[noreturn]] + void throw_exception(std::exception const& e); +#endif +} // namespace Catch; + +#define CATCH_PREPARE_EXCEPTION( type, msg ) \ + type( ( Catch::ReusableStringStream() << msg ).str() ) +#define CATCH_INTERNAL_ERROR( msg ) \ + Catch::throw_exception(CATCH_PREPARE_EXCEPTION( std::logic_error, CATCH_INTERNAL_LINEINFO << ": Internal Catch error: " << msg)) +#define CATCH_ERROR( msg ) \ + Catch::throw_exception(CATCH_PREPARE_EXCEPTION( std::domain_error, msg )) +#define CATCH_RUNTIME_ERROR( msg ) \ + Catch::throw_exception(CATCH_PREPARE_EXCEPTION( std::runtime_error, msg )) +#define CATCH_ENFORCE( condition, msg ) \ + do{ if( !(condition) ) CATCH_ERROR( msg ); } while(false) + +// end catch_enforce.h +#include +#include +#include + +#include +#include + +namespace Catch { + +class GeneratorException : public std::exception { + const char* const m_msg = ""; + +public: + GeneratorException(const char* msg): + m_msg(msg) + {} + + const char* what() const noexcept override final; +}; + +namespace Generators { + + // !TBD move this into its own location? + namespace pf{ + template + std::unique_ptr make_unique( Args&&... args ) { + return std::unique_ptr(new T(std::forward(args)...)); + } + } + + template + struct IGenerator : GeneratorUntypedBase { + virtual ~IGenerator() = default; + + // Returns the current element of the generator + // + // \Precondition The generator is either freshly constructed, + // or the last call to `next()` returned true + virtual T const& get() const = 0; + using type = T; + }; + + template + class SingleValueGenerator final : public IGenerator { + T m_value; + public: + SingleValueGenerator(T const& value) : m_value( value ) {} + SingleValueGenerator(T&& value) : m_value(std::move(value)) {} + + T const& get() const override { + return m_value; + } + bool next() override { + return false; + } + }; + + template + class FixedValuesGenerator final : public IGenerator { + std::vector m_values; + size_t m_idx = 0; + public: + FixedValuesGenerator( std::initializer_list values ) : m_values( values ) {} + + T const& get() const override { + return m_values[m_idx]; + } + bool next() override { + ++m_idx; + return m_idx < m_values.size(); + } + }; + + template + class GeneratorWrapper final { + std::unique_ptr> m_generator; + public: + GeneratorWrapper(std::unique_ptr> generator): + m_generator(std::move(generator)) + {} + T const& get() const { + return m_generator->get(); + } + bool next() { + return m_generator->next(); + } + }; + + template + GeneratorWrapper value(T&& value) { + return GeneratorWrapper(pf::make_unique>(std::forward(value))); + } + template + GeneratorWrapper values(std::initializer_list values) { + return GeneratorWrapper(pf::make_unique>(values)); + } + + template + class Generators : public IGenerator { + std::vector> m_generators; + size_t m_current = 0; + + void populate(GeneratorWrapper&& generator) { + m_generators.emplace_back(std::move(generator)); + } + void populate(T&& val) { + m_generators.emplace_back(value(std::move(val))); + } + template + void populate(U&& val) { + populate(T(std::move(val))); + } + template + void populate(U&& valueOrGenerator, Gs... moreGenerators) { + populate(std::forward(valueOrGenerator)); + populate(std::forward(moreGenerators)...); + } + + public: + template + Generators(Gs... moreGenerators) { + m_generators.reserve(sizeof...(Gs)); + populate(std::forward(moreGenerators)...); + } + + T const& get() const override { + return m_generators[m_current].get(); + } + + bool next() override { + if (m_current >= m_generators.size()) { + return false; + } + const bool current_status = m_generators[m_current].next(); + if (!current_status) { + ++m_current; + } + return m_current < m_generators.size(); + } + }; + + template + GeneratorWrapper> table( std::initializer_list::type...>> tuples ) { + return values>( tuples ); + } + + // Tag type to signal that a generator sequence should convert arguments to a specific type + template + struct as {}; + + template + auto makeGenerators( GeneratorWrapper&& generator, Gs... moreGenerators ) -> Generators { + return Generators(std::move(generator), std::forward(moreGenerators)...); + } + template + auto makeGenerators( GeneratorWrapper&& generator ) -> Generators { + return Generators(std::move(generator)); + } + template + auto makeGenerators( T&& val, Gs... moreGenerators ) -> Generators { + return makeGenerators( value( std::forward( val ) ), std::forward( moreGenerators )... ); + } + template + auto makeGenerators( as, U&& val, Gs... moreGenerators ) -> Generators { + return makeGenerators( value( T( std::forward( val ) ) ), std::forward( moreGenerators )... ); + } + + auto acquireGeneratorTracker( SourceLineInfo const& lineInfo ) -> IGeneratorTracker&; + + template + // Note: The type after -> is weird, because VS2015 cannot parse + // the expression used in the typedef inside, when it is in + // return type. Yeah. + auto generate( SourceLineInfo const& lineInfo, L const& generatorExpression ) -> decltype(std::declval().get()) { + using UnderlyingType = typename decltype(generatorExpression())::type; + + IGeneratorTracker& tracker = acquireGeneratorTracker( lineInfo ); + if (!tracker.hasGenerator()) { + tracker.setGenerator(pf::make_unique>(generatorExpression())); + } + + auto const& generator = static_cast const&>( *tracker.getGenerator() ); + return generator.get(); + } + +} // namespace Generators +} // namespace Catch + +#define GENERATE( ... ) \ + Catch::Generators::generate( CATCH_INTERNAL_LINEINFO, []{ using namespace Catch::Generators; return makeGenerators( __VA_ARGS__ ); } ) + +// end catch_generators.hpp +// start catch_generators_generic.hpp + +namespace Catch { +namespace Generators { + + template + class TakeGenerator : public IGenerator { + GeneratorWrapper m_generator; + size_t m_returned = 0; + size_t m_target; + public: + TakeGenerator(size_t target, GeneratorWrapper&& generator): + m_generator(std::move(generator)), + m_target(target) + { + assert(target != 0 && "Empty generators are not allowed"); + } + T const& get() const override { + return m_generator.get(); + } + bool next() override { + ++m_returned; + if (m_returned >= m_target) { + return false; + } + + const auto success = m_generator.next(); + // If the underlying generator does not contain enough values + // then we cut short as well + if (!success) { + m_returned = m_target; + } + return success; + } + }; + + template + GeneratorWrapper take(size_t target, GeneratorWrapper&& generator) { + return GeneratorWrapper(pf::make_unique>(target, std::move(generator))); + } + + template + class FilterGenerator : public IGenerator { + GeneratorWrapper m_generator; + Predicate m_predicate; + public: + template + FilterGenerator(P&& pred, GeneratorWrapper&& generator): + m_generator(std::move(generator)), + m_predicate(std::forward

(pred)) + { + if (!m_predicate(m_generator.get())) { + // It might happen that there are no values that pass the + // filter. In that case we throw an exception. + auto has_initial_value = next(); + if (!has_initial_value) { + Catch::throw_exception(GeneratorException("No valid value found in filtered generator")); + } + } + } + + T const& get() const override { + return m_generator.get(); + } + + bool next() override { + bool success = m_generator.next(); + if (!success) { + return false; + } + while (!m_predicate(m_generator.get()) && (success = m_generator.next()) == true); + return success; + } + }; + + template + GeneratorWrapper filter(Predicate&& pred, GeneratorWrapper&& generator) { + return GeneratorWrapper(std::unique_ptr>(pf::make_unique>(std::forward(pred), std::move(generator)))); + } + + template + class RepeatGenerator : public IGenerator { + GeneratorWrapper m_generator; + mutable std::vector m_returned; + size_t m_target_repeats; + size_t m_current_repeat = 0; + size_t m_repeat_index = 0; + public: + RepeatGenerator(size_t repeats, GeneratorWrapper&& generator): + m_generator(std::move(generator)), + m_target_repeats(repeats) + { + assert(m_target_repeats > 0 && "Repeat generator must repeat at least once"); + } + + T const& get() const override { + if (m_current_repeat == 0) { + m_returned.push_back(m_generator.get()); + return m_returned.back(); + } + return m_returned[m_repeat_index]; + } + + bool next() override { + // There are 2 basic cases: + // 1) We are still reading the generator + // 2) We are reading our own cache + + // In the first case, we need to poke the underlying generator. + // If it happily moves, we are left in that state, otherwise it is time to start reading from our cache + if (m_current_repeat == 0) { + const auto success = m_generator.next(); + if (!success) { + ++m_current_repeat; + } + return m_current_repeat < m_target_repeats; + } + + // In the second case, we need to move indices forward and check that we haven't run up against the end + ++m_repeat_index; + if (m_repeat_index == m_returned.size()) { + m_repeat_index = 0; + ++m_current_repeat; + } + return m_current_repeat < m_target_repeats; + } + }; + + template + GeneratorWrapper repeat(size_t repeats, GeneratorWrapper&& generator) { + return GeneratorWrapper(pf::make_unique>(repeats, std::move(generator))); + } + + template + class MapGenerator : public IGenerator { + // TBD: provide static assert for mapping function, for friendly error message + GeneratorWrapper m_generator; + Func m_function; + // To avoid returning dangling reference, we have to save the values + T m_cache; + public: + template + MapGenerator(F2&& function, GeneratorWrapper&& generator) : + m_generator(std::move(generator)), + m_function(std::forward(function)), + m_cache(m_function(m_generator.get())) + {} + + T const& get() const override { + return m_cache; + } + bool next() override { + const auto success = m_generator.next(); + if (success) { + m_cache = m_function(m_generator.get()); + } + return success; + } + }; + + template + GeneratorWrapper map(Func&& function, GeneratorWrapper&& generator) { + return GeneratorWrapper( + pf::make_unique>(std::forward(function), std::move(generator)) + ); + } + template + GeneratorWrapper map(Func&& function, GeneratorWrapper&& generator) { + return GeneratorWrapper( + pf::make_unique>(std::forward(function), std::move(generator)) + ); + } + + template + class ChunkGenerator final : public IGenerator> { + std::vector m_chunk; + size_t m_chunk_size; + GeneratorWrapper m_generator; + bool m_used_up = false; + public: + ChunkGenerator(size_t size, GeneratorWrapper generator) : + m_chunk_size(size), m_generator(std::move(generator)) + { + m_chunk.reserve(m_chunk_size); + m_chunk.push_back(m_generator.get()); + for (size_t i = 1; i < m_chunk_size; ++i) { + if (!m_generator.next()) { + Catch::throw_exception(GeneratorException("Not enough values to initialize the first chunk")); + } + m_chunk.push_back(m_generator.get()); + } + } + std::vector const& get() const override { + return m_chunk; + } + bool next() override { + m_chunk.clear(); + for (size_t idx = 0; idx < m_chunk_size; ++idx) { + if (!m_generator.next()) { + return false; + } + m_chunk.push_back(m_generator.get()); + } + return true; + } + }; + + template + GeneratorWrapper> chunk(size_t size, GeneratorWrapper&& generator) { + return GeneratorWrapper>( + pf::make_unique>(size, std::move(generator)) + ); + } + +} // namespace Generators +} // namespace Catch + +// end catch_generators_generic.hpp +// start catch_generators_specific.hpp + +// start catch_context.h + +#include + +namespace Catch { + + struct IResultCapture; + struct IRunner; + struct IConfig; + struct IMutableContext; + + using IConfigPtr = std::shared_ptr; + + struct IContext + { + virtual ~IContext(); + + virtual IResultCapture* getResultCapture() = 0; + virtual IRunner* getRunner() = 0; + virtual IConfigPtr const& getConfig() const = 0; + }; + + struct IMutableContext : IContext + { + virtual ~IMutableContext(); + virtual void setResultCapture( IResultCapture* resultCapture ) = 0; + virtual void setRunner( IRunner* runner ) = 0; + virtual void setConfig( IConfigPtr const& config ) = 0; + + private: + static IMutableContext *currentContext; + friend IMutableContext& getCurrentMutableContext(); + friend void cleanUpContext(); + static void createContext(); + }; + + inline IMutableContext& getCurrentMutableContext() + { + if( !IMutableContext::currentContext ) + IMutableContext::createContext(); + return *IMutableContext::currentContext; + } + + inline IContext& getCurrentContext() + { + return getCurrentMutableContext(); + } + + void cleanUpContext(); +} + +// end catch_context.h +// start catch_interfaces_config.h + +#include +#include +#include +#include + +namespace Catch { + + enum class Verbosity { + Quiet = 0, + Normal, + High + }; + + struct WarnAbout { enum What { + Nothing = 0x00, + NoAssertions = 0x01, + NoTests = 0x02 + }; }; + + struct ShowDurations { enum OrNot { + DefaultForReporter, + Always, + Never + }; }; + struct RunTests { enum InWhatOrder { + InDeclarationOrder, + InLexicographicalOrder, + InRandomOrder + }; }; + struct UseColour { enum YesOrNo { + Auto, + Yes, + No + }; }; + struct WaitForKeypress { enum When { + Never, + BeforeStart = 1, + BeforeExit = 2, + BeforeStartAndExit = BeforeStart | BeforeExit + }; }; + + class TestSpec; + + struct IConfig : NonCopyable { + + virtual ~IConfig(); + + virtual bool allowThrows() const = 0; + virtual std::ostream& stream() const = 0; + virtual std::string name() const = 0; + virtual bool includeSuccessfulResults() const = 0; + virtual bool shouldDebugBreak() const = 0; + virtual bool warnAboutMissingAssertions() const = 0; + virtual bool warnAboutNoTests() const = 0; + virtual int abortAfter() const = 0; + virtual bool showInvisibles() const = 0; + virtual ShowDurations::OrNot showDurations() const = 0; + virtual TestSpec const& testSpec() const = 0; + virtual bool hasTestFilters() const = 0; + virtual RunTests::InWhatOrder runOrder() const = 0; + virtual unsigned int rngSeed() const = 0; + virtual int benchmarkResolutionMultiple() const = 0; + virtual UseColour::YesOrNo useColour() const = 0; + virtual std::vector const& getSectionsToRun() const = 0; + virtual Verbosity verbosity() const = 0; + }; + + using IConfigPtr = std::shared_ptr; +} + +// end catch_interfaces_config.h +#include + +namespace Catch { +namespace Generators { + +template +class RandomFloatingGenerator final : public IGenerator { + // FIXME: What is the right seed? + std::minstd_rand m_rand; + std::uniform_real_distribution m_dist; + Float m_current_number; +public: + + RandomFloatingGenerator(Float a, Float b): + m_rand(getCurrentContext().getConfig()->rngSeed()), + m_dist(a, b) { + static_cast(next()); + } + + Float const& get() const override { + return m_current_number; + } + bool next() override { + m_current_number = m_dist(m_rand); + return true; + } +}; + +template +class RandomIntegerGenerator final : public IGenerator { + std::minstd_rand m_rand; + std::uniform_int_distribution m_dist; + Integer m_current_number; +public: + + RandomIntegerGenerator(Integer a, Integer b): + m_rand(getCurrentContext().getConfig()->rngSeed()), + m_dist(a, b) { + static_cast(next()); + } + + Integer const& get() const override { + return m_current_number; + } + bool next() override { + m_current_number = m_dist(m_rand); + return true; + } +}; + +// TODO: Ideally this would be also constrained against the various char types, +// but I don't expect users to run into that in practice. +template +typename std::enable_if::value && !std::is_same::value, +GeneratorWrapper>::type +random(T a, T b) { + return GeneratorWrapper( + pf::make_unique>(a, b) + ); +} + +template +typename std::enable_if::value, +GeneratorWrapper>::type +random(T a, T b) { + return GeneratorWrapper( + pf::make_unique>(a, b) + ); +} + +template +class RangeGenerator final : public IGenerator { + T m_current; + T m_end; + T m_step; + bool m_positive; + +public: + RangeGenerator(T const& start, T const& end, T const& step): + m_current(start), + m_end(end), + m_step(step), + m_positive(m_step > T(0)) + { + assert(m_current != m_end && "Range start and end cannot be equal"); + assert(m_step != T(0) && "Step size cannot be zero"); + assert(((m_positive && m_current <= m_end) || (!m_positive && m_current >= m_end)) && "Step moves away from end"); + } + + RangeGenerator(T const& start, T const& end): + RangeGenerator(start, end, (start < end) ? T(1) : T(-1)) + {} + + T const& get() const override { + return m_current; + } + + bool next() override { + m_current += m_step; + return (m_positive) ? (m_current < m_end) : (m_current > m_end); + } +}; + +template +GeneratorWrapper range(T const& start, T const& end, T const& step) { + static_assert(std::is_integral::value && !std::is_same::value, "Type must be an integer"); + return GeneratorWrapper(pf::make_unique>(start, end, step)); +} + +template +GeneratorWrapper range(T const& start, T const& end) { + static_assert(std::is_integral::value && !std::is_same::value, "Type must be an integer"); + return GeneratorWrapper(pf::make_unique>(start, end)); +} + +} // namespace Generators +} // namespace Catch + +// end catch_generators_specific.hpp + +// These files are included here so the single_include script doesn't put them +// in the conditionally compiled sections +// start catch_test_case_info.h + +#include +#include +#include + +#ifdef __clang__ +#pragma clang diagnostic push +#pragma clang diagnostic ignored "-Wpadded" +#endif + +namespace Catch { + + struct ITestInvoker; + + struct TestCaseInfo { + enum SpecialProperties{ + None = 0, + IsHidden = 1 << 1, + ShouldFail = 1 << 2, + MayFail = 1 << 3, + Throws = 1 << 4, + NonPortable = 1 << 5, + Benchmark = 1 << 6 + }; + + TestCaseInfo( std::string const& _name, + std::string const& _className, + std::string const& _description, + std::vector const& _tags, + SourceLineInfo const& _lineInfo ); + + friend void setTags( TestCaseInfo& testCaseInfo, std::vector tags ); + + bool isHidden() const; + bool throws() const; + bool okToFail() const; + bool expectedToFail() const; + + std::string tagsAsString() const; + + std::string name; + std::string className; + std::string description; + std::vector tags; + std::vector lcaseTags; + SourceLineInfo lineInfo; + SpecialProperties properties; + }; + + class TestCase : public TestCaseInfo { + public: + + TestCase( ITestInvoker* testCase, TestCaseInfo&& info ); + + TestCase withName( std::string const& _newName ) const; + + void invoke() const; + + TestCaseInfo const& getTestCaseInfo() const; + + bool operator == ( TestCase const& other ) const; + bool operator < ( TestCase const& other ) const; + + private: + std::shared_ptr test; + }; + + TestCase makeTestCase( ITestInvoker* testCase, + std::string const& className, + NameAndTags const& nameAndTags, + SourceLineInfo const& lineInfo ); +} + +#ifdef __clang__ +#pragma clang diagnostic pop +#endif + +// end catch_test_case_info.h +// start catch_interfaces_runner.h + +namespace Catch { + + struct IRunner { + virtual ~IRunner(); + virtual bool aborting() const = 0; + }; +} + +// end catch_interfaces_runner.h + +#ifdef __OBJC__ +// start catch_objc.hpp + +#import + +#include + +// NB. Any general catch headers included here must be included +// in catch.hpp first to make sure they are included by the single +// header for non obj-usage + +/////////////////////////////////////////////////////////////////////////////// +// This protocol is really only here for (self) documenting purposes, since +// all its methods are optional. +@protocol OcFixture + +@optional + +-(void) setUp; +-(void) tearDown; + +@end + +namespace Catch { + + class OcMethod : public ITestInvoker { + + public: + OcMethod( Class cls, SEL sel ) : m_cls( cls ), m_sel( sel ) {} + + virtual void invoke() const { + id obj = [[m_cls alloc] init]; + + performOptionalSelector( obj, @selector(setUp) ); + performOptionalSelector( obj, m_sel ); + performOptionalSelector( obj, @selector(tearDown) ); + + arcSafeRelease( obj ); + } + private: + virtual ~OcMethod() {} + + Class m_cls; + SEL m_sel; + }; + + namespace Detail{ + + inline std::string getAnnotation( Class cls, + std::string const& annotationName, + std::string const& testCaseName ) { + NSString* selStr = [[NSString alloc] initWithFormat:@"Catch_%s_%s", annotationName.c_str(), testCaseName.c_str()]; + SEL sel = NSSelectorFromString( selStr ); + arcSafeRelease( selStr ); + id value = performOptionalSelector( cls, sel ); + if( value ) + return [(NSString*)value UTF8String]; + return ""; + } + } + + inline std::size_t registerTestMethods() { + std::size_t noTestMethods = 0; + int noClasses = objc_getClassList( nullptr, 0 ); + + Class* classes = (CATCH_UNSAFE_UNRETAINED Class *)malloc( sizeof(Class) * noClasses); + objc_getClassList( classes, noClasses ); + + for( int c = 0; c < noClasses; c++ ) { + Class cls = classes[c]; + { + u_int count; + Method* methods = class_copyMethodList( cls, &count ); + for( u_int m = 0; m < count ; m++ ) { + SEL selector = method_getName(methods[m]); + std::string methodName = sel_getName(selector); + if( startsWith( methodName, "Catch_TestCase_" ) ) { + std::string testCaseName = methodName.substr( 15 ); + std::string name = Detail::getAnnotation( cls, "Name", testCaseName ); + std::string desc = Detail::getAnnotation( cls, "Description", testCaseName ); + const char* className = class_getName( cls ); + + getMutableRegistryHub().registerTest( makeTestCase( new OcMethod( cls, selector ), className, NameAndTags( name.c_str(), desc.c_str() ), SourceLineInfo("",0) ) ); + noTestMethods++; + } + } + free(methods); + } + } + return noTestMethods; + } + +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) + + namespace Matchers { + namespace Impl { + namespace NSStringMatchers { + + struct StringHolder : MatcherBase{ + StringHolder( NSString* substr ) : m_substr( [substr copy] ){} + StringHolder( StringHolder const& other ) : m_substr( [other.m_substr copy] ){} + StringHolder() { + arcSafeRelease( m_substr ); + } + + bool match( NSString* arg ) const override { + return false; + } + + NSString* CATCH_ARC_STRONG m_substr; + }; + + struct Equals : StringHolder { + Equals( NSString* substr ) : StringHolder( substr ){} + + bool match( NSString* str ) const override { + return (str != nil || m_substr == nil ) && + [str isEqualToString:m_substr]; + } + + std::string describe() const override { + return "equals string: " + Catch::Detail::stringify( m_substr ); + } + }; + + struct Contains : StringHolder { + Contains( NSString* substr ) : StringHolder( substr ){} + + bool match( NSString* str ) const { + return (str != nil || m_substr == nil ) && + [str rangeOfString:m_substr].location != NSNotFound; + } + + std::string describe() const override { + return "contains string: " + Catch::Detail::stringify( m_substr ); + } + }; + + struct StartsWith : StringHolder { + StartsWith( NSString* substr ) : StringHolder( substr ){} + + bool match( NSString* str ) const override { + return (str != nil || m_substr == nil ) && + [str rangeOfString:m_substr].location == 0; + } + + std::string describe() const override { + return "starts with: " + Catch::Detail::stringify( m_substr ); + } + }; + struct EndsWith : StringHolder { + EndsWith( NSString* substr ) : StringHolder( substr ){} + + bool match( NSString* str ) const override { + return (str != nil || m_substr == nil ) && + [str rangeOfString:m_substr].location == [str length] - [m_substr length]; + } + + std::string describe() const override { + return "ends with: " + Catch::Detail::stringify( m_substr ); + } + }; + + } // namespace NSStringMatchers + } // namespace Impl + + inline Impl::NSStringMatchers::Equals + Equals( NSString* substr ){ return Impl::NSStringMatchers::Equals( substr ); } + + inline Impl::NSStringMatchers::Contains + Contains( NSString* substr ){ return Impl::NSStringMatchers::Contains( substr ); } + + inline Impl::NSStringMatchers::StartsWith + StartsWith( NSString* substr ){ return Impl::NSStringMatchers::StartsWith( substr ); } + + inline Impl::NSStringMatchers::EndsWith + EndsWith( NSString* substr ){ return Impl::NSStringMatchers::EndsWith( substr ); } + + } // namespace Matchers + + using namespace Matchers; + +#endif // CATCH_CONFIG_DISABLE_MATCHERS + +} // namespace Catch + +/////////////////////////////////////////////////////////////////////////////// +#define OC_MAKE_UNIQUE_NAME( root, uniqueSuffix ) root##uniqueSuffix +#define OC_TEST_CASE2( name, desc, uniqueSuffix ) \ ++(NSString*) OC_MAKE_UNIQUE_NAME( Catch_Name_test_, uniqueSuffix ) \ +{ \ +return @ name; \ +} \ ++(NSString*) OC_MAKE_UNIQUE_NAME( Catch_Description_test_, uniqueSuffix ) \ +{ \ +return @ desc; \ +} \ +-(void) OC_MAKE_UNIQUE_NAME( Catch_TestCase_test_, uniqueSuffix ) + +#define OC_TEST_CASE( name, desc ) OC_TEST_CASE2( name, desc, __LINE__ ) + +// end catch_objc.hpp +#endif + +#ifdef CATCH_CONFIG_EXTERNAL_INTERFACES +// start catch_external_interfaces.h + +// start catch_reporter_bases.hpp + +// start catch_interfaces_reporter.h + +// start catch_config.hpp + +// start catch_test_spec_parser.h + +#ifdef __clang__ +#pragma clang diagnostic push +#pragma clang diagnostic ignored "-Wpadded" +#endif + +// start catch_test_spec.h + +#ifdef __clang__ +#pragma clang diagnostic push +#pragma clang diagnostic ignored "-Wpadded" +#endif + +// start catch_wildcard_pattern.h + +namespace Catch +{ + class WildcardPattern { + enum WildcardPosition { + NoWildcard = 0, + WildcardAtStart = 1, + WildcardAtEnd = 2, + WildcardAtBothEnds = WildcardAtStart | WildcardAtEnd + }; + + public: + + WildcardPattern( std::string const& pattern, CaseSensitive::Choice caseSensitivity ); + virtual ~WildcardPattern() = default; + virtual bool matches( std::string const& str ) const; + + private: + std::string adjustCase( std::string const& str ) const; + CaseSensitive::Choice m_caseSensitivity; + WildcardPosition m_wildcard = NoWildcard; + std::string m_pattern; + }; +} + +// end catch_wildcard_pattern.h +#include +#include +#include + +namespace Catch { + + class TestSpec { + struct Pattern { + virtual ~Pattern(); + virtual bool matches( TestCaseInfo const& testCase ) const = 0; + }; + using PatternPtr = std::shared_ptr; + + class NamePattern : public Pattern { + public: + NamePattern( std::string const& name ); + virtual ~NamePattern(); + virtual bool matches( TestCaseInfo const& testCase ) const override; + private: + WildcardPattern m_wildcardPattern; + }; + + class TagPattern : public Pattern { + public: + TagPattern( std::string const& tag ); + virtual ~TagPattern(); + virtual bool matches( TestCaseInfo const& testCase ) const override; + private: + std::string m_tag; + }; + + class ExcludedPattern : public Pattern { + public: + ExcludedPattern( PatternPtr const& underlyingPattern ); + virtual ~ExcludedPattern(); + virtual bool matches( TestCaseInfo const& testCase ) const override; + private: + PatternPtr m_underlyingPattern; + }; + + struct Filter { + std::vector m_patterns; + + bool matches( TestCaseInfo const& testCase ) const; + }; + + public: + bool hasFilters() const; + bool matches( TestCaseInfo const& testCase ) const; + + private: + std::vector m_filters; + + friend class TestSpecParser; + }; +} + +#ifdef __clang__ +#pragma clang diagnostic pop +#endif + +// end catch_test_spec.h +// start catch_interfaces_tag_alias_registry.h + +#include + +namespace Catch { + + struct TagAlias; + + struct ITagAliasRegistry { + virtual ~ITagAliasRegistry(); + // Nullptr if not present + virtual TagAlias const* find( std::string const& alias ) const = 0; + virtual std::string expandAliases( std::string const& unexpandedTestSpec ) const = 0; + + static ITagAliasRegistry const& get(); + }; + +} // end namespace Catch + +// end catch_interfaces_tag_alias_registry.h +namespace Catch { + + class TestSpecParser { + enum Mode{ None, Name, QuotedName, Tag, EscapedName }; + Mode m_mode = None; + bool m_exclusion = false; + std::size_t m_start = std::string::npos, m_pos = 0; + std::string m_arg; + std::vector m_escapeChars; + TestSpec::Filter m_currentFilter; + TestSpec m_testSpec; + ITagAliasRegistry const* m_tagAliases = nullptr; + + public: + TestSpecParser( ITagAliasRegistry const& tagAliases ); + + TestSpecParser& parse( std::string const& arg ); + TestSpec testSpec(); + + private: + void visitChar( char c ); + void startNewMode( Mode mode, std::size_t start ); + void escape(); + std::string subString() const; + + template + void addPattern() { + std::string token = subString(); + for( std::size_t i = 0; i < m_escapeChars.size(); ++i ) + token = token.substr( 0, m_escapeChars[i]-m_start-i ) + token.substr( m_escapeChars[i]-m_start-i+1 ); + m_escapeChars.clear(); + if( startsWith( token, "exclude:" ) ) { + m_exclusion = true; + token = token.substr( 8 ); + } + if( !token.empty() ) { + TestSpec::PatternPtr pattern = std::make_shared( token ); + if( m_exclusion ) + pattern = std::make_shared( pattern ); + m_currentFilter.m_patterns.push_back( pattern ); + } + m_exclusion = false; + m_mode = None; + } + + void addFilter(); + }; + TestSpec parseTestSpec( std::string const& arg ); + +} // namespace Catch + +#ifdef __clang__ +#pragma clang diagnostic pop +#endif + +// end catch_test_spec_parser.h +// Libstdc++ doesn't like incomplete classes for unique_ptr + +#include +#include +#include + +#ifndef CATCH_CONFIG_CONSOLE_WIDTH +#define CATCH_CONFIG_CONSOLE_WIDTH 80 +#endif + +namespace Catch { + + struct IStream; + + struct ConfigData { + bool listTests = false; + bool listTags = false; + bool listReporters = false; + bool listTestNamesOnly = false; + + bool showSuccessfulTests = false; + bool shouldDebugBreak = false; + bool noThrow = false; + bool showHelp = false; + bool showInvisibles = false; + bool filenamesAsTags = false; + bool libIdentify = false; + + int abortAfter = -1; + unsigned int rngSeed = 0; + int benchmarkResolutionMultiple = 100; + + Verbosity verbosity = Verbosity::Normal; + WarnAbout::What warnings = WarnAbout::Nothing; + ShowDurations::OrNot showDurations = ShowDurations::DefaultForReporter; + RunTests::InWhatOrder runOrder = RunTests::InDeclarationOrder; + UseColour::YesOrNo useColour = UseColour::Auto; + WaitForKeypress::When waitForKeypress = WaitForKeypress::Never; + + std::string outputFilename; + std::string name; + std::string processName; +#ifndef CATCH_CONFIG_DEFAULT_REPORTER +#define CATCH_CONFIG_DEFAULT_REPORTER "console" +#endif + std::string reporterName = CATCH_CONFIG_DEFAULT_REPORTER; +#undef CATCH_CONFIG_DEFAULT_REPORTER + + std::vector testsOrTags; + std::vector sectionsToRun; + }; + + class Config : public IConfig { + public: + + Config() = default; + Config( ConfigData const& data ); + virtual ~Config() = default; + + std::string const& getFilename() const; + + bool listTests() const; + bool listTestNamesOnly() const; + bool listTags() const; + bool listReporters() const; + + std::string getProcessName() const; + std::string const& getReporterName() const; + + std::vector const& getTestsOrTags() const; + std::vector const& getSectionsToRun() const override; + + virtual TestSpec const& testSpec() const override; + bool hasTestFilters() const override; + + bool showHelp() const; + + // IConfig interface + bool allowThrows() const override; + std::ostream& stream() const override; + std::string name() const override; + bool includeSuccessfulResults() const override; + bool warnAboutMissingAssertions() const override; + bool warnAboutNoTests() const override; + ShowDurations::OrNot showDurations() const override; + RunTests::InWhatOrder runOrder() const override; + unsigned int rngSeed() const override; + int benchmarkResolutionMultiple() const override; + UseColour::YesOrNo useColour() const override; + bool shouldDebugBreak() const override; + int abortAfter() const override; + bool showInvisibles() const override; + Verbosity verbosity() const override; + + private: + + IStream const* openStream(); + ConfigData m_data; + + std::unique_ptr m_stream; + TestSpec m_testSpec; + bool m_hasTestFilters = false; + }; + +} // end namespace Catch + +// end catch_config.hpp +// start catch_assertionresult.h + +#include + +namespace Catch { + + struct AssertionResultData + { + AssertionResultData() = delete; + + AssertionResultData( ResultWas::OfType _resultType, LazyExpression const& _lazyExpression ); + + std::string message; + mutable std::string reconstructedExpression; + LazyExpression lazyExpression; + ResultWas::OfType resultType; + + std::string reconstructExpression() const; + }; + + class AssertionResult { + public: + AssertionResult() = delete; + AssertionResult( AssertionInfo const& info, AssertionResultData const& data ); + + bool isOk() const; + bool succeeded() const; + ResultWas::OfType getResultType() const; + bool hasExpression() const; + bool hasMessage() const; + std::string getExpression() const; + std::string getExpressionInMacro() const; + bool hasExpandedExpression() const; + std::string getExpandedExpression() const; + std::string getMessage() const; + SourceLineInfo getSourceInfo() const; + StringRef getTestMacroName() const; + + //protected: + AssertionInfo m_info; + AssertionResultData m_resultData; + }; + +} // end namespace Catch + +// end catch_assertionresult.h +// start catch_option.hpp + +namespace Catch { + + // An optional type + template + class Option { + public: + Option() : nullableValue( nullptr ) {} + Option( T const& _value ) + : nullableValue( new( storage ) T( _value ) ) + {} + Option( Option const& _other ) + : nullableValue( _other ? new( storage ) T( *_other ) : nullptr ) + {} + + ~Option() { + reset(); + } + + Option& operator= ( Option const& _other ) { + if( &_other != this ) { + reset(); + if( _other ) + nullableValue = new( storage ) T( *_other ); + } + return *this; + } + Option& operator = ( T const& _value ) { + reset(); + nullableValue = new( storage ) T( _value ); + return *this; + } + + void reset() { + if( nullableValue ) + nullableValue->~T(); + nullableValue = nullptr; + } + + T& operator*() { return *nullableValue; } + T const& operator*() const { return *nullableValue; } + T* operator->() { return nullableValue; } + const T* operator->() const { return nullableValue; } + + T valueOr( T const& defaultValue ) const { + return nullableValue ? *nullableValue : defaultValue; + } + + bool some() const { return nullableValue != nullptr; } + bool none() const { return nullableValue == nullptr; } + + bool operator !() const { return nullableValue == nullptr; } + explicit operator bool() const { + return some(); + } + + private: + T *nullableValue; + alignas(alignof(T)) char storage[sizeof(T)]; + }; + +} // end namespace Catch + +// end catch_option.hpp +#include +#include +#include +#include +#include + +namespace Catch { + + struct ReporterConfig { + explicit ReporterConfig( IConfigPtr const& _fullConfig ); + + ReporterConfig( IConfigPtr const& _fullConfig, std::ostream& _stream ); + + std::ostream& stream() const; + IConfigPtr fullConfig() const; + + private: + std::ostream* m_stream; + IConfigPtr m_fullConfig; + }; + + struct ReporterPreferences { + bool shouldRedirectStdOut = false; + bool shouldReportAllAssertions = false; + }; + + template + struct LazyStat : Option { + LazyStat& operator=( T const& _value ) { + Option::operator=( _value ); + used = false; + return *this; + } + void reset() { + Option::reset(); + used = false; + } + bool used = false; + }; + + struct TestRunInfo { + TestRunInfo( std::string const& _name ); + std::string name; + }; + struct GroupInfo { + GroupInfo( std::string const& _name, + std::size_t _groupIndex, + std::size_t _groupsCount ); + + std::string name; + std::size_t groupIndex; + std::size_t groupsCounts; + }; + + struct AssertionStats { + AssertionStats( AssertionResult const& _assertionResult, + std::vector const& _infoMessages, + Totals const& _totals ); + + AssertionStats( AssertionStats const& ) = default; + AssertionStats( AssertionStats && ) = default; + AssertionStats& operator = ( AssertionStats const& ) = delete; + AssertionStats& operator = ( AssertionStats && ) = delete; + virtual ~AssertionStats(); + + AssertionResult assertionResult; + std::vector infoMessages; + Totals totals; + }; + + struct SectionStats { + SectionStats( SectionInfo const& _sectionInfo, + Counts const& _assertions, + double _durationInSeconds, + bool _missingAssertions ); + SectionStats( SectionStats const& ) = default; + SectionStats( SectionStats && ) = default; + SectionStats& operator = ( SectionStats const& ) = default; + SectionStats& operator = ( SectionStats && ) = default; + virtual ~SectionStats(); + + SectionInfo sectionInfo; + Counts assertions; + double durationInSeconds; + bool missingAssertions; + }; + + struct TestCaseStats { + TestCaseStats( TestCaseInfo const& _testInfo, + Totals const& _totals, + std::string const& _stdOut, + std::string const& _stdErr, + bool _aborting ); + + TestCaseStats( TestCaseStats const& ) = default; + TestCaseStats( TestCaseStats && ) = default; + TestCaseStats& operator = ( TestCaseStats const& ) = default; + TestCaseStats& operator = ( TestCaseStats && ) = default; + virtual ~TestCaseStats(); + + TestCaseInfo testInfo; + Totals totals; + std::string stdOut; + std::string stdErr; + bool aborting; + }; + + struct TestGroupStats { + TestGroupStats( GroupInfo const& _groupInfo, + Totals const& _totals, + bool _aborting ); + TestGroupStats( GroupInfo const& _groupInfo ); + + TestGroupStats( TestGroupStats const& ) = default; + TestGroupStats( TestGroupStats && ) = default; + TestGroupStats& operator = ( TestGroupStats const& ) = default; + TestGroupStats& operator = ( TestGroupStats && ) = default; + virtual ~TestGroupStats(); + + GroupInfo groupInfo; + Totals totals; + bool aborting; + }; + + struct TestRunStats { + TestRunStats( TestRunInfo const& _runInfo, + Totals const& _totals, + bool _aborting ); + + TestRunStats( TestRunStats const& ) = default; + TestRunStats( TestRunStats && ) = default; + TestRunStats& operator = ( TestRunStats const& ) = default; + TestRunStats& operator = ( TestRunStats && ) = default; + virtual ~TestRunStats(); + + TestRunInfo runInfo; + Totals totals; + bool aborting; + }; + + struct BenchmarkInfo { + std::string name; + }; + struct BenchmarkStats { + BenchmarkInfo info; + std::size_t iterations; + uint64_t elapsedTimeInNanoseconds; + }; + + struct IStreamingReporter { + virtual ~IStreamingReporter() = default; + + // Implementing class must also provide the following static methods: + // static std::string getDescription(); + // static std::set getSupportedVerbosities() + + virtual ReporterPreferences getPreferences() const = 0; + + virtual void noMatchingTestCases( std::string const& spec ) = 0; + + virtual void testRunStarting( TestRunInfo const& testRunInfo ) = 0; + virtual void testGroupStarting( GroupInfo const& groupInfo ) = 0; + + virtual void testCaseStarting( TestCaseInfo const& testInfo ) = 0; + virtual void sectionStarting( SectionInfo const& sectionInfo ) = 0; + + // *** experimental *** + virtual void benchmarkStarting( BenchmarkInfo const& ) {} + + virtual void assertionStarting( AssertionInfo const& assertionInfo ) = 0; + + // The return value indicates if the messages buffer should be cleared: + virtual bool assertionEnded( AssertionStats const& assertionStats ) = 0; + + // *** experimental *** + virtual void benchmarkEnded( BenchmarkStats const& ) {} + + virtual void sectionEnded( SectionStats const& sectionStats ) = 0; + virtual void testCaseEnded( TestCaseStats const& testCaseStats ) = 0; + virtual void testGroupEnded( TestGroupStats const& testGroupStats ) = 0; + virtual void testRunEnded( TestRunStats const& testRunStats ) = 0; + + virtual void skipTest( TestCaseInfo const& testInfo ) = 0; + + // Default empty implementation provided + virtual void fatalErrorEncountered( StringRef name ); + + virtual bool isMulti() const; + }; + using IStreamingReporterPtr = std::unique_ptr; + + struct IReporterFactory { + virtual ~IReporterFactory(); + virtual IStreamingReporterPtr create( ReporterConfig const& config ) const = 0; + virtual std::string getDescription() const = 0; + }; + using IReporterFactoryPtr = std::shared_ptr; + + struct IReporterRegistry { + using FactoryMap = std::map; + using Listeners = std::vector; + + virtual ~IReporterRegistry(); + virtual IStreamingReporterPtr create( std::string const& name, IConfigPtr const& config ) const = 0; + virtual FactoryMap const& getFactories() const = 0; + virtual Listeners const& getListeners() const = 0; + }; + +} // end namespace Catch + +// end catch_interfaces_reporter.h +#include +#include +#include +#include +#include +#include +#include + +namespace Catch { + void prepareExpandedExpression(AssertionResult& result); + + // Returns double formatted as %.3f (format expected on output) + std::string getFormattedDuration( double duration ); + + template + struct StreamingReporterBase : IStreamingReporter { + + StreamingReporterBase( ReporterConfig const& _config ) + : m_config( _config.fullConfig() ), + stream( _config.stream() ) + { + m_reporterPrefs.shouldRedirectStdOut = false; + if( !DerivedT::getSupportedVerbosities().count( m_config->verbosity() ) ) + CATCH_ERROR( "Verbosity level not supported by this reporter" ); + } + + ReporterPreferences getPreferences() const override { + return m_reporterPrefs; + } + + static std::set getSupportedVerbosities() { + return { Verbosity::Normal }; + } + + ~StreamingReporterBase() override = default; + + void noMatchingTestCases(std::string const&) override {} + + void testRunStarting(TestRunInfo const& _testRunInfo) override { + currentTestRunInfo = _testRunInfo; + } + void testGroupStarting(GroupInfo const& _groupInfo) override { + currentGroupInfo = _groupInfo; + } + + void testCaseStarting(TestCaseInfo const& _testInfo) override { + currentTestCaseInfo = _testInfo; + } + void sectionStarting(SectionInfo const& _sectionInfo) override { + m_sectionStack.push_back(_sectionInfo); + } + + void sectionEnded(SectionStats const& /* _sectionStats */) override { + m_sectionStack.pop_back(); + } + void testCaseEnded(TestCaseStats const& /* _testCaseStats */) override { + currentTestCaseInfo.reset(); + } + void testGroupEnded(TestGroupStats const& /* _testGroupStats */) override { + currentGroupInfo.reset(); + } + void testRunEnded(TestRunStats const& /* _testRunStats */) override { + currentTestCaseInfo.reset(); + currentGroupInfo.reset(); + currentTestRunInfo.reset(); + } + + void skipTest(TestCaseInfo const&) override { + // Don't do anything with this by default. + // It can optionally be overridden in the derived class. + } + + IConfigPtr m_config; + std::ostream& stream; + + LazyStat currentTestRunInfo; + LazyStat currentGroupInfo; + LazyStat currentTestCaseInfo; + + std::vector m_sectionStack; + ReporterPreferences m_reporterPrefs; + }; + + template + struct CumulativeReporterBase : IStreamingReporter { + template + struct Node { + explicit Node( T const& _value ) : value( _value ) {} + virtual ~Node() {} + + using ChildNodes = std::vector>; + T value; + ChildNodes children; + }; + struct SectionNode { + explicit SectionNode(SectionStats const& _stats) : stats(_stats) {} + virtual ~SectionNode() = default; + + bool operator == (SectionNode const& other) const { + return stats.sectionInfo.lineInfo == other.stats.sectionInfo.lineInfo; + } + bool operator == (std::shared_ptr const& other) const { + return operator==(*other); + } + + SectionStats stats; + using ChildSections = std::vector>; + using Assertions = std::vector; + ChildSections childSections; + Assertions assertions; + std::string stdOut; + std::string stdErr; + }; + + struct BySectionInfo { + BySectionInfo( SectionInfo const& other ) : m_other( other ) {} + BySectionInfo( BySectionInfo const& other ) : m_other( other.m_other ) {} + bool operator() (std::shared_ptr const& node) const { + return ((node->stats.sectionInfo.name == m_other.name) && + (node->stats.sectionInfo.lineInfo == m_other.lineInfo)); + } + void operator=(BySectionInfo const&) = delete; + + private: + SectionInfo const& m_other; + }; + + using TestCaseNode = Node; + using TestGroupNode = Node; + using TestRunNode = Node; + + CumulativeReporterBase( ReporterConfig const& _config ) + : m_config( _config.fullConfig() ), + stream( _config.stream() ) + { + m_reporterPrefs.shouldRedirectStdOut = false; + if( !DerivedT::getSupportedVerbosities().count( m_config->verbosity() ) ) + CATCH_ERROR( "Verbosity level not supported by this reporter" ); + } + ~CumulativeReporterBase() override = default; + + ReporterPreferences getPreferences() const override { + return m_reporterPrefs; + } + + static std::set getSupportedVerbosities() { + return { Verbosity::Normal }; + } + + void testRunStarting( TestRunInfo const& ) override {} + void testGroupStarting( GroupInfo const& ) override {} + + void testCaseStarting( TestCaseInfo const& ) override {} + + void sectionStarting( SectionInfo const& sectionInfo ) override { + SectionStats incompleteStats( sectionInfo, Counts(), 0, false ); + std::shared_ptr node; + if( m_sectionStack.empty() ) { + if( !m_rootSection ) + m_rootSection = std::make_shared( incompleteStats ); + node = m_rootSection; + } + else { + SectionNode& parentNode = *m_sectionStack.back(); + auto it = + std::find_if( parentNode.childSections.begin(), + parentNode.childSections.end(), + BySectionInfo( sectionInfo ) ); + if( it == parentNode.childSections.end() ) { + node = std::make_shared( incompleteStats ); + parentNode.childSections.push_back( node ); + } + else + node = *it; + } + m_sectionStack.push_back( node ); + m_deepestSection = std::move(node); + } + + void assertionStarting(AssertionInfo const&) override {} + + bool assertionEnded(AssertionStats const& assertionStats) override { + assert(!m_sectionStack.empty()); + // AssertionResult holds a pointer to a temporary DecomposedExpression, + // which getExpandedExpression() calls to build the expression string. + // Our section stack copy of the assertionResult will likely outlive the + // temporary, so it must be expanded or discarded now to avoid calling + // a destroyed object later. + prepareExpandedExpression(const_cast( assertionStats.assertionResult ) ); + SectionNode& sectionNode = *m_sectionStack.back(); + sectionNode.assertions.push_back(assertionStats); + return true; + } + void sectionEnded(SectionStats const& sectionStats) override { + assert(!m_sectionStack.empty()); + SectionNode& node = *m_sectionStack.back(); + node.stats = sectionStats; + m_sectionStack.pop_back(); + } + void testCaseEnded(TestCaseStats const& testCaseStats) override { + auto node = std::make_shared(testCaseStats); + assert(m_sectionStack.size() == 0); + node->children.push_back(m_rootSection); + m_testCases.push_back(node); + m_rootSection.reset(); + + assert(m_deepestSection); + m_deepestSection->stdOut = testCaseStats.stdOut; + m_deepestSection->stdErr = testCaseStats.stdErr; + } + void testGroupEnded(TestGroupStats const& testGroupStats) override { + auto node = std::make_shared(testGroupStats); + node->children.swap(m_testCases); + m_testGroups.push_back(node); + } + void testRunEnded(TestRunStats const& testRunStats) override { + auto node = std::make_shared(testRunStats); + node->children.swap(m_testGroups); + m_testRuns.push_back(node); + testRunEndedCumulative(); + } + virtual void testRunEndedCumulative() = 0; + + void skipTest(TestCaseInfo const&) override {} + + IConfigPtr m_config; + std::ostream& stream; + std::vector m_assertions; + std::vector>> m_sections; + std::vector> m_testCases; + std::vector> m_testGroups; + + std::vector> m_testRuns; + + std::shared_ptr m_rootSection; + std::shared_ptr m_deepestSection; + std::vector> m_sectionStack; + ReporterPreferences m_reporterPrefs; + }; + + template + char const* getLineOfChars() { + static char line[CATCH_CONFIG_CONSOLE_WIDTH] = {0}; + if( !*line ) { + std::memset( line, C, CATCH_CONFIG_CONSOLE_WIDTH-1 ); + line[CATCH_CONFIG_CONSOLE_WIDTH-1] = 0; + } + return line; + } + + struct TestEventListenerBase : StreamingReporterBase { + TestEventListenerBase( ReporterConfig const& _config ); + + static std::set getSupportedVerbosities(); + + void assertionStarting(AssertionInfo const&) override; + bool assertionEnded(AssertionStats const&) override; + }; + +} // end namespace Catch + +// end catch_reporter_bases.hpp +// start catch_console_colour.h + +namespace Catch { + + struct Colour { + enum Code { + None = 0, + + White, + Red, + Green, + Blue, + Cyan, + Yellow, + Grey, + + Bright = 0x10, + + BrightRed = Bright | Red, + BrightGreen = Bright | Green, + LightGrey = Bright | Grey, + BrightWhite = Bright | White, + BrightYellow = Bright | Yellow, + + // By intention + FileName = LightGrey, + Warning = BrightYellow, + ResultError = BrightRed, + ResultSuccess = BrightGreen, + ResultExpectedFailure = Warning, + + Error = BrightRed, + Success = Green, + + OriginalExpression = Cyan, + ReconstructedExpression = BrightYellow, + + SecondaryText = LightGrey, + Headers = White + }; + + // Use constructed object for RAII guard + Colour( Code _colourCode ); + Colour( Colour&& other ) noexcept; + Colour& operator=( Colour&& other ) noexcept; + ~Colour(); + + // Use static method for one-shot changes + static void use( Code _colourCode ); + + private: + bool m_moved = false; + }; + + std::ostream& operator << ( std::ostream& os, Colour const& ); + +} // end namespace Catch + +// end catch_console_colour.h +// start catch_reporter_registrars.hpp + + +namespace Catch { + + template + class ReporterRegistrar { + + class ReporterFactory : public IReporterFactory { + + virtual IStreamingReporterPtr create( ReporterConfig const& config ) const override { + return std::unique_ptr( new T( config ) ); + } + + virtual std::string getDescription() const override { + return T::getDescription(); + } + }; + + public: + + explicit ReporterRegistrar( std::string const& name ) { + getMutableRegistryHub().registerReporter( name, std::make_shared() ); + } + }; + + template + class ListenerRegistrar { + + class ListenerFactory : public IReporterFactory { + + virtual IStreamingReporterPtr create( ReporterConfig const& config ) const override { + return std::unique_ptr( new T( config ) ); + } + virtual std::string getDescription() const override { + return std::string(); + } + }; + + public: + + ListenerRegistrar() { + getMutableRegistryHub().registerListener( std::make_shared() ); + } + }; +} + +#if !defined(CATCH_CONFIG_DISABLE) + +#define CATCH_REGISTER_REPORTER( name, reporterType ) \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ Catch::ReporterRegistrar catch_internal_RegistrarFor##reporterType( name ); } \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS + +#define CATCH_REGISTER_LISTENER( listenerType ) \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ Catch::ListenerRegistrar catch_internal_RegistrarFor##listenerType; } \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS +#else // CATCH_CONFIG_DISABLE + +#define CATCH_REGISTER_REPORTER(name, reporterType) +#define CATCH_REGISTER_LISTENER(listenerType) + +#endif // CATCH_CONFIG_DISABLE + +// end catch_reporter_registrars.hpp +// Allow users to base their work off existing reporters +// start catch_reporter_compact.h + +namespace Catch { + + struct CompactReporter : StreamingReporterBase { + + using StreamingReporterBase::StreamingReporterBase; + + ~CompactReporter() override; + + static std::string getDescription(); + + ReporterPreferences getPreferences() const override; + + void noMatchingTestCases(std::string const& spec) override; + + void assertionStarting(AssertionInfo const&) override; + + bool assertionEnded(AssertionStats const& _assertionStats) override; + + void sectionEnded(SectionStats const& _sectionStats) override; + + void testRunEnded(TestRunStats const& _testRunStats) override; + + }; + +} // end namespace Catch + +// end catch_reporter_compact.h +// start catch_reporter_console.h + +#if defined(_MSC_VER) +#pragma warning(push) +#pragma warning(disable:4061) // Not all labels are EXPLICITLY handled in switch + // Note that 4062 (not all labels are handled + // and default is missing) is enabled +#endif + +namespace Catch { + // Fwd decls + struct SummaryColumn; + class TablePrinter; + + struct ConsoleReporter : StreamingReporterBase { + std::unique_ptr m_tablePrinter; + + ConsoleReporter(ReporterConfig const& config); + ~ConsoleReporter() override; + static std::string getDescription(); + + void noMatchingTestCases(std::string const& spec) override; + + void assertionStarting(AssertionInfo const&) override; + + bool assertionEnded(AssertionStats const& _assertionStats) override; + + void sectionStarting(SectionInfo const& _sectionInfo) override; + void sectionEnded(SectionStats const& _sectionStats) override; + + void benchmarkStarting(BenchmarkInfo const& info) override; + void benchmarkEnded(BenchmarkStats const& stats) override; + + void testCaseEnded(TestCaseStats const& _testCaseStats) override; + void testGroupEnded(TestGroupStats const& _testGroupStats) override; + void testRunEnded(TestRunStats const& _testRunStats) override; + + private: + + void lazyPrint(); + + void lazyPrintWithoutClosingBenchmarkTable(); + void lazyPrintRunInfo(); + void lazyPrintGroupInfo(); + void printTestCaseAndSectionHeader(); + + void printClosedHeader(std::string const& _name); + void printOpenHeader(std::string const& _name); + + // if string has a : in first line will set indent to follow it on + // subsequent lines + void printHeaderString(std::string const& _string, std::size_t indent = 0); + + void printTotals(Totals const& totals); + void printSummaryRow(std::string const& label, std::vector const& cols, std::size_t row); + + void printTotalsDivider(Totals const& totals); + void printSummaryDivider(); + + private: + bool m_headerPrinted = false; + }; + +} // end namespace Catch + +#if defined(_MSC_VER) +#pragma warning(pop) +#endif + +// end catch_reporter_console.h +// start catch_reporter_junit.h + +// start catch_xmlwriter.h + +#include + +namespace Catch { + + class XmlEncode { + public: + enum ForWhat { ForTextNodes, ForAttributes }; + + XmlEncode( std::string const& str, ForWhat forWhat = ForTextNodes ); + + void encodeTo( std::ostream& os ) const; + + friend std::ostream& operator << ( std::ostream& os, XmlEncode const& xmlEncode ); + + private: + std::string m_str; + ForWhat m_forWhat; + }; + + class XmlWriter { + public: + + class ScopedElement { + public: + ScopedElement( XmlWriter* writer ); + + ScopedElement( ScopedElement&& other ) noexcept; + ScopedElement& operator=( ScopedElement&& other ) noexcept; + + ~ScopedElement(); + + ScopedElement& writeText( std::string const& text, bool indent = true ); + + template + ScopedElement& writeAttribute( std::string const& name, T const& attribute ) { + m_writer->writeAttribute( name, attribute ); + return *this; + } + + private: + mutable XmlWriter* m_writer = nullptr; + }; + + XmlWriter( std::ostream& os = Catch::cout() ); + ~XmlWriter(); + + XmlWriter( XmlWriter const& ) = delete; + XmlWriter& operator=( XmlWriter const& ) = delete; + + XmlWriter& startElement( std::string const& name ); + + ScopedElement scopedElement( std::string const& name ); + + XmlWriter& endElement(); + + XmlWriter& writeAttribute( std::string const& name, std::string const& attribute ); + + XmlWriter& writeAttribute( std::string const& name, bool attribute ); + + template + XmlWriter& writeAttribute( std::string const& name, T const& attribute ) { + ReusableStringStream rss; + rss << attribute; + return writeAttribute( name, rss.str() ); + } + + XmlWriter& writeText( std::string const& text, bool indent = true ); + + XmlWriter& writeComment( std::string const& text ); + + void writeStylesheetRef( std::string const& url ); + + XmlWriter& writeBlankLine(); + + void ensureTagClosed(); + + private: + + void writeDeclaration(); + + void newlineIfNecessary(); + + bool m_tagIsOpen = false; + bool m_needsNewline = false; + std::vector m_tags; + std::string m_indent; + std::ostream& m_os; + }; + +} + +// end catch_xmlwriter.h +namespace Catch { + + class JunitReporter : public CumulativeReporterBase { + public: + JunitReporter(ReporterConfig const& _config); + + ~JunitReporter() override; + + static std::string getDescription(); + + void noMatchingTestCases(std::string const& /*spec*/) override; + + void testRunStarting(TestRunInfo const& runInfo) override; + + void testGroupStarting(GroupInfo const& groupInfo) override; + + void testCaseStarting(TestCaseInfo const& testCaseInfo) override; + bool assertionEnded(AssertionStats const& assertionStats) override; + + void testCaseEnded(TestCaseStats const& testCaseStats) override; + + void testGroupEnded(TestGroupStats const& testGroupStats) override; + + void testRunEndedCumulative() override; + + void writeGroup(TestGroupNode const& groupNode, double suiteTime); + + void writeTestCase(TestCaseNode const& testCaseNode); + + void writeSection(std::string const& className, + std::string const& rootName, + SectionNode const& sectionNode); + + void writeAssertions(SectionNode const& sectionNode); + void writeAssertion(AssertionStats const& stats); + + XmlWriter xml; + Timer suiteTimer; + std::string stdOutForSuite; + std::string stdErrForSuite; + unsigned int unexpectedExceptions = 0; + bool m_okToFail = false; + }; + +} // end namespace Catch + +// end catch_reporter_junit.h +// start catch_reporter_xml.h + +namespace Catch { + class XmlReporter : public StreamingReporterBase { + public: + XmlReporter(ReporterConfig const& _config); + + ~XmlReporter() override; + + static std::string getDescription(); + + virtual std::string getStylesheetRef() const; + + void writeSourceInfo(SourceLineInfo const& sourceInfo); + + public: // StreamingReporterBase + + void noMatchingTestCases(std::string const& s) override; + + void testRunStarting(TestRunInfo const& testInfo) override; + + void testGroupStarting(GroupInfo const& groupInfo) override; + + void testCaseStarting(TestCaseInfo const& testInfo) override; + + void sectionStarting(SectionInfo const& sectionInfo) override; + + void assertionStarting(AssertionInfo const&) override; + + bool assertionEnded(AssertionStats const& assertionStats) override; + + void sectionEnded(SectionStats const& sectionStats) override; + + void testCaseEnded(TestCaseStats const& testCaseStats) override; + + void testGroupEnded(TestGroupStats const& testGroupStats) override; + + void testRunEnded(TestRunStats const& testRunStats) override; + + private: + Timer m_testCaseTimer; + XmlWriter m_xml; + int m_sectionDepth = 0; + }; + +} // end namespace Catch + +// end catch_reporter_xml.h + +// end catch_external_interfaces.h +#endif + +#endif // ! CATCH_CONFIG_IMPL_ONLY + +#ifdef CATCH_IMPL +// start catch_impl.hpp + +#ifdef __clang__ +#pragma clang diagnostic push +#pragma clang diagnostic ignored "-Wweak-vtables" +#endif + +// Keep these here for external reporters +// start catch_test_case_tracker.h + +#include +#include +#include + +namespace Catch { +namespace TestCaseTracking { + + struct NameAndLocation { + std::string name; + SourceLineInfo location; + + NameAndLocation( std::string const& _name, SourceLineInfo const& _location ); + }; + + struct ITracker; + + using ITrackerPtr = std::shared_ptr; + + struct ITracker { + virtual ~ITracker(); + + // static queries + virtual NameAndLocation const& nameAndLocation() const = 0; + + // dynamic queries + virtual bool isComplete() const = 0; // Successfully completed or failed + virtual bool isSuccessfullyCompleted() const = 0; + virtual bool isOpen() const = 0; // Started but not complete + virtual bool hasChildren() const = 0; + + virtual ITracker& parent() = 0; + + // actions + virtual void close() = 0; // Successfully complete + virtual void fail() = 0; + virtual void markAsNeedingAnotherRun() = 0; + + virtual void addChild( ITrackerPtr const& child ) = 0; + virtual ITrackerPtr findChild( NameAndLocation const& nameAndLocation ) = 0; + virtual void openChild() = 0; + + // Debug/ checking + virtual bool isSectionTracker() const = 0; + virtual bool isGeneratorTracker() const = 0; + }; + + class TrackerContext { + + enum RunState { + NotStarted, + Executing, + CompletedCycle + }; + + ITrackerPtr m_rootTracker; + ITracker* m_currentTracker = nullptr; + RunState m_runState = NotStarted; + + public: + + static TrackerContext& instance(); + + ITracker& startRun(); + void endRun(); + + void startCycle(); + void completeCycle(); + + bool completedCycle() const; + ITracker& currentTracker(); + void setCurrentTracker( ITracker* tracker ); + }; + + class TrackerBase : public ITracker { + protected: + enum CycleState { + NotStarted, + Executing, + ExecutingChildren, + NeedsAnotherRun, + CompletedSuccessfully, + Failed + }; + + using Children = std::vector; + NameAndLocation m_nameAndLocation; + TrackerContext& m_ctx; + ITracker* m_parent; + Children m_children; + CycleState m_runState = NotStarted; + + public: + TrackerBase( NameAndLocation const& nameAndLocation, TrackerContext& ctx, ITracker* parent ); + + NameAndLocation const& nameAndLocation() const override; + bool isComplete() const override; + bool isSuccessfullyCompleted() const override; + bool isOpen() const override; + bool hasChildren() const override; + + void addChild( ITrackerPtr const& child ) override; + + ITrackerPtr findChild( NameAndLocation const& nameAndLocation ) override; + ITracker& parent() override; + + void openChild() override; + + bool isSectionTracker() const override; + bool isGeneratorTracker() const override; + + void open(); + + void close() override; + void fail() override; + void markAsNeedingAnotherRun() override; + + private: + void moveToParent(); + void moveToThis(); + }; + + class SectionTracker : public TrackerBase { + std::vector m_filters; + public: + SectionTracker( NameAndLocation const& nameAndLocation, TrackerContext& ctx, ITracker* parent ); + + bool isSectionTracker() const override; + + bool isComplete() const override; + + static SectionTracker& acquire( TrackerContext& ctx, NameAndLocation const& nameAndLocation ); + + void tryOpen(); + + void addInitialFilters( std::vector const& filters ); + void addNextFilters( std::vector const& filters ); + }; + +} // namespace TestCaseTracking + +using TestCaseTracking::ITracker; +using TestCaseTracking::TrackerContext; +using TestCaseTracking::SectionTracker; + +} // namespace Catch + +// end catch_test_case_tracker.h + +// start catch_leak_detector.h + +namespace Catch { + + struct LeakDetector { + LeakDetector(); + ~LeakDetector(); + }; + +} +// end catch_leak_detector.h +// Cpp files will be included in the single-header file here +// start catch_approx.cpp + +#include +#include + +namespace { + +// Performs equivalent check of std::fabs(lhs - rhs) <= margin +// But without the subtraction to allow for INFINITY in comparison +bool marginComparison(double lhs, double rhs, double margin) { + return (lhs + margin >= rhs) && (rhs + margin >= lhs); +} + +} + +namespace Catch { +namespace Detail { + + Approx::Approx ( double value ) + : m_epsilon( std::numeric_limits::epsilon()*100 ), + m_margin( 0.0 ), + m_scale( 0.0 ), + m_value( value ) + {} + + Approx Approx::custom() { + return Approx( 0 ); + } + + Approx Approx::operator-() const { + auto temp(*this); + temp.m_value = -temp.m_value; + return temp; + } + + std::string Approx::toString() const { + ReusableStringStream rss; + rss << "Approx( " << ::Catch::Detail::stringify( m_value ) << " )"; + return rss.str(); + } + + bool Approx::equalityComparisonImpl(const double other) const { + // First try with fixed margin, then compute margin based on epsilon, scale and Approx's value + // Thanks to Richard Harris for his help refining the scaled margin value + return marginComparison(m_value, other, m_margin) || marginComparison(m_value, other, m_epsilon * (m_scale + std::fabs(m_value))); + } + + void Approx::setMargin(double margin) { + CATCH_ENFORCE(margin >= 0, + "Invalid Approx::margin: " << margin << '.' + << " Approx::Margin has to be non-negative."); + m_margin = margin; + } + + void Approx::setEpsilon(double epsilon) { + CATCH_ENFORCE(epsilon >= 0 && epsilon <= 1.0, + "Invalid Approx::epsilon: " << epsilon << '.' + << " Approx::epsilon has to be in [0, 1]"); + m_epsilon = epsilon; + } + +} // end namespace Detail + +namespace literals { + Detail::Approx operator "" _a(long double val) { + return Detail::Approx(val); + } + Detail::Approx operator "" _a(unsigned long long val) { + return Detail::Approx(val); + } +} // end namespace literals + +std::string StringMaker::convert(Catch::Detail::Approx const& value) { + return value.toString(); +} + +} // end namespace Catch +// end catch_approx.cpp +// start catch_assertionhandler.cpp + +// start catch_debugger.h + +namespace Catch { + bool isDebuggerActive(); +} + +#ifdef CATCH_PLATFORM_MAC + + #define CATCH_TRAP() __asm__("int $3\n" : : ) /* NOLINT */ + +#elif defined(CATCH_PLATFORM_LINUX) + // If we can use inline assembler, do it because this allows us to break + // directly at the location of the failing check instead of breaking inside + // raise() called from it, i.e. one stack frame below. + #if defined(__GNUC__) && (defined(__i386) || defined(__x86_64)) + #define CATCH_TRAP() asm volatile ("int $3") /* NOLINT */ + #else // Fall back to the generic way. + #include + + #define CATCH_TRAP() raise(SIGTRAP) + #endif +#elif defined(_MSC_VER) + #define CATCH_TRAP() __debugbreak() +#elif defined(__MINGW32__) + extern "C" __declspec(dllimport) void __stdcall DebugBreak(); + #define CATCH_TRAP() DebugBreak() +#endif + +#ifdef CATCH_TRAP + #define CATCH_BREAK_INTO_DEBUGGER() []{ if( Catch::isDebuggerActive() ) { CATCH_TRAP(); } }() +#else + #define CATCH_BREAK_INTO_DEBUGGER() []{}() +#endif + +// end catch_debugger.h +// start catch_run_context.h + +// start catch_fatal_condition.h + +// start catch_windows_h_proxy.h + + +#if defined(CATCH_PLATFORM_WINDOWS) + +#if !defined(NOMINMAX) && !defined(CATCH_CONFIG_NO_NOMINMAX) +# define CATCH_DEFINED_NOMINMAX +# define NOMINMAX +#endif +#if !defined(WIN32_LEAN_AND_MEAN) && !defined(CATCH_CONFIG_NO_WIN32_LEAN_AND_MEAN) +# define CATCH_DEFINED_WIN32_LEAN_AND_MEAN +# define WIN32_LEAN_AND_MEAN +#endif + +#ifdef __AFXDLL +#include +#else +#include +#endif + +#ifdef CATCH_DEFINED_NOMINMAX +# undef NOMINMAX +#endif +#ifdef CATCH_DEFINED_WIN32_LEAN_AND_MEAN +# undef WIN32_LEAN_AND_MEAN +#endif + +#endif // defined(CATCH_PLATFORM_WINDOWS) + +// end catch_windows_h_proxy.h +#if defined( CATCH_CONFIG_WINDOWS_SEH ) + +namespace Catch { + + struct FatalConditionHandler { + + static LONG CALLBACK handleVectoredException(PEXCEPTION_POINTERS ExceptionInfo); + FatalConditionHandler(); + static void reset(); + ~FatalConditionHandler(); + + private: + static bool isSet; + static ULONG guaranteeSize; + static PVOID exceptionHandlerHandle; + }; + +} // namespace Catch + +#elif defined ( CATCH_CONFIG_POSIX_SIGNALS ) + +#include + +namespace Catch { + + struct FatalConditionHandler { + + static bool isSet; + static struct sigaction oldSigActions[]; + static stack_t oldSigStack; + static char altStackMem[]; + + static void handleSignal( int sig ); + + FatalConditionHandler(); + ~FatalConditionHandler(); + static void reset(); + }; + +} // namespace Catch + +#else + +namespace Catch { + struct FatalConditionHandler { + void reset(); + }; +} + +#endif + +// end catch_fatal_condition.h +#include + +namespace Catch { + + struct IMutableContext; + + /////////////////////////////////////////////////////////////////////////// + + class RunContext : public IResultCapture, public IRunner { + + public: + RunContext( RunContext const& ) = delete; + RunContext& operator =( RunContext const& ) = delete; + + explicit RunContext( IConfigPtr const& _config, IStreamingReporterPtr&& reporter ); + + ~RunContext() override; + + void testGroupStarting( std::string const& testSpec, std::size_t groupIndex, std::size_t groupsCount ); + void testGroupEnded( std::string const& testSpec, Totals const& totals, std::size_t groupIndex, std::size_t groupsCount ); + + Totals runTest(TestCase const& testCase); + + IConfigPtr config() const; + IStreamingReporter& reporter() const; + + public: // IResultCapture + + // Assertion handlers + void handleExpr + ( AssertionInfo const& info, + ITransientExpression const& expr, + AssertionReaction& reaction ) override; + void handleMessage + ( AssertionInfo const& info, + ResultWas::OfType resultType, + StringRef const& message, + AssertionReaction& reaction ) override; + void handleUnexpectedExceptionNotThrown + ( AssertionInfo const& info, + AssertionReaction& reaction ) override; + void handleUnexpectedInflightException + ( AssertionInfo const& info, + std::string const& message, + AssertionReaction& reaction ) override; + void handleIncomplete + ( AssertionInfo const& info ) override; + void handleNonExpr + ( AssertionInfo const &info, + ResultWas::OfType resultType, + AssertionReaction &reaction ) override; + + bool sectionStarted( SectionInfo const& sectionInfo, Counts& assertions ) override; + + void sectionEnded( SectionEndInfo const& endInfo ) override; + void sectionEndedEarly( SectionEndInfo const& endInfo ) override; + + auto acquireGeneratorTracker( SourceLineInfo const& lineInfo ) -> IGeneratorTracker& override; + + void benchmarkStarting( BenchmarkInfo const& info ) override; + void benchmarkEnded( BenchmarkStats const& stats ) override; + + void pushScopedMessage( MessageInfo const& message ) override; + void popScopedMessage( MessageInfo const& message ) override; + + void emplaceUnscopedMessage( MessageBuilder const& builder ) override; + + std::string getCurrentTestName() const override; + + const AssertionResult* getLastResult() const override; + + void exceptionEarlyReported() override; + + void handleFatalErrorCondition( StringRef message ) override; + + bool lastAssertionPassed() override; + + void assertionPassed() override; + + public: + // !TBD We need to do this another way! + bool aborting() const final; + + private: + + void runCurrentTest( std::string& redirectedCout, std::string& redirectedCerr ); + void invokeActiveTestCase(); + + void resetAssertionInfo(); + bool testForMissingAssertions( Counts& assertions ); + + void assertionEnded( AssertionResult const& result ); + void reportExpr + ( AssertionInfo const &info, + ResultWas::OfType resultType, + ITransientExpression const *expr, + bool negated ); + + void populateReaction( AssertionReaction& reaction ); + + private: + + void handleUnfinishedSections(); + + TestRunInfo m_runInfo; + IMutableContext& m_context; + TestCase const* m_activeTestCase = nullptr; + ITracker* m_testCaseTracker = nullptr; + Option m_lastResult; + + IConfigPtr m_config; + Totals m_totals; + IStreamingReporterPtr m_reporter; + std::vector m_messages; + std::vector m_messageScopes; /* Keeps owners of so-called unscoped messages. */ + AssertionInfo m_lastAssertionInfo; + std::vector m_unfinishedSections; + std::vector m_activeSections; + TrackerContext m_trackerContext; + bool m_lastAssertionPassed = false; + bool m_shouldReportUnexpected = true; + bool m_includeSuccessfulResults; + }; + +} // end namespace Catch + +// end catch_run_context.h +namespace Catch { + + namespace { + auto operator <<( std::ostream& os, ITransientExpression const& expr ) -> std::ostream& { + expr.streamReconstructedExpression( os ); + return os; + } + } + + LazyExpression::LazyExpression( bool isNegated ) + : m_isNegated( isNegated ) + {} + + LazyExpression::LazyExpression( LazyExpression const& other ) : m_isNegated( other.m_isNegated ) {} + + LazyExpression::operator bool() const { + return m_transientExpression != nullptr; + } + + auto operator << ( std::ostream& os, LazyExpression const& lazyExpr ) -> std::ostream& { + if( lazyExpr.m_isNegated ) + os << "!"; + + if( lazyExpr ) { + if( lazyExpr.m_isNegated && lazyExpr.m_transientExpression->isBinaryExpression() ) + os << "(" << *lazyExpr.m_transientExpression << ")"; + else + os << *lazyExpr.m_transientExpression; + } + else { + os << "{** error - unchecked empty expression requested **}"; + } + return os; + } + + AssertionHandler::AssertionHandler + ( StringRef const& macroName, + SourceLineInfo const& lineInfo, + StringRef capturedExpression, + ResultDisposition::Flags resultDisposition ) + : m_assertionInfo{ macroName, lineInfo, capturedExpression, resultDisposition }, + m_resultCapture( getResultCapture() ) + {} + + void AssertionHandler::handleExpr( ITransientExpression const& expr ) { + m_resultCapture.handleExpr( m_assertionInfo, expr, m_reaction ); + } + void AssertionHandler::handleMessage(ResultWas::OfType resultType, StringRef const& message) { + m_resultCapture.handleMessage( m_assertionInfo, resultType, message, m_reaction ); + } + + auto AssertionHandler::allowThrows() const -> bool { + return getCurrentContext().getConfig()->allowThrows(); + } + + void AssertionHandler::complete() { + setCompleted(); + if( m_reaction.shouldDebugBreak ) { + + // If you find your debugger stopping you here then go one level up on the + // call-stack for the code that caused it (typically a failed assertion) + + // (To go back to the test and change execution, jump over the throw, next) + CATCH_BREAK_INTO_DEBUGGER(); + } + if (m_reaction.shouldThrow) { +#if !defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) + throw Catch::TestFailureException(); +#else + CATCH_ERROR( "Test failure requires aborting test!" ); +#endif + } + } + void AssertionHandler::setCompleted() { + m_completed = true; + } + + void AssertionHandler::handleUnexpectedInflightException() { + m_resultCapture.handleUnexpectedInflightException( m_assertionInfo, Catch::translateActiveException(), m_reaction ); + } + + void AssertionHandler::handleExceptionThrownAsExpected() { + m_resultCapture.handleNonExpr(m_assertionInfo, ResultWas::Ok, m_reaction); + } + void AssertionHandler::handleExceptionNotThrownAsExpected() { + m_resultCapture.handleNonExpr(m_assertionInfo, ResultWas::Ok, m_reaction); + } + + void AssertionHandler::handleUnexpectedExceptionNotThrown() { + m_resultCapture.handleUnexpectedExceptionNotThrown( m_assertionInfo, m_reaction ); + } + + void AssertionHandler::handleThrowingCallSkipped() { + m_resultCapture.handleNonExpr(m_assertionInfo, ResultWas::Ok, m_reaction); + } + + // This is the overload that takes a string and infers the Equals matcher from it + // The more general overload, that takes any string matcher, is in catch_capture_matchers.cpp + void handleExceptionMatchExpr( AssertionHandler& handler, std::string const& str, StringRef const& matcherString ) { + handleExceptionMatchExpr( handler, Matchers::Equals( str ), matcherString ); + } + +} // namespace Catch +// end catch_assertionhandler.cpp +// start catch_assertionresult.cpp + +namespace Catch { + AssertionResultData::AssertionResultData(ResultWas::OfType _resultType, LazyExpression const & _lazyExpression): + lazyExpression(_lazyExpression), + resultType(_resultType) {} + + std::string AssertionResultData::reconstructExpression() const { + + if( reconstructedExpression.empty() ) { + if( lazyExpression ) { + ReusableStringStream rss; + rss << lazyExpression; + reconstructedExpression = rss.str(); + } + } + return reconstructedExpression; + } + + AssertionResult::AssertionResult( AssertionInfo const& info, AssertionResultData const& data ) + : m_info( info ), + m_resultData( data ) + {} + + // Result was a success + bool AssertionResult::succeeded() const { + return Catch::isOk( m_resultData.resultType ); + } + + // Result was a success, or failure is suppressed + bool AssertionResult::isOk() const { + return Catch::isOk( m_resultData.resultType ) || shouldSuppressFailure( m_info.resultDisposition ); + } + + ResultWas::OfType AssertionResult::getResultType() const { + return m_resultData.resultType; + } + + bool AssertionResult::hasExpression() const { + return m_info.capturedExpression[0] != 0; + } + + bool AssertionResult::hasMessage() const { + return !m_resultData.message.empty(); + } + + std::string AssertionResult::getExpression() const { + if( isFalseTest( m_info.resultDisposition ) ) + return "!(" + m_info.capturedExpression + ")"; + else + return m_info.capturedExpression; + } + + std::string AssertionResult::getExpressionInMacro() const { + std::string expr; + if( m_info.macroName[0] == 0 ) + expr = m_info.capturedExpression; + else { + expr.reserve( m_info.macroName.size() + m_info.capturedExpression.size() + 4 ); + expr += m_info.macroName; + expr += "( "; + expr += m_info.capturedExpression; + expr += " )"; + } + return expr; + } + + bool AssertionResult::hasExpandedExpression() const { + return hasExpression() && getExpandedExpression() != getExpression(); + } + + std::string AssertionResult::getExpandedExpression() const { + std::string expr = m_resultData.reconstructExpression(); + return expr.empty() + ? getExpression() + : expr; + } + + std::string AssertionResult::getMessage() const { + return m_resultData.message; + } + SourceLineInfo AssertionResult::getSourceInfo() const { + return m_info.lineInfo; + } + + StringRef AssertionResult::getTestMacroName() const { + return m_info.macroName; + } + +} // end namespace Catch +// end catch_assertionresult.cpp +// start catch_benchmark.cpp + +namespace Catch { + + auto BenchmarkLooper::getResolution() -> uint64_t { + return getEstimatedClockResolution() * getCurrentContext().getConfig()->benchmarkResolutionMultiple(); + } + + void BenchmarkLooper::reportStart() { + getResultCapture().benchmarkStarting( { m_name } ); + } + auto BenchmarkLooper::needsMoreIterations() -> bool { + auto elapsed = m_timer.getElapsedNanoseconds(); + + // Exponentially increasing iterations until we're confident in our timer resolution + if( elapsed < m_resolution ) { + m_iterationsToRun *= 10; + return true; + } + + getResultCapture().benchmarkEnded( { { m_name }, m_count, elapsed } ); + return false; + } + +} // end namespace Catch +// end catch_benchmark.cpp +// start catch_capture_matchers.cpp + +namespace Catch { + + using StringMatcher = Matchers::Impl::MatcherBase; + + // This is the general overload that takes a any string matcher + // There is another overload, in catch_assertionhandler.h/.cpp, that only takes a string and infers + // the Equals matcher (so the header does not mention matchers) + void handleExceptionMatchExpr( AssertionHandler& handler, StringMatcher const& matcher, StringRef const& matcherString ) { + std::string exceptionMessage = Catch::translateActiveException(); + MatchExpr expr( exceptionMessage, matcher, matcherString ); + handler.handleExpr( expr ); + } + +} // namespace Catch +// end catch_capture_matchers.cpp +// start catch_commandline.cpp + +// start catch_commandline.h + +// start catch_clara.h + +// Use Catch's value for console width (store Clara's off to the side, if present) +#ifdef CLARA_CONFIG_CONSOLE_WIDTH +#define CATCH_TEMP_CLARA_CONFIG_CONSOLE_WIDTH CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH +#undef CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH +#endif +#define CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH CATCH_CONFIG_CONSOLE_WIDTH-1 + +#ifdef __clang__ +#pragma clang diagnostic push +#pragma clang diagnostic ignored "-Wweak-vtables" +#pragma clang diagnostic ignored "-Wexit-time-destructors" +#pragma clang diagnostic ignored "-Wshadow" +#endif + +// start clara.hpp +// Copyright 2017 Two Blue Cubes Ltd. All rights reserved. +// +// Distributed under the Boost Software License, Version 1.0. (See accompanying +// file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt) +// +// See https://github.com/philsquared/Clara for more details + +// Clara v1.1.5 + + +#ifndef CATCH_CLARA_CONFIG_CONSOLE_WIDTH +#define CATCH_CLARA_CONFIG_CONSOLE_WIDTH 80 +#endif + +#ifndef CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH +#define CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH CATCH_CLARA_CONFIG_CONSOLE_WIDTH +#endif + +#ifndef CLARA_CONFIG_OPTIONAL_TYPE +#ifdef __has_include +#if __has_include() && __cplusplus >= 201703L +#include +#define CLARA_CONFIG_OPTIONAL_TYPE std::optional +#endif +#endif +#endif + +// ----------- #included from clara_textflow.hpp ----------- + +// TextFlowCpp +// +// A single-header library for wrapping and laying out basic text, by Phil Nash +// +// Distributed under the Boost Software License, Version 1.0. (See accompanying +// file LICENSE.txt or copy at http://www.boost.org/LICENSE_1_0.txt) +// +// This project is hosted at https://github.com/philsquared/textflowcpp + + +#include +#include +#include +#include + +#ifndef CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH +#define CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH 80 +#endif + +namespace Catch { +namespace clara { +namespace TextFlow { + +inline auto isWhitespace(char c) -> bool { + static std::string chars = " \t\n\r"; + return chars.find(c) != std::string::npos; +} +inline auto isBreakableBefore(char c) -> bool { + static std::string chars = "[({<|"; + return chars.find(c) != std::string::npos; +} +inline auto isBreakableAfter(char c) -> bool { + static std::string chars = "])}>.,:;*+-=&/\\"; + return chars.find(c) != std::string::npos; +} + +class Columns; + +class Column { + std::vector m_strings; + size_t m_width = CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH; + size_t m_indent = 0; + size_t m_initialIndent = std::string::npos; + +public: + class iterator { + friend Column; + + Column const& m_column; + size_t m_stringIndex = 0; + size_t m_pos = 0; + + size_t m_len = 0; + size_t m_end = 0; + bool m_suffix = false; + + iterator(Column const& column, size_t stringIndex) + : m_column(column), + m_stringIndex(stringIndex) {} + + auto line() const -> std::string const& { return m_column.m_strings[m_stringIndex]; } + + auto isBoundary(size_t at) const -> bool { + assert(at > 0); + assert(at <= line().size()); + + return at == line().size() || + (isWhitespace(line()[at]) && !isWhitespace(line()[at - 1])) || + isBreakableBefore(line()[at]) || + isBreakableAfter(line()[at - 1]); + } + + void calcLength() { + assert(m_stringIndex < m_column.m_strings.size()); + + m_suffix = false; + auto width = m_column.m_width - indent(); + m_end = m_pos; + while (m_end < line().size() && line()[m_end] != '\n') + ++m_end; + + if (m_end < m_pos + width) { + m_len = m_end - m_pos; + } else { + size_t len = width; + while (len > 0 && !isBoundary(m_pos + len)) + --len; + while (len > 0 && isWhitespace(line()[m_pos + len - 1])) + --len; + + if (len > 0) { + m_len = len; + } else { + m_suffix = true; + m_len = width - 1; + } + } + } + + auto indent() const -> size_t { + auto initial = m_pos == 0 && m_stringIndex == 0 ? m_column.m_initialIndent : std::string::npos; + return initial == std::string::npos ? m_column.m_indent : initial; + } + + auto addIndentAndSuffix(std::string const &plain) const -> std::string { + return std::string(indent(), ' ') + (m_suffix ? plain + "-" : plain); + } + + public: + using difference_type = std::ptrdiff_t; + using value_type = std::string; + using pointer = value_type * ; + using reference = value_type & ; + using iterator_category = std::forward_iterator_tag; + + explicit iterator(Column const& column) : m_column(column) { + assert(m_column.m_width > m_column.m_indent); + assert(m_column.m_initialIndent == std::string::npos || m_column.m_width > m_column.m_initialIndent); + calcLength(); + if (m_len == 0) + m_stringIndex++; // Empty string + } + + auto operator *() const -> std::string { + assert(m_stringIndex < m_column.m_strings.size()); + assert(m_pos <= m_end); + return addIndentAndSuffix(line().substr(m_pos, m_len)); + } + + auto operator ++() -> iterator& { + m_pos += m_len; + if (m_pos < line().size() && line()[m_pos] == '\n') + m_pos += 1; + else + while (m_pos < line().size() && isWhitespace(line()[m_pos])) + ++m_pos; + + if (m_pos == line().size()) { + m_pos = 0; + ++m_stringIndex; + } + if (m_stringIndex < m_column.m_strings.size()) + calcLength(); + return *this; + } + auto operator ++(int) -> iterator { + iterator prev(*this); + operator++(); + return prev; + } + + auto operator ==(iterator const& other) const -> bool { + return + m_pos == other.m_pos && + m_stringIndex == other.m_stringIndex && + &m_column == &other.m_column; + } + auto operator !=(iterator const& other) const -> bool { + return !operator==(other); + } + }; + using const_iterator = iterator; + + explicit Column(std::string const& text) { m_strings.push_back(text); } + + auto width(size_t newWidth) -> Column& { + assert(newWidth > 0); + m_width = newWidth; + return *this; + } + auto indent(size_t newIndent) -> Column& { + m_indent = newIndent; + return *this; + } + auto initialIndent(size_t newIndent) -> Column& { + m_initialIndent = newIndent; + return *this; + } + + auto width() const -> size_t { return m_width; } + auto begin() const -> iterator { return iterator(*this); } + auto end() const -> iterator { return { *this, m_strings.size() }; } + + inline friend std::ostream& operator << (std::ostream& os, Column const& col) { + bool first = true; + for (auto line : col) { + if (first) + first = false; + else + os << "\n"; + os << line; + } + return os; + } + + auto operator + (Column const& other)->Columns; + + auto toString() const -> std::string { + std::ostringstream oss; + oss << *this; + return oss.str(); + } +}; + +class Spacer : public Column { + +public: + explicit Spacer(size_t spaceWidth) : Column("") { + width(spaceWidth); + } +}; + +class Columns { + std::vector m_columns; + +public: + + class iterator { + friend Columns; + struct EndTag {}; + + std::vector const& m_columns; + std::vector m_iterators; + size_t m_activeIterators; + + iterator(Columns const& columns, EndTag) + : m_columns(columns.m_columns), + m_activeIterators(0) { + m_iterators.reserve(m_columns.size()); + + for (auto const& col : m_columns) + m_iterators.push_back(col.end()); + } + + public: + using difference_type = std::ptrdiff_t; + using value_type = std::string; + using pointer = value_type * ; + using reference = value_type & ; + using iterator_category = std::forward_iterator_tag; + + explicit iterator(Columns const& columns) + : m_columns(columns.m_columns), + m_activeIterators(m_columns.size()) { + m_iterators.reserve(m_columns.size()); + + for (auto const& col : m_columns) + m_iterators.push_back(col.begin()); + } + + auto operator ==(iterator const& other) const -> bool { + return m_iterators == other.m_iterators; + } + auto operator !=(iterator const& other) const -> bool { + return m_iterators != other.m_iterators; + } + auto operator *() const -> std::string { + std::string row, padding; + + for (size_t i = 0; i < m_columns.size(); ++i) { + auto width = m_columns[i].width(); + if (m_iterators[i] != m_columns[i].end()) { + std::string col = *m_iterators[i]; + row += padding + col; + if (col.size() < width) + padding = std::string(width - col.size(), ' '); + else + padding = ""; + } else { + padding += std::string(width, ' '); + } + } + return row; + } + auto operator ++() -> iterator& { + for (size_t i = 0; i < m_columns.size(); ++i) { + if (m_iterators[i] != m_columns[i].end()) + ++m_iterators[i]; + } + return *this; + } + auto operator ++(int) -> iterator { + iterator prev(*this); + operator++(); + return prev; + } + }; + using const_iterator = iterator; + + auto begin() const -> iterator { return iterator(*this); } + auto end() const -> iterator { return { *this, iterator::EndTag() }; } + + auto operator += (Column const& col) -> Columns& { + m_columns.push_back(col); + return *this; + } + auto operator + (Column const& col) -> Columns { + Columns combined = *this; + combined += col; + return combined; + } + + inline friend std::ostream& operator << (std::ostream& os, Columns const& cols) { + + bool first = true; + for (auto line : cols) { + if (first) + first = false; + else + os << "\n"; + os << line; + } + return os; + } + + auto toString() const -> std::string { + std::ostringstream oss; + oss << *this; + return oss.str(); + } +}; + +inline auto Column::operator + (Column const& other) -> Columns { + Columns cols; + cols += *this; + cols += other; + return cols; +} +} + +} +} + +// ----------- end of #include from clara_textflow.hpp ----------- +// ........... back in clara.hpp + +#include +#include +#include +#include +#include + +#if !defined(CATCH_PLATFORM_WINDOWS) && ( defined(WIN32) || defined(__WIN32__) || defined(_WIN32) || defined(_MSC_VER) ) +#define CATCH_PLATFORM_WINDOWS +#endif + +namespace Catch { namespace clara { +namespace detail { + + // Traits for extracting arg and return type of lambdas (for single argument lambdas) + template + struct UnaryLambdaTraits : UnaryLambdaTraits {}; + + template + struct UnaryLambdaTraits { + static const bool isValid = false; + }; + + template + struct UnaryLambdaTraits { + static const bool isValid = true; + using ArgType = typename std::remove_const::type>::type; + using ReturnType = ReturnT; + }; + + class TokenStream; + + // Transport for raw args (copied from main args, or supplied via init list for testing) + class Args { + friend TokenStream; + std::string m_exeName; + std::vector m_args; + + public: + Args( int argc, char const* const* argv ) + : m_exeName(argv[0]), + m_args(argv + 1, argv + argc) {} + + Args( std::initializer_list args ) + : m_exeName( *args.begin() ), + m_args( args.begin()+1, args.end() ) + {} + + auto exeName() const -> std::string { + return m_exeName; + } + }; + + // Wraps a token coming from a token stream. These may not directly correspond to strings as a single string + // may encode an option + its argument if the : or = form is used + enum class TokenType { + Option, Argument + }; + struct Token { + TokenType type; + std::string token; + }; + + inline auto isOptPrefix( char c ) -> bool { + return c == '-' +#ifdef CATCH_PLATFORM_WINDOWS + || c == '/' +#endif + ; + } + + // Abstracts iterators into args as a stream of tokens, with option arguments uniformly handled + class TokenStream { + using Iterator = std::vector::const_iterator; + Iterator it; + Iterator itEnd; + std::vector m_tokenBuffer; + + void loadBuffer() { + m_tokenBuffer.resize( 0 ); + + // Skip any empty strings + while( it != itEnd && it->empty() ) + ++it; + + if( it != itEnd ) { + auto const &next = *it; + if( isOptPrefix( next[0] ) ) { + auto delimiterPos = next.find_first_of( " :=" ); + if( delimiterPos != std::string::npos ) { + m_tokenBuffer.push_back( { TokenType::Option, next.substr( 0, delimiterPos ) } ); + m_tokenBuffer.push_back( { TokenType::Argument, next.substr( delimiterPos + 1 ) } ); + } else { + if( next[1] != '-' && next.size() > 2 ) { + std::string opt = "- "; + for( size_t i = 1; i < next.size(); ++i ) { + opt[1] = next[i]; + m_tokenBuffer.push_back( { TokenType::Option, opt } ); + } + } else { + m_tokenBuffer.push_back( { TokenType::Option, next } ); + } + } + } else { + m_tokenBuffer.push_back( { TokenType::Argument, next } ); + } + } + } + + public: + explicit TokenStream( Args const &args ) : TokenStream( args.m_args.begin(), args.m_args.end() ) {} + + TokenStream( Iterator it, Iterator itEnd ) : it( it ), itEnd( itEnd ) { + loadBuffer(); + } + + explicit operator bool() const { + return !m_tokenBuffer.empty() || it != itEnd; + } + + auto count() const -> size_t { return m_tokenBuffer.size() + (itEnd - it); } + + auto operator*() const -> Token { + assert( !m_tokenBuffer.empty() ); + return m_tokenBuffer.front(); + } + + auto operator->() const -> Token const * { + assert( !m_tokenBuffer.empty() ); + return &m_tokenBuffer.front(); + } + + auto operator++() -> TokenStream & { + if( m_tokenBuffer.size() >= 2 ) { + m_tokenBuffer.erase( m_tokenBuffer.begin() ); + } else { + if( it != itEnd ) + ++it; + loadBuffer(); + } + return *this; + } + }; + + class ResultBase { + public: + enum Type { + Ok, LogicError, RuntimeError + }; + + protected: + ResultBase( Type type ) : m_type( type ) {} + virtual ~ResultBase() = default; + + virtual void enforceOk() const = 0; + + Type m_type; + }; + + template + class ResultValueBase : public ResultBase { + public: + auto value() const -> T const & { + enforceOk(); + return m_value; + } + + protected: + ResultValueBase( Type type ) : ResultBase( type ) {} + + ResultValueBase( ResultValueBase const &other ) : ResultBase( other ) { + if( m_type == ResultBase::Ok ) + new( &m_value ) T( other.m_value ); + } + + ResultValueBase( Type, T const &value ) : ResultBase( Ok ) { + new( &m_value ) T( value ); + } + + auto operator=( ResultValueBase const &other ) -> ResultValueBase & { + if( m_type == ResultBase::Ok ) + m_value.~T(); + ResultBase::operator=(other); + if( m_type == ResultBase::Ok ) + new( &m_value ) T( other.m_value ); + return *this; + } + + ~ResultValueBase() override { + if( m_type == Ok ) + m_value.~T(); + } + + union { + T m_value; + }; + }; + + template<> + class ResultValueBase : public ResultBase { + protected: + using ResultBase::ResultBase; + }; + + template + class BasicResult : public ResultValueBase { + public: + template + explicit BasicResult( BasicResult const &other ) + : ResultValueBase( other.type() ), + m_errorMessage( other.errorMessage() ) + { + assert( type() != ResultBase::Ok ); + } + + template + static auto ok( U const &value ) -> BasicResult { return { ResultBase::Ok, value }; } + static auto ok() -> BasicResult { return { ResultBase::Ok }; } + static auto logicError( std::string const &message ) -> BasicResult { return { ResultBase::LogicError, message }; } + static auto runtimeError( std::string const &message ) -> BasicResult { return { ResultBase::RuntimeError, message }; } + + explicit operator bool() const { return m_type == ResultBase::Ok; } + auto type() const -> ResultBase::Type { return m_type; } + auto errorMessage() const -> std::string { return m_errorMessage; } + + protected: + void enforceOk() const override { + + // Errors shouldn't reach this point, but if they do + // the actual error message will be in m_errorMessage + assert( m_type != ResultBase::LogicError ); + assert( m_type != ResultBase::RuntimeError ); + if( m_type != ResultBase::Ok ) + std::abort(); + } + + std::string m_errorMessage; // Only populated if resultType is an error + + BasicResult( ResultBase::Type type, std::string const &message ) + : ResultValueBase(type), + m_errorMessage(message) + { + assert( m_type != ResultBase::Ok ); + } + + using ResultValueBase::ResultValueBase; + using ResultBase::m_type; + }; + + enum class ParseResultType { + Matched, NoMatch, ShortCircuitAll, ShortCircuitSame + }; + + class ParseState { + public: + + ParseState( ParseResultType type, TokenStream const &remainingTokens ) + : m_type(type), + m_remainingTokens( remainingTokens ) + {} + + auto type() const -> ParseResultType { return m_type; } + auto remainingTokens() const -> TokenStream { return m_remainingTokens; } + + private: + ParseResultType m_type; + TokenStream m_remainingTokens; + }; + + using Result = BasicResult; + using ParserResult = BasicResult; + using InternalParseResult = BasicResult; + + struct HelpColumns { + std::string left; + std::string right; + }; + + template + inline auto convertInto( std::string const &source, T& target ) -> ParserResult { + std::stringstream ss; + ss << source; + ss >> target; + if( ss.fail() ) + return ParserResult::runtimeError( "Unable to convert '" + source + "' to destination type" ); + else + return ParserResult::ok( ParseResultType::Matched ); + } + inline auto convertInto( std::string const &source, std::string& target ) -> ParserResult { + target = source; + return ParserResult::ok( ParseResultType::Matched ); + } + inline auto convertInto( std::string const &source, bool &target ) -> ParserResult { + std::string srcLC = source; + std::transform( srcLC.begin(), srcLC.end(), srcLC.begin(), []( char c ) { return static_cast( std::tolower(c) ); } ); + if (srcLC == "y" || srcLC == "1" || srcLC == "true" || srcLC == "yes" || srcLC == "on") + target = true; + else if (srcLC == "n" || srcLC == "0" || srcLC == "false" || srcLC == "no" || srcLC == "off") + target = false; + else + return ParserResult::runtimeError( "Expected a boolean value but did not recognise: '" + source + "'" ); + return ParserResult::ok( ParseResultType::Matched ); + } +#ifdef CLARA_CONFIG_OPTIONAL_TYPE + template + inline auto convertInto( std::string const &source, CLARA_CONFIG_OPTIONAL_TYPE& target ) -> ParserResult { + T temp; + auto result = convertInto( source, temp ); + if( result ) + target = std::move(temp); + return result; + } +#endif // CLARA_CONFIG_OPTIONAL_TYPE + + struct NonCopyable { + NonCopyable() = default; + NonCopyable( NonCopyable const & ) = delete; + NonCopyable( NonCopyable && ) = delete; + NonCopyable &operator=( NonCopyable const & ) = delete; + NonCopyable &operator=( NonCopyable && ) = delete; + }; + + struct BoundRef : NonCopyable { + virtual ~BoundRef() = default; + virtual auto isContainer() const -> bool { return false; } + virtual auto isFlag() const -> bool { return false; } + }; + struct BoundValueRefBase : BoundRef { + virtual auto setValue( std::string const &arg ) -> ParserResult = 0; + }; + struct BoundFlagRefBase : BoundRef { + virtual auto setFlag( bool flag ) -> ParserResult = 0; + virtual auto isFlag() const -> bool { return true; } + }; + + template + struct BoundValueRef : BoundValueRefBase { + T &m_ref; + + explicit BoundValueRef( T &ref ) : m_ref( ref ) {} + + auto setValue( std::string const &arg ) -> ParserResult override { + return convertInto( arg, m_ref ); + } + }; + + template + struct BoundValueRef> : BoundValueRefBase { + std::vector &m_ref; + + explicit BoundValueRef( std::vector &ref ) : m_ref( ref ) {} + + auto isContainer() const -> bool override { return true; } + + auto setValue( std::string const &arg ) -> ParserResult override { + T temp; + auto result = convertInto( arg, temp ); + if( result ) + m_ref.push_back( temp ); + return result; + } + }; + + struct BoundFlagRef : BoundFlagRefBase { + bool &m_ref; + + explicit BoundFlagRef( bool &ref ) : m_ref( ref ) {} + + auto setFlag( bool flag ) -> ParserResult override { + m_ref = flag; + return ParserResult::ok( ParseResultType::Matched ); + } + }; + + template + struct LambdaInvoker { + static_assert( std::is_same::value, "Lambda must return void or clara::ParserResult" ); + + template + static auto invoke( L const &lambda, ArgType const &arg ) -> ParserResult { + return lambda( arg ); + } + }; + + template<> + struct LambdaInvoker { + template + static auto invoke( L const &lambda, ArgType const &arg ) -> ParserResult { + lambda( arg ); + return ParserResult::ok( ParseResultType::Matched ); + } + }; + + template + inline auto invokeLambda( L const &lambda, std::string const &arg ) -> ParserResult { + ArgType temp{}; + auto result = convertInto( arg, temp ); + return !result + ? result + : LambdaInvoker::ReturnType>::invoke( lambda, temp ); + } + + template + struct BoundLambda : BoundValueRefBase { + L m_lambda; + + static_assert( UnaryLambdaTraits::isValid, "Supplied lambda must take exactly one argument" ); + explicit BoundLambda( L const &lambda ) : m_lambda( lambda ) {} + + auto setValue( std::string const &arg ) -> ParserResult override { + return invokeLambda::ArgType>( m_lambda, arg ); + } + }; + + template + struct BoundFlagLambda : BoundFlagRefBase { + L m_lambda; + + static_assert( UnaryLambdaTraits::isValid, "Supplied lambda must take exactly one argument" ); + static_assert( std::is_same::ArgType, bool>::value, "flags must be boolean" ); + + explicit BoundFlagLambda( L const &lambda ) : m_lambda( lambda ) {} + + auto setFlag( bool flag ) -> ParserResult override { + return LambdaInvoker::ReturnType>::invoke( m_lambda, flag ); + } + }; + + enum class Optionality { Optional, Required }; + + struct Parser; + + class ParserBase { + public: + virtual ~ParserBase() = default; + virtual auto validate() const -> Result { return Result::ok(); } + virtual auto parse( std::string const& exeName, TokenStream const &tokens) const -> InternalParseResult = 0; + virtual auto cardinality() const -> size_t { return 1; } + + auto parse( Args const &args ) const -> InternalParseResult { + return parse( args.exeName(), TokenStream( args ) ); + } + }; + + template + class ComposableParserImpl : public ParserBase { + public: + template + auto operator|( T const &other ) const -> Parser; + + template + auto operator+( T const &other ) const -> Parser; + }; + + // Common code and state for Args and Opts + template + class ParserRefImpl : public ComposableParserImpl { + protected: + Optionality m_optionality = Optionality::Optional; + std::shared_ptr m_ref; + std::string m_hint; + std::string m_description; + + explicit ParserRefImpl( std::shared_ptr const &ref ) : m_ref( ref ) {} + + public: + template + ParserRefImpl( T &ref, std::string const &hint ) + : m_ref( std::make_shared>( ref ) ), + m_hint( hint ) + {} + + template + ParserRefImpl( LambdaT const &ref, std::string const &hint ) + : m_ref( std::make_shared>( ref ) ), + m_hint(hint) + {} + + auto operator()( std::string const &description ) -> DerivedT & { + m_description = description; + return static_cast( *this ); + } + + auto optional() -> DerivedT & { + m_optionality = Optionality::Optional; + return static_cast( *this ); + }; + + auto required() -> DerivedT & { + m_optionality = Optionality::Required; + return static_cast( *this ); + }; + + auto isOptional() const -> bool { + return m_optionality == Optionality::Optional; + } + + auto cardinality() const -> size_t override { + if( m_ref->isContainer() ) + return 0; + else + return 1; + } + + auto hint() const -> std::string { return m_hint; } + }; + + class ExeName : public ComposableParserImpl { + std::shared_ptr m_name; + std::shared_ptr m_ref; + + template + static auto makeRef(LambdaT const &lambda) -> std::shared_ptr { + return std::make_shared>( lambda) ; + } + + public: + ExeName() : m_name( std::make_shared( "" ) ) {} + + explicit ExeName( std::string &ref ) : ExeName() { + m_ref = std::make_shared>( ref ); + } + + template + explicit ExeName( LambdaT const& lambda ) : ExeName() { + m_ref = std::make_shared>( lambda ); + } + + // The exe name is not parsed out of the normal tokens, but is handled specially + auto parse( std::string const&, TokenStream const &tokens ) const -> InternalParseResult override { + return InternalParseResult::ok( ParseState( ParseResultType::NoMatch, tokens ) ); + } + + auto name() const -> std::string { return *m_name; } + auto set( std::string const& newName ) -> ParserResult { + + auto lastSlash = newName.find_last_of( "\\/" ); + auto filename = ( lastSlash == std::string::npos ) + ? newName + : newName.substr( lastSlash+1 ); + + *m_name = filename; + if( m_ref ) + return m_ref->setValue( filename ); + else + return ParserResult::ok( ParseResultType::Matched ); + } + }; + + class Arg : public ParserRefImpl { + public: + using ParserRefImpl::ParserRefImpl; + + auto parse( std::string const &, TokenStream const &tokens ) const -> InternalParseResult override { + auto validationResult = validate(); + if( !validationResult ) + return InternalParseResult( validationResult ); + + auto remainingTokens = tokens; + auto const &token = *remainingTokens; + if( token.type != TokenType::Argument ) + return InternalParseResult::ok( ParseState( ParseResultType::NoMatch, remainingTokens ) ); + + assert( !m_ref->isFlag() ); + auto valueRef = static_cast( m_ref.get() ); + + auto result = valueRef->setValue( remainingTokens->token ); + if( !result ) + return InternalParseResult( result ); + else + return InternalParseResult::ok( ParseState( ParseResultType::Matched, ++remainingTokens ) ); + } + }; + + inline auto normaliseOpt( std::string const &optName ) -> std::string { +#ifdef CATCH_PLATFORM_WINDOWS + if( optName[0] == '/' ) + return "-" + optName.substr( 1 ); + else +#endif + return optName; + } + + class Opt : public ParserRefImpl { + protected: + std::vector m_optNames; + + public: + template + explicit Opt( LambdaT const &ref ) : ParserRefImpl( std::make_shared>( ref ) ) {} + + explicit Opt( bool &ref ) : ParserRefImpl( std::make_shared( ref ) ) {} + + template + Opt( LambdaT const &ref, std::string const &hint ) : ParserRefImpl( ref, hint ) {} + + template + Opt( T &ref, std::string const &hint ) : ParserRefImpl( ref, hint ) {} + + auto operator[]( std::string const &optName ) -> Opt & { + m_optNames.push_back( optName ); + return *this; + } + + auto getHelpColumns() const -> std::vector { + std::ostringstream oss; + bool first = true; + for( auto const &opt : m_optNames ) { + if (first) + first = false; + else + oss << ", "; + oss << opt; + } + if( !m_hint.empty() ) + oss << " <" << m_hint << ">"; + return { { oss.str(), m_description } }; + } + + auto isMatch( std::string const &optToken ) const -> bool { + auto normalisedToken = normaliseOpt( optToken ); + for( auto const &name : m_optNames ) { + if( normaliseOpt( name ) == normalisedToken ) + return true; + } + return false; + } + + using ParserBase::parse; + + auto parse( std::string const&, TokenStream const &tokens ) const -> InternalParseResult override { + auto validationResult = validate(); + if( !validationResult ) + return InternalParseResult( validationResult ); + + auto remainingTokens = tokens; + if( remainingTokens && remainingTokens->type == TokenType::Option ) { + auto const &token = *remainingTokens; + if( isMatch(token.token ) ) { + if( m_ref->isFlag() ) { + auto flagRef = static_cast( m_ref.get() ); + auto result = flagRef->setFlag( true ); + if( !result ) + return InternalParseResult( result ); + if( result.value() == ParseResultType::ShortCircuitAll ) + return InternalParseResult::ok( ParseState( result.value(), remainingTokens ) ); + } else { + auto valueRef = static_cast( m_ref.get() ); + ++remainingTokens; + if( !remainingTokens ) + return InternalParseResult::runtimeError( "Expected argument following " + token.token ); + auto const &argToken = *remainingTokens; + if( argToken.type != TokenType::Argument ) + return InternalParseResult::runtimeError( "Expected argument following " + token.token ); + auto result = valueRef->setValue( argToken.token ); + if( !result ) + return InternalParseResult( result ); + if( result.value() == ParseResultType::ShortCircuitAll ) + return InternalParseResult::ok( ParseState( result.value(), remainingTokens ) ); + } + return InternalParseResult::ok( ParseState( ParseResultType::Matched, ++remainingTokens ) ); + } + } + return InternalParseResult::ok( ParseState( ParseResultType::NoMatch, remainingTokens ) ); + } + + auto validate() const -> Result override { + if( m_optNames.empty() ) + return Result::logicError( "No options supplied to Opt" ); + for( auto const &name : m_optNames ) { + if( name.empty() ) + return Result::logicError( "Option name cannot be empty" ); +#ifdef CATCH_PLATFORM_WINDOWS + if( name[0] != '-' && name[0] != '/' ) + return Result::logicError( "Option name must begin with '-' or '/'" ); +#else + if( name[0] != '-' ) + return Result::logicError( "Option name must begin with '-'" ); +#endif + } + return ParserRefImpl::validate(); + } + }; + + struct Help : Opt { + Help( bool &showHelpFlag ) + : Opt([&]( bool flag ) { + showHelpFlag = flag; + return ParserResult::ok( ParseResultType::ShortCircuitAll ); + }) + { + static_cast( *this ) + ("display usage information") + ["-?"]["-h"]["--help"] + .optional(); + } + }; + + struct Parser : ParserBase { + + mutable ExeName m_exeName; + std::vector m_options; + std::vector m_args; + + auto operator|=( ExeName const &exeName ) -> Parser & { + m_exeName = exeName; + return *this; + } + + auto operator|=( Arg const &arg ) -> Parser & { + m_args.push_back(arg); + return *this; + } + + auto operator|=( Opt const &opt ) -> Parser & { + m_options.push_back(opt); + return *this; + } + + auto operator|=( Parser const &other ) -> Parser & { + m_options.insert(m_options.end(), other.m_options.begin(), other.m_options.end()); + m_args.insert(m_args.end(), other.m_args.begin(), other.m_args.end()); + return *this; + } + + template + auto operator|( T const &other ) const -> Parser { + return Parser( *this ) |= other; + } + + // Forward deprecated interface with '+' instead of '|' + template + auto operator+=( T const &other ) -> Parser & { return operator|=( other ); } + template + auto operator+( T const &other ) const -> Parser { return operator|( other ); } + + auto getHelpColumns() const -> std::vector { + std::vector cols; + for (auto const &o : m_options) { + auto childCols = o.getHelpColumns(); + cols.insert( cols.end(), childCols.begin(), childCols.end() ); + } + return cols; + } + + void writeToStream( std::ostream &os ) const { + if (!m_exeName.name().empty()) { + os << "usage:\n" << " " << m_exeName.name() << " "; + bool required = true, first = true; + for( auto const &arg : m_args ) { + if (first) + first = false; + else + os << " "; + if( arg.isOptional() && required ) { + os << "["; + required = false; + } + os << "<" << arg.hint() << ">"; + if( arg.cardinality() == 0 ) + os << " ... "; + } + if( !required ) + os << "]"; + if( !m_options.empty() ) + os << " options"; + os << "\n\nwhere options are:" << std::endl; + } + + auto rows = getHelpColumns(); + size_t consoleWidth = CATCH_CLARA_CONFIG_CONSOLE_WIDTH; + size_t optWidth = 0; + for( auto const &cols : rows ) + optWidth = (std::max)(optWidth, cols.left.size() + 2); + + optWidth = (std::min)(optWidth, consoleWidth/2); + + for( auto const &cols : rows ) { + auto row = + TextFlow::Column( cols.left ).width( optWidth ).indent( 2 ) + + TextFlow::Spacer(4) + + TextFlow::Column( cols.right ).width( consoleWidth - 7 - optWidth ); + os << row << std::endl; + } + } + + friend auto operator<<( std::ostream &os, Parser const &parser ) -> std::ostream& { + parser.writeToStream( os ); + return os; + } + + auto validate() const -> Result override { + for( auto const &opt : m_options ) { + auto result = opt.validate(); + if( !result ) + return result; + } + for( auto const &arg : m_args ) { + auto result = arg.validate(); + if( !result ) + return result; + } + return Result::ok(); + } + + using ParserBase::parse; + + auto parse( std::string const& exeName, TokenStream const &tokens ) const -> InternalParseResult override { + + struct ParserInfo { + ParserBase const* parser = nullptr; + size_t count = 0; + }; + const size_t totalParsers = m_options.size() + m_args.size(); + assert( totalParsers < 512 ); + // ParserInfo parseInfos[totalParsers]; // <-- this is what we really want to do + ParserInfo parseInfos[512]; + + { + size_t i = 0; + for (auto const &opt : m_options) parseInfos[i++].parser = &opt; + for (auto const &arg : m_args) parseInfos[i++].parser = &arg; + } + + m_exeName.set( exeName ); + + auto result = InternalParseResult::ok( ParseState( ParseResultType::NoMatch, tokens ) ); + while( result.value().remainingTokens() ) { + bool tokenParsed = false; + + for( size_t i = 0; i < totalParsers; ++i ) { + auto& parseInfo = parseInfos[i]; + if( parseInfo.parser->cardinality() == 0 || parseInfo.count < parseInfo.parser->cardinality() ) { + result = parseInfo.parser->parse(exeName, result.value().remainingTokens()); + if (!result) + return result; + if (result.value().type() != ParseResultType::NoMatch) { + tokenParsed = true; + ++parseInfo.count; + break; + } + } + } + + if( result.value().type() == ParseResultType::ShortCircuitAll ) + return result; + if( !tokenParsed ) + return InternalParseResult::runtimeError( "Unrecognised token: " + result.value().remainingTokens()->token ); + } + // !TBD Check missing required options + return result; + } + }; + + template + template + auto ComposableParserImpl::operator|( T const &other ) const -> Parser { + return Parser() | static_cast( *this ) | other; + } +} // namespace detail + +// A Combined parser +using detail::Parser; + +// A parser for options +using detail::Opt; + +// A parser for arguments +using detail::Arg; + +// Wrapper for argc, argv from main() +using detail::Args; + +// Specifies the name of the executable +using detail::ExeName; + +// Convenience wrapper for option parser that specifies the help option +using detail::Help; + +// enum of result types from a parse +using detail::ParseResultType; + +// Result type for parser operation +using detail::ParserResult; + +}} // namespace Catch::clara + +// end clara.hpp +#ifdef __clang__ +#pragma clang diagnostic pop +#endif + +// Restore Clara's value for console width, if present +#ifdef CATCH_TEMP_CLARA_CONFIG_CONSOLE_WIDTH +#define CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH CATCH_TEMP_CLARA_CONFIG_CONSOLE_WIDTH +#undef CATCH_TEMP_CLARA_CONFIG_CONSOLE_WIDTH +#endif + +// end catch_clara.h +namespace Catch { + + clara::Parser makeCommandLineParser( ConfigData& config ); + +} // end namespace Catch + +// end catch_commandline.h +#include +#include + +namespace Catch { + + clara::Parser makeCommandLineParser( ConfigData& config ) { + + using namespace clara; + + auto const setWarning = [&]( std::string const& warning ) { + auto warningSet = [&]() { + if( warning == "NoAssertions" ) + return WarnAbout::NoAssertions; + + if ( warning == "NoTests" ) + return WarnAbout::NoTests; + + return WarnAbout::Nothing; + }(); + + if (warningSet == WarnAbout::Nothing) + return ParserResult::runtimeError( "Unrecognised warning: '" + warning + "'" ); + config.warnings = static_cast( config.warnings | warningSet ); + return ParserResult::ok( ParseResultType::Matched ); + }; + auto const loadTestNamesFromFile = [&]( std::string const& filename ) { + std::ifstream f( filename.c_str() ); + if( !f.is_open() ) + return ParserResult::runtimeError( "Unable to load input file: '" + filename + "'" ); + + std::string line; + while( std::getline( f, line ) ) { + line = trim(line); + if( !line.empty() && !startsWith( line, '#' ) ) { + if( !startsWith( line, '"' ) ) + line = '"' + line + '"'; + config.testsOrTags.push_back( line + ',' ); + } + } + return ParserResult::ok( ParseResultType::Matched ); + }; + auto const setTestOrder = [&]( std::string const& order ) { + if( startsWith( "declared", order ) ) + config.runOrder = RunTests::InDeclarationOrder; + else if( startsWith( "lexical", order ) ) + config.runOrder = RunTests::InLexicographicalOrder; + else if( startsWith( "random", order ) ) + config.runOrder = RunTests::InRandomOrder; + else + return clara::ParserResult::runtimeError( "Unrecognised ordering: '" + order + "'" ); + return ParserResult::ok( ParseResultType::Matched ); + }; + auto const setRngSeed = [&]( std::string const& seed ) { + if( seed != "time" ) + return clara::detail::convertInto( seed, config.rngSeed ); + config.rngSeed = static_cast( std::time(nullptr) ); + return ParserResult::ok( ParseResultType::Matched ); + }; + auto const setColourUsage = [&]( std::string const& useColour ) { + auto mode = toLower( useColour ); + + if( mode == "yes" ) + config.useColour = UseColour::Yes; + else if( mode == "no" ) + config.useColour = UseColour::No; + else if( mode == "auto" ) + config.useColour = UseColour::Auto; + else + return ParserResult::runtimeError( "colour mode must be one of: auto, yes or no. '" + useColour + "' not recognised" ); + return ParserResult::ok( ParseResultType::Matched ); + }; + auto const setWaitForKeypress = [&]( std::string const& keypress ) { + auto keypressLc = toLower( keypress ); + if( keypressLc == "start" ) + config.waitForKeypress = WaitForKeypress::BeforeStart; + else if( keypressLc == "exit" ) + config.waitForKeypress = WaitForKeypress::BeforeExit; + else if( keypressLc == "both" ) + config.waitForKeypress = WaitForKeypress::BeforeStartAndExit; + else + return ParserResult::runtimeError( "keypress argument must be one of: start, exit or both. '" + keypress + "' not recognised" ); + return ParserResult::ok( ParseResultType::Matched ); + }; + auto const setVerbosity = [&]( std::string const& verbosity ) { + auto lcVerbosity = toLower( verbosity ); + if( lcVerbosity == "quiet" ) + config.verbosity = Verbosity::Quiet; + else if( lcVerbosity == "normal" ) + config.verbosity = Verbosity::Normal; + else if( lcVerbosity == "high" ) + config.verbosity = Verbosity::High; + else + return ParserResult::runtimeError( "Unrecognised verbosity, '" + verbosity + "'" ); + return ParserResult::ok( ParseResultType::Matched ); + }; + auto const setReporter = [&]( std::string const& reporter ) { + IReporterRegistry::FactoryMap const& factories = getRegistryHub().getReporterRegistry().getFactories(); + + auto lcReporter = toLower( reporter ); + auto result = factories.find( lcReporter ); + + if( factories.end() != result ) + config.reporterName = lcReporter; + else + return ParserResult::runtimeError( "Unrecognized reporter, '" + reporter + "'. Check available with --list-reporters" ); + return ParserResult::ok( ParseResultType::Matched ); + }; + + auto cli + = ExeName( config.processName ) + | Help( config.showHelp ) + | Opt( config.listTests ) + ["-l"]["--list-tests"] + ( "list all/matching test cases" ) + | Opt( config.listTags ) + ["-t"]["--list-tags"] + ( "list all/matching tags" ) + | Opt( config.showSuccessfulTests ) + ["-s"]["--success"] + ( "include successful tests in output" ) + | Opt( config.shouldDebugBreak ) + ["-b"]["--break"] + ( "break into debugger on failure" ) + | Opt( config.noThrow ) + ["-e"]["--nothrow"] + ( "skip exception tests" ) + | Opt( config.showInvisibles ) + ["-i"]["--invisibles"] + ( "show invisibles (tabs, newlines)" ) + | Opt( config.outputFilename, "filename" ) + ["-o"]["--out"] + ( "output filename" ) + | Opt( setReporter, "name" ) + ["-r"]["--reporter"] + ( "reporter to use (defaults to console)" ) + | Opt( config.name, "name" ) + ["-n"]["--name"] + ( "suite name" ) + | Opt( [&]( bool ){ config.abortAfter = 1; } ) + ["-a"]["--abort"] + ( "abort at first failure" ) + | Opt( [&]( int x ){ config.abortAfter = x; }, "no. failures" ) + ["-x"]["--abortx"] + ( "abort after x failures" ) + | Opt( setWarning, "warning name" ) + ["-w"]["--warn"] + ( "enable warnings" ) + | Opt( [&]( bool flag ) { config.showDurations = flag ? ShowDurations::Always : ShowDurations::Never; }, "yes|no" ) + ["-d"]["--durations"] + ( "show test durations" ) + | Opt( loadTestNamesFromFile, "filename" ) + ["-f"]["--input-file"] + ( "load test names to run from a file" ) + | Opt( config.filenamesAsTags ) + ["-#"]["--filenames-as-tags"] + ( "adds a tag for the filename" ) + | Opt( config.sectionsToRun, "section name" ) + ["-c"]["--section"] + ( "specify section to run" ) + | Opt( setVerbosity, "quiet|normal|high" ) + ["-v"]["--verbosity"] + ( "set output verbosity" ) + | Opt( config.listTestNamesOnly ) + ["--list-test-names-only"] + ( "list all/matching test cases names only" ) + | Opt( config.listReporters ) + ["--list-reporters"] + ( "list all reporters" ) + | Opt( setTestOrder, "decl|lex|rand" ) + ["--order"] + ( "test case order (defaults to decl)" ) + | Opt( setRngSeed, "'time'|number" ) + ["--rng-seed"] + ( "set a specific seed for random numbers" ) + | Opt( setColourUsage, "yes|no" ) + ["--use-colour"] + ( "should output be colourised" ) + | Opt( config.libIdentify ) + ["--libidentify"] + ( "report name and version according to libidentify standard" ) + | Opt( setWaitForKeypress, "start|exit|both" ) + ["--wait-for-keypress"] + ( "waits for a keypress before exiting" ) + | Opt( config.benchmarkResolutionMultiple, "multiplier" ) + ["--benchmark-resolution-multiple"] + ( "multiple of clock resolution to run benchmarks" ) + + | Arg( config.testsOrTags, "test name|pattern|tags" ) + ( "which test or tests to use" ); + + return cli; + } + +} // end namespace Catch +// end catch_commandline.cpp +// start catch_common.cpp + +#include +#include + +namespace Catch { + + bool SourceLineInfo::empty() const noexcept { + return file[0] == '\0'; + } + bool SourceLineInfo::operator == ( SourceLineInfo const& other ) const noexcept { + return line == other.line && (file == other.file || std::strcmp(file, other.file) == 0); + } + bool SourceLineInfo::operator < ( SourceLineInfo const& other ) const noexcept { + // We can assume that the same file will usually have the same pointer. + // Thus, if the pointers are the same, there is no point in calling the strcmp + return line < other.line || ( line == other.line && file != other.file && (std::strcmp(file, other.file) < 0)); + } + + std::ostream& operator << ( std::ostream& os, SourceLineInfo const& info ) { +#ifndef __GNUG__ + os << info.file << '(' << info.line << ')'; +#else + os << info.file << ':' << info.line; +#endif + return os; + } + + std::string StreamEndStop::operator+() const { + return std::string(); + } + + NonCopyable::NonCopyable() = default; + NonCopyable::~NonCopyable() = default; + +} +// end catch_common.cpp +// start catch_config.cpp + +namespace Catch { + + Config::Config( ConfigData const& data ) + : m_data( data ), + m_stream( openStream() ) + { + TestSpecParser parser(ITagAliasRegistry::get()); + if (data.testsOrTags.empty()) { + parser.parse("~[.]"); // All not hidden tests + } + else { + m_hasTestFilters = true; + for( auto const& testOrTags : data.testsOrTags ) + parser.parse( testOrTags ); + } + m_testSpec = parser.testSpec(); + } + + std::string const& Config::getFilename() const { + return m_data.outputFilename ; + } + + bool Config::listTests() const { return m_data.listTests; } + bool Config::listTestNamesOnly() const { return m_data.listTestNamesOnly; } + bool Config::listTags() const { return m_data.listTags; } + bool Config::listReporters() const { return m_data.listReporters; } + + std::string Config::getProcessName() const { return m_data.processName; } + std::string const& Config::getReporterName() const { return m_data.reporterName; } + + std::vector const& Config::getTestsOrTags() const { return m_data.testsOrTags; } + std::vector const& Config::getSectionsToRun() const { return m_data.sectionsToRun; } + + TestSpec const& Config::testSpec() const { return m_testSpec; } + bool Config::hasTestFilters() const { return m_hasTestFilters; } + + bool Config::showHelp() const { return m_data.showHelp; } + + // IConfig interface + bool Config::allowThrows() const { return !m_data.noThrow; } + std::ostream& Config::stream() const { return m_stream->stream(); } + std::string Config::name() const { return m_data.name.empty() ? m_data.processName : m_data.name; } + bool Config::includeSuccessfulResults() const { return m_data.showSuccessfulTests; } + bool Config::warnAboutMissingAssertions() const { return !!(m_data.warnings & WarnAbout::NoAssertions); } + bool Config::warnAboutNoTests() const { return !!(m_data.warnings & WarnAbout::NoTests); } + ShowDurations::OrNot Config::showDurations() const { return m_data.showDurations; } + RunTests::InWhatOrder Config::runOrder() const { return m_data.runOrder; } + unsigned int Config::rngSeed() const { return m_data.rngSeed; } + int Config::benchmarkResolutionMultiple() const { return m_data.benchmarkResolutionMultiple; } + UseColour::YesOrNo Config::useColour() const { return m_data.useColour; } + bool Config::shouldDebugBreak() const { return m_data.shouldDebugBreak; } + int Config::abortAfter() const { return m_data.abortAfter; } + bool Config::showInvisibles() const { return m_data.showInvisibles; } + Verbosity Config::verbosity() const { return m_data.verbosity; } + + IStream const* Config::openStream() { + return Catch::makeStream(m_data.outputFilename); + } + +} // end namespace Catch +// end catch_config.cpp +// start catch_console_colour.cpp + +#if defined(__clang__) +# pragma clang diagnostic push +# pragma clang diagnostic ignored "-Wexit-time-destructors" +#endif + +// start catch_errno_guard.h + +namespace Catch { + + class ErrnoGuard { + public: + ErrnoGuard(); + ~ErrnoGuard(); + private: + int m_oldErrno; + }; + +} + +// end catch_errno_guard.h +#include + +namespace Catch { + namespace { + + struct IColourImpl { + virtual ~IColourImpl() = default; + virtual void use( Colour::Code _colourCode ) = 0; + }; + + struct NoColourImpl : IColourImpl { + void use( Colour::Code ) {} + + static IColourImpl* instance() { + static NoColourImpl s_instance; + return &s_instance; + } + }; + + } // anon namespace +} // namespace Catch + +#if !defined( CATCH_CONFIG_COLOUR_NONE ) && !defined( CATCH_CONFIG_COLOUR_WINDOWS ) && !defined( CATCH_CONFIG_COLOUR_ANSI ) +# ifdef CATCH_PLATFORM_WINDOWS +# define CATCH_CONFIG_COLOUR_WINDOWS +# else +# define CATCH_CONFIG_COLOUR_ANSI +# endif +#endif + +#if defined ( CATCH_CONFIG_COLOUR_WINDOWS ) ///////////////////////////////////////// + +namespace Catch { +namespace { + + class Win32ColourImpl : public IColourImpl { + public: + Win32ColourImpl() : stdoutHandle( GetStdHandle(STD_OUTPUT_HANDLE) ) + { + CONSOLE_SCREEN_BUFFER_INFO csbiInfo; + GetConsoleScreenBufferInfo( stdoutHandle, &csbiInfo ); + originalForegroundAttributes = csbiInfo.wAttributes & ~( BACKGROUND_GREEN | BACKGROUND_RED | BACKGROUND_BLUE | BACKGROUND_INTENSITY ); + originalBackgroundAttributes = csbiInfo.wAttributes & ~( FOREGROUND_GREEN | FOREGROUND_RED | FOREGROUND_BLUE | FOREGROUND_INTENSITY ); + } + + virtual void use( Colour::Code _colourCode ) override { + switch( _colourCode ) { + case Colour::None: return setTextAttribute( originalForegroundAttributes ); + case Colour::White: return setTextAttribute( FOREGROUND_GREEN | FOREGROUND_RED | FOREGROUND_BLUE ); + case Colour::Red: return setTextAttribute( FOREGROUND_RED ); + case Colour::Green: return setTextAttribute( FOREGROUND_GREEN ); + case Colour::Blue: return setTextAttribute( FOREGROUND_BLUE ); + case Colour::Cyan: return setTextAttribute( FOREGROUND_BLUE | FOREGROUND_GREEN ); + case Colour::Yellow: return setTextAttribute( FOREGROUND_RED | FOREGROUND_GREEN ); + case Colour::Grey: return setTextAttribute( 0 ); + + case Colour::LightGrey: return setTextAttribute( FOREGROUND_INTENSITY ); + case Colour::BrightRed: return setTextAttribute( FOREGROUND_INTENSITY | FOREGROUND_RED ); + case Colour::BrightGreen: return setTextAttribute( FOREGROUND_INTENSITY | FOREGROUND_GREEN ); + case Colour::BrightWhite: return setTextAttribute( FOREGROUND_INTENSITY | FOREGROUND_GREEN | FOREGROUND_RED | FOREGROUND_BLUE ); + case Colour::BrightYellow: return setTextAttribute( FOREGROUND_INTENSITY | FOREGROUND_RED | FOREGROUND_GREEN ); + + case Colour::Bright: CATCH_INTERNAL_ERROR( "not a colour" ); + + default: + CATCH_ERROR( "Unknown colour requested" ); + } + } + + private: + void setTextAttribute( WORD _textAttribute ) { + SetConsoleTextAttribute( stdoutHandle, _textAttribute | originalBackgroundAttributes ); + } + HANDLE stdoutHandle; + WORD originalForegroundAttributes; + WORD originalBackgroundAttributes; + }; + + IColourImpl* platformColourInstance() { + static Win32ColourImpl s_instance; + + IConfigPtr config = getCurrentContext().getConfig(); + UseColour::YesOrNo colourMode = config + ? config->useColour() + : UseColour::Auto; + if( colourMode == UseColour::Auto ) + colourMode = UseColour::Yes; + return colourMode == UseColour::Yes + ? &s_instance + : NoColourImpl::instance(); + } + +} // end anon namespace +} // end namespace Catch + +#elif defined( CATCH_CONFIG_COLOUR_ANSI ) ////////////////////////////////////// + +#include + +namespace Catch { +namespace { + + // use POSIX/ ANSI console terminal codes + // Thanks to Adam Strzelecki for original contribution + // (http://github.com/nanoant) + // https://github.com/philsquared/Catch/pull/131 + class PosixColourImpl : public IColourImpl { + public: + virtual void use( Colour::Code _colourCode ) override { + switch( _colourCode ) { + case Colour::None: + case Colour::White: return setColour( "[0m" ); + case Colour::Red: return setColour( "[0;31m" ); + case Colour::Green: return setColour( "[0;32m" ); + case Colour::Blue: return setColour( "[0;34m" ); + case Colour::Cyan: return setColour( "[0;36m" ); + case Colour::Yellow: return setColour( "[0;33m" ); + case Colour::Grey: return setColour( "[1;30m" ); + + case Colour::LightGrey: return setColour( "[0;37m" ); + case Colour::BrightRed: return setColour( "[1;31m" ); + case Colour::BrightGreen: return setColour( "[1;32m" ); + case Colour::BrightWhite: return setColour( "[1;37m" ); + case Colour::BrightYellow: return setColour( "[1;33m" ); + + case Colour::Bright: CATCH_INTERNAL_ERROR( "not a colour" ); + default: CATCH_INTERNAL_ERROR( "Unknown colour requested" ); + } + } + static IColourImpl* instance() { + static PosixColourImpl s_instance; + return &s_instance; + } + + private: + void setColour( const char* _escapeCode ) { + getCurrentContext().getConfig()->stream() + << '\033' << _escapeCode; + } + }; + + bool useColourOnPlatform() { + return +#ifdef CATCH_PLATFORM_MAC + !isDebuggerActive() && +#endif +#if !(defined(__DJGPP__) && defined(__STRICT_ANSI__)) + isatty(STDOUT_FILENO) +#else + false +#endif + ; + } + IColourImpl* platformColourInstance() { + ErrnoGuard guard; + IConfigPtr config = getCurrentContext().getConfig(); + UseColour::YesOrNo colourMode = config + ? config->useColour() + : UseColour::Auto; + if( colourMode == UseColour::Auto ) + colourMode = useColourOnPlatform() + ? UseColour::Yes + : UseColour::No; + return colourMode == UseColour::Yes + ? PosixColourImpl::instance() + : NoColourImpl::instance(); + } + +} // end anon namespace +} // end namespace Catch + +#else // not Windows or ANSI /////////////////////////////////////////////// + +namespace Catch { + + static IColourImpl* platformColourInstance() { return NoColourImpl::instance(); } + +} // end namespace Catch + +#endif // Windows/ ANSI/ None + +namespace Catch { + + Colour::Colour( Code _colourCode ) { use( _colourCode ); } + Colour::Colour( Colour&& rhs ) noexcept { + m_moved = rhs.m_moved; + rhs.m_moved = true; + } + Colour& Colour::operator=( Colour&& rhs ) noexcept { + m_moved = rhs.m_moved; + rhs.m_moved = true; + return *this; + } + + Colour::~Colour(){ if( !m_moved ) use( None ); } + + void Colour::use( Code _colourCode ) { + static IColourImpl* impl = platformColourInstance(); + impl->use( _colourCode ); + } + + std::ostream& operator << ( std::ostream& os, Colour const& ) { + return os; + } + +} // end namespace Catch + +#if defined(__clang__) +# pragma clang diagnostic pop +#endif + +// end catch_console_colour.cpp +// start catch_context.cpp + +namespace Catch { + + class Context : public IMutableContext, NonCopyable { + + public: // IContext + virtual IResultCapture* getResultCapture() override { + return m_resultCapture; + } + virtual IRunner* getRunner() override { + return m_runner; + } + + virtual IConfigPtr const& getConfig() const override { + return m_config; + } + + virtual ~Context() override; + + public: // IMutableContext + virtual void setResultCapture( IResultCapture* resultCapture ) override { + m_resultCapture = resultCapture; + } + virtual void setRunner( IRunner* runner ) override { + m_runner = runner; + } + virtual void setConfig( IConfigPtr const& config ) override { + m_config = config; + } + + friend IMutableContext& getCurrentMutableContext(); + + private: + IConfigPtr m_config; + IRunner* m_runner = nullptr; + IResultCapture* m_resultCapture = nullptr; + }; + + IMutableContext *IMutableContext::currentContext = nullptr; + + void IMutableContext::createContext() + { + currentContext = new Context(); + } + + void cleanUpContext() { + delete IMutableContext::currentContext; + IMutableContext::currentContext = nullptr; + } + IContext::~IContext() = default; + IMutableContext::~IMutableContext() = default; + Context::~Context() = default; +} +// end catch_context.cpp +// start catch_debug_console.cpp + +// start catch_debug_console.h + +#include + +namespace Catch { + void writeToDebugConsole( std::string const& text ); +} + +// end catch_debug_console.h +#ifdef CATCH_PLATFORM_WINDOWS + + namespace Catch { + void writeToDebugConsole( std::string const& text ) { + ::OutputDebugStringA( text.c_str() ); + } + } + +#else + + namespace Catch { + void writeToDebugConsole( std::string const& text ) { + // !TBD: Need a version for Mac/ XCode and other IDEs + Catch::cout() << text; + } + } + +#endif // Platform +// end catch_debug_console.cpp +// start catch_debugger.cpp + +#ifdef CATCH_PLATFORM_MAC + +# include +# include +# include +# include +# include +# include +# include + +namespace Catch { + + // The following function is taken directly from the following technical note: + // http://developer.apple.com/library/mac/#qa/qa2004/qa1361.html + + // Returns true if the current process is being debugged (either + // running under the debugger or has a debugger attached post facto). + bool isDebuggerActive(){ + + int mib[4]; + struct kinfo_proc info; + std::size_t size; + + // Initialize the flags so that, if sysctl fails for some bizarre + // reason, we get a predictable result. + + info.kp_proc.p_flag = 0; + + // Initialize mib, which tells sysctl the info we want, in this case + // we're looking for information about a specific process ID. + + mib[0] = CTL_KERN; + mib[1] = KERN_PROC; + mib[2] = KERN_PROC_PID; + mib[3] = getpid(); + + // Call sysctl. + + size = sizeof(info); + if( sysctl(mib, sizeof(mib) / sizeof(*mib), &info, &size, nullptr, 0) != 0 ) { + Catch::cerr() << "\n** Call to sysctl failed - unable to determine if debugger is active **\n" << std::endl; + return false; + } + + // We're being debugged if the P_TRACED flag is set. + + return ( (info.kp_proc.p_flag & P_TRACED) != 0 ); + } + } // namespace Catch + +#elif defined(CATCH_PLATFORM_LINUX) + #include + #include + + namespace Catch{ + // The standard POSIX way of detecting a debugger is to attempt to + // ptrace() the process, but this needs to be done from a child and not + // this process itself to still allow attaching to this process later + // if wanted, so is rather heavy. Under Linux we have the PID of the + // "debugger" (which doesn't need to be gdb, of course, it could also + // be strace, for example) in /proc/$PID/status, so just get it from + // there instead. + bool isDebuggerActive(){ + // Libstdc++ has a bug, where std::ifstream sets errno to 0 + // This way our users can properly assert over errno values + ErrnoGuard guard; + std::ifstream in("/proc/self/status"); + for( std::string line; std::getline(in, line); ) { + static const int PREFIX_LEN = 11; + if( line.compare(0, PREFIX_LEN, "TracerPid:\t") == 0 ) { + // We're traced if the PID is not 0 and no other PID starts + // with 0 digit, so it's enough to check for just a single + // character. + return line.length() > PREFIX_LEN && line[PREFIX_LEN] != '0'; + } + } + + return false; + } + } // namespace Catch +#elif defined(_MSC_VER) + extern "C" __declspec(dllimport) int __stdcall IsDebuggerPresent(); + namespace Catch { + bool isDebuggerActive() { + return IsDebuggerPresent() != 0; + } + } +#elif defined(__MINGW32__) + extern "C" __declspec(dllimport) int __stdcall IsDebuggerPresent(); + namespace Catch { + bool isDebuggerActive() { + return IsDebuggerPresent() != 0; + } + } +#else + namespace Catch { + bool isDebuggerActive() { return false; } + } +#endif // Platform +// end catch_debugger.cpp +// start catch_decomposer.cpp + +namespace Catch { + + ITransientExpression::~ITransientExpression() = default; + + void formatReconstructedExpression( std::ostream &os, std::string const& lhs, StringRef op, std::string const& rhs ) { + if( lhs.size() + rhs.size() < 40 && + lhs.find('\n') == std::string::npos && + rhs.find('\n') == std::string::npos ) + os << lhs << " " << op << " " << rhs; + else + os << lhs << "\n" << op << "\n" << rhs; + } +} +// end catch_decomposer.cpp +// start catch_enforce.cpp + +namespace Catch { +#if defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) && !defined(CATCH_CONFIG_DISABLE_EXCEPTIONS_CUSTOM_HANDLER) + [[noreturn]] + void throw_exception(std::exception const& e) { + Catch::cerr() << "Catch will terminate because it needed to throw an exception.\n" + << "The message was: " << e.what() << '\n'; + std::terminate(); + } +#endif +} // namespace Catch; +// end catch_enforce.cpp +// start catch_errno_guard.cpp + +#include + +namespace Catch { + ErrnoGuard::ErrnoGuard():m_oldErrno(errno){} + ErrnoGuard::~ErrnoGuard() { errno = m_oldErrno; } +} +// end catch_errno_guard.cpp +// start catch_exception_translator_registry.cpp + +// start catch_exception_translator_registry.h + +#include +#include +#include + +namespace Catch { + + class ExceptionTranslatorRegistry : public IExceptionTranslatorRegistry { + public: + ~ExceptionTranslatorRegistry(); + virtual void registerTranslator( const IExceptionTranslator* translator ); + virtual std::string translateActiveException() const override; + std::string tryTranslators() const; + + private: + std::vector> m_translators; + }; +} + +// end catch_exception_translator_registry.h +#ifdef __OBJC__ +#import "Foundation/Foundation.h" +#endif + +namespace Catch { + + ExceptionTranslatorRegistry::~ExceptionTranslatorRegistry() { + } + + void ExceptionTranslatorRegistry::registerTranslator( const IExceptionTranslator* translator ) { + m_translators.push_back( std::unique_ptr( translator ) ); + } + +#if !defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) + std::string ExceptionTranslatorRegistry::translateActiveException() const { + try { +#ifdef __OBJC__ + // In Objective-C try objective-c exceptions first + @try { + return tryTranslators(); + } + @catch (NSException *exception) { + return Catch::Detail::stringify( [exception description] ); + } +#else + // Compiling a mixed mode project with MSVC means that CLR + // exceptions will be caught in (...) as well. However, these + // do not fill-in std::current_exception and thus lead to crash + // when attempting rethrow. + // /EHa switch also causes structured exceptions to be caught + // here, but they fill-in current_exception properly, so + // at worst the output should be a little weird, instead of + // causing a crash. + if (std::current_exception() == nullptr) { + return "Non C++ exception. Possibly a CLR exception."; + } + return tryTranslators(); +#endif + } + catch( TestFailureException& ) { + std::rethrow_exception(std::current_exception()); + } + catch( std::exception& ex ) { + return ex.what(); + } + catch( std::string& msg ) { + return msg; + } + catch( const char* msg ) { + return msg; + } + catch(...) { + return "Unknown exception"; + } + } + + std::string ExceptionTranslatorRegistry::tryTranslators() const { + if (m_translators.empty()) { + std::rethrow_exception(std::current_exception()); + } else { + return m_translators[0]->translate(m_translators.begin() + 1, m_translators.end()); + } + } + +#else // ^^ Exceptions are enabled // Exceptions are disabled vv + std::string ExceptionTranslatorRegistry::translateActiveException() const { + CATCH_INTERNAL_ERROR("Attempted to translate active exception under CATCH_CONFIG_DISABLE_EXCEPTIONS!"); + } + + std::string ExceptionTranslatorRegistry::tryTranslators() const { + CATCH_INTERNAL_ERROR("Attempted to use exception translators under CATCH_CONFIG_DISABLE_EXCEPTIONS!"); + } +#endif + +} +// end catch_exception_translator_registry.cpp +// start catch_fatal_condition.cpp + +#if defined(__GNUC__) +# pragma GCC diagnostic push +# pragma GCC diagnostic ignored "-Wmissing-field-initializers" +#endif + +#if defined( CATCH_CONFIG_WINDOWS_SEH ) || defined( CATCH_CONFIG_POSIX_SIGNALS ) + +namespace { + // Report the error condition + void reportFatal( char const * const message ) { + Catch::getCurrentContext().getResultCapture()->handleFatalErrorCondition( message ); + } +} + +#endif // signals/SEH handling + +#if defined( CATCH_CONFIG_WINDOWS_SEH ) + +namespace Catch { + struct SignalDefs { DWORD id; const char* name; }; + + // There is no 1-1 mapping between signals and windows exceptions. + // Windows can easily distinguish between SO and SigSegV, + // but SigInt, SigTerm, etc are handled differently. + static SignalDefs signalDefs[] = { + { EXCEPTION_ILLEGAL_INSTRUCTION, "SIGILL - Illegal instruction signal" }, + { EXCEPTION_STACK_OVERFLOW, "SIGSEGV - Stack overflow" }, + { EXCEPTION_ACCESS_VIOLATION, "SIGSEGV - Segmentation violation signal" }, + { EXCEPTION_INT_DIVIDE_BY_ZERO, "Divide by zero error" }, + }; + + LONG CALLBACK FatalConditionHandler::handleVectoredException(PEXCEPTION_POINTERS ExceptionInfo) { + for (auto const& def : signalDefs) { + if (ExceptionInfo->ExceptionRecord->ExceptionCode == def.id) { + reportFatal(def.name); + } + } + // If its not an exception we care about, pass it along. + // This stops us from eating debugger breaks etc. + return EXCEPTION_CONTINUE_SEARCH; + } + + FatalConditionHandler::FatalConditionHandler() { + isSet = true; + // 32k seems enough for Catch to handle stack overflow, + // but the value was found experimentally, so there is no strong guarantee + guaranteeSize = 32 * 1024; + exceptionHandlerHandle = nullptr; + // Register as first handler in current chain + exceptionHandlerHandle = AddVectoredExceptionHandler(1, handleVectoredException); + // Pass in guarantee size to be filled + SetThreadStackGuarantee(&guaranteeSize); + } + + void FatalConditionHandler::reset() { + if (isSet) { + RemoveVectoredExceptionHandler(exceptionHandlerHandle); + SetThreadStackGuarantee(&guaranteeSize); + exceptionHandlerHandle = nullptr; + isSet = false; + } + } + + FatalConditionHandler::~FatalConditionHandler() { + reset(); + } + +bool FatalConditionHandler::isSet = false; +ULONG FatalConditionHandler::guaranteeSize = 0; +PVOID FatalConditionHandler::exceptionHandlerHandle = nullptr; + +} // namespace Catch + +#elif defined( CATCH_CONFIG_POSIX_SIGNALS ) + +namespace Catch { + + struct SignalDefs { + int id; + const char* name; + }; + + // 32kb for the alternate stack seems to be sufficient. However, this value + // is experimentally determined, so that's not guaranteed. + constexpr static std::size_t sigStackSize = 32768 >= MINSIGSTKSZ ? 32768 : MINSIGSTKSZ; + + static SignalDefs signalDefs[] = { + { SIGINT, "SIGINT - Terminal interrupt signal" }, + { SIGILL, "SIGILL - Illegal instruction signal" }, + { SIGFPE, "SIGFPE - Floating point error signal" }, + { SIGSEGV, "SIGSEGV - Segmentation violation signal" }, + { SIGTERM, "SIGTERM - Termination request signal" }, + { SIGABRT, "SIGABRT - Abort (abnormal termination) signal" } + }; + + void FatalConditionHandler::handleSignal( int sig ) { + char const * name = ""; + for (auto const& def : signalDefs) { + if (sig == def.id) { + name = def.name; + break; + } + } + reset(); + reportFatal(name); + raise( sig ); + } + + FatalConditionHandler::FatalConditionHandler() { + isSet = true; + stack_t sigStack; + sigStack.ss_sp = altStackMem; + sigStack.ss_size = sigStackSize; + sigStack.ss_flags = 0; + sigaltstack(&sigStack, &oldSigStack); + struct sigaction sa = { }; + + sa.sa_handler = handleSignal; + sa.sa_flags = SA_ONSTACK; + for (std::size_t i = 0; i < sizeof(signalDefs)/sizeof(SignalDefs); ++i) { + sigaction(signalDefs[i].id, &sa, &oldSigActions[i]); + } + } + + FatalConditionHandler::~FatalConditionHandler() { + reset(); + } + + void FatalConditionHandler::reset() { + if( isSet ) { + // Set signals back to previous values -- hopefully nobody overwrote them in the meantime + for( std::size_t i = 0; i < sizeof(signalDefs)/sizeof(SignalDefs); ++i ) { + sigaction(signalDefs[i].id, &oldSigActions[i], nullptr); + } + // Return the old stack + sigaltstack(&oldSigStack, nullptr); + isSet = false; + } + } + + bool FatalConditionHandler::isSet = false; + struct sigaction FatalConditionHandler::oldSigActions[sizeof(signalDefs)/sizeof(SignalDefs)] = {}; + stack_t FatalConditionHandler::oldSigStack = {}; + char FatalConditionHandler::altStackMem[sigStackSize] = {}; + +} // namespace Catch + +#else + +namespace Catch { + void FatalConditionHandler::reset() {} +} + +#endif // signals/SEH handling + +#if defined(__GNUC__) +# pragma GCC diagnostic pop +#endif +// end catch_fatal_condition.cpp +// start catch_generators.cpp + +// start catch_random_number_generator.h + +#include +#include + +namespace Catch { + + struct IConfig; + + std::mt19937& rng(); + void seedRng( IConfig const& config ); + unsigned int rngSeed(); + +} + +// end catch_random_number_generator.h +#include +#include + +namespace Catch { + +IGeneratorTracker::~IGeneratorTracker() {} + +const char* GeneratorException::what() const noexcept { + return m_msg; +} + +namespace Generators { + + GeneratorUntypedBase::~GeneratorUntypedBase() {} + + auto acquireGeneratorTracker( SourceLineInfo const& lineInfo ) -> IGeneratorTracker& { + return getResultCapture().acquireGeneratorTracker( lineInfo ); + } + +} // namespace Generators +} // namespace Catch +// end catch_generators.cpp +// start catch_interfaces_capture.cpp + +namespace Catch { + IResultCapture::~IResultCapture() = default; +} +// end catch_interfaces_capture.cpp +// start catch_interfaces_config.cpp + +namespace Catch { + IConfig::~IConfig() = default; +} +// end catch_interfaces_config.cpp +// start catch_interfaces_exception.cpp + +namespace Catch { + IExceptionTranslator::~IExceptionTranslator() = default; + IExceptionTranslatorRegistry::~IExceptionTranslatorRegistry() = default; +} +// end catch_interfaces_exception.cpp +// start catch_interfaces_registry_hub.cpp + +namespace Catch { + IRegistryHub::~IRegistryHub() = default; + IMutableRegistryHub::~IMutableRegistryHub() = default; +} +// end catch_interfaces_registry_hub.cpp +// start catch_interfaces_reporter.cpp + +// start catch_reporter_listening.h + +namespace Catch { + + class ListeningReporter : public IStreamingReporter { + using Reporters = std::vector; + Reporters m_listeners; + IStreamingReporterPtr m_reporter = nullptr; + ReporterPreferences m_preferences; + + public: + ListeningReporter(); + + void addListener( IStreamingReporterPtr&& listener ); + void addReporter( IStreamingReporterPtr&& reporter ); + + public: // IStreamingReporter + + ReporterPreferences getPreferences() const override; + + void noMatchingTestCases( std::string const& spec ) override; + + static std::set getSupportedVerbosities(); + + void benchmarkStarting( BenchmarkInfo const& benchmarkInfo ) override; + void benchmarkEnded( BenchmarkStats const& benchmarkStats ) override; + + void testRunStarting( TestRunInfo const& testRunInfo ) override; + void testGroupStarting( GroupInfo const& groupInfo ) override; + void testCaseStarting( TestCaseInfo const& testInfo ) override; + void sectionStarting( SectionInfo const& sectionInfo ) override; + void assertionStarting( AssertionInfo const& assertionInfo ) override; + + // The return value indicates if the messages buffer should be cleared: + bool assertionEnded( AssertionStats const& assertionStats ) override; + void sectionEnded( SectionStats const& sectionStats ) override; + void testCaseEnded( TestCaseStats const& testCaseStats ) override; + void testGroupEnded( TestGroupStats const& testGroupStats ) override; + void testRunEnded( TestRunStats const& testRunStats ) override; + + void skipTest( TestCaseInfo const& testInfo ) override; + bool isMulti() const override; + + }; + +} // end namespace Catch + +// end catch_reporter_listening.h +namespace Catch { + + ReporterConfig::ReporterConfig( IConfigPtr const& _fullConfig ) + : m_stream( &_fullConfig->stream() ), m_fullConfig( _fullConfig ) {} + + ReporterConfig::ReporterConfig( IConfigPtr const& _fullConfig, std::ostream& _stream ) + : m_stream( &_stream ), m_fullConfig( _fullConfig ) {} + + std::ostream& ReporterConfig::stream() const { return *m_stream; } + IConfigPtr ReporterConfig::fullConfig() const { return m_fullConfig; } + + TestRunInfo::TestRunInfo( std::string const& _name ) : name( _name ) {} + + GroupInfo::GroupInfo( std::string const& _name, + std::size_t _groupIndex, + std::size_t _groupsCount ) + : name( _name ), + groupIndex( _groupIndex ), + groupsCounts( _groupsCount ) + {} + + AssertionStats::AssertionStats( AssertionResult const& _assertionResult, + std::vector const& _infoMessages, + Totals const& _totals ) + : assertionResult( _assertionResult ), + infoMessages( _infoMessages ), + totals( _totals ) + { + assertionResult.m_resultData.lazyExpression.m_transientExpression = _assertionResult.m_resultData.lazyExpression.m_transientExpression; + + if( assertionResult.hasMessage() ) { + // Copy message into messages list. + // !TBD This should have been done earlier, somewhere + MessageBuilder builder( assertionResult.getTestMacroName(), assertionResult.getSourceInfo(), assertionResult.getResultType() ); + builder << assertionResult.getMessage(); + builder.m_info.message = builder.m_stream.str(); + + infoMessages.push_back( builder.m_info ); + } + } + + AssertionStats::~AssertionStats() = default; + + SectionStats::SectionStats( SectionInfo const& _sectionInfo, + Counts const& _assertions, + double _durationInSeconds, + bool _missingAssertions ) + : sectionInfo( _sectionInfo ), + assertions( _assertions ), + durationInSeconds( _durationInSeconds ), + missingAssertions( _missingAssertions ) + {} + + SectionStats::~SectionStats() = default; + + TestCaseStats::TestCaseStats( TestCaseInfo const& _testInfo, + Totals const& _totals, + std::string const& _stdOut, + std::string const& _stdErr, + bool _aborting ) + : testInfo( _testInfo ), + totals( _totals ), + stdOut( _stdOut ), + stdErr( _stdErr ), + aborting( _aborting ) + {} + + TestCaseStats::~TestCaseStats() = default; + + TestGroupStats::TestGroupStats( GroupInfo const& _groupInfo, + Totals const& _totals, + bool _aborting ) + : groupInfo( _groupInfo ), + totals( _totals ), + aborting( _aborting ) + {} + + TestGroupStats::TestGroupStats( GroupInfo const& _groupInfo ) + : groupInfo( _groupInfo ), + aborting( false ) + {} + + TestGroupStats::~TestGroupStats() = default; + + TestRunStats::TestRunStats( TestRunInfo const& _runInfo, + Totals const& _totals, + bool _aborting ) + : runInfo( _runInfo ), + totals( _totals ), + aborting( _aborting ) + {} + + TestRunStats::~TestRunStats() = default; + + void IStreamingReporter::fatalErrorEncountered( StringRef ) {} + bool IStreamingReporter::isMulti() const { return false; } + + IReporterFactory::~IReporterFactory() = default; + IReporterRegistry::~IReporterRegistry() = default; + +} // end namespace Catch +// end catch_interfaces_reporter.cpp +// start catch_interfaces_runner.cpp + +namespace Catch { + IRunner::~IRunner() = default; +} +// end catch_interfaces_runner.cpp +// start catch_interfaces_testcase.cpp + +namespace Catch { + ITestInvoker::~ITestInvoker() = default; + ITestCaseRegistry::~ITestCaseRegistry() = default; +} +// end catch_interfaces_testcase.cpp +// start catch_leak_detector.cpp + +#ifdef CATCH_CONFIG_WINDOWS_CRTDBG +#include + +namespace Catch { + + LeakDetector::LeakDetector() { + int flag = _CrtSetDbgFlag(_CRTDBG_REPORT_FLAG); + flag |= _CRTDBG_LEAK_CHECK_DF; + flag |= _CRTDBG_ALLOC_MEM_DF; + _CrtSetDbgFlag(flag); + _CrtSetReportMode(_CRT_WARN, _CRTDBG_MODE_FILE | _CRTDBG_MODE_DEBUG); + _CrtSetReportFile(_CRT_WARN, _CRTDBG_FILE_STDERR); + // Change this to leaking allocation's number to break there + _CrtSetBreakAlloc(-1); + } +} + +#else + + Catch::LeakDetector::LeakDetector() {} + +#endif + +Catch::LeakDetector::~LeakDetector() { + Catch::cleanUp(); +} +// end catch_leak_detector.cpp +// start catch_list.cpp + +// start catch_list.h + +#include + +namespace Catch { + + std::size_t listTests( Config const& config ); + + std::size_t listTestsNamesOnly( Config const& config ); + + struct TagInfo { + void add( std::string const& spelling ); + std::string all() const; + + std::set spellings; + std::size_t count = 0; + }; + + std::size_t listTags( Config const& config ); + + std::size_t listReporters(); + + Option list( std::shared_ptr const& config ); + +} // end namespace Catch + +// end catch_list.h +// start catch_text.h + +namespace Catch { + using namespace clara::TextFlow; +} + +// end catch_text.h +#include +#include +#include + +namespace Catch { + + std::size_t listTests( Config const& config ) { + TestSpec testSpec = config.testSpec(); + if( config.hasTestFilters() ) + Catch::cout() << "Matching test cases:\n"; + else { + Catch::cout() << "All available test cases:\n"; + } + + auto matchedTestCases = filterTests( getAllTestCasesSorted( config ), testSpec, config ); + for( auto const& testCaseInfo : matchedTestCases ) { + Colour::Code colour = testCaseInfo.isHidden() + ? Colour::SecondaryText + : Colour::None; + Colour colourGuard( colour ); + + Catch::cout() << Column( testCaseInfo.name ).initialIndent( 2 ).indent( 4 ) << "\n"; + if( config.verbosity() >= Verbosity::High ) { + Catch::cout() << Column( Catch::Detail::stringify( testCaseInfo.lineInfo ) ).indent(4) << std::endl; + std::string description = testCaseInfo.description; + if( description.empty() ) + description = "(NO DESCRIPTION)"; + Catch::cout() << Column( description ).indent(4) << std::endl; + } + if( !testCaseInfo.tags.empty() ) + Catch::cout() << Column( testCaseInfo.tagsAsString() ).indent( 6 ) << "\n"; + } + + if( !config.hasTestFilters() ) + Catch::cout() << pluralise( matchedTestCases.size(), "test case" ) << '\n' << std::endl; + else + Catch::cout() << pluralise( matchedTestCases.size(), "matching test case" ) << '\n' << std::endl; + return matchedTestCases.size(); + } + + std::size_t listTestsNamesOnly( Config const& config ) { + TestSpec testSpec = config.testSpec(); + std::size_t matchedTests = 0; + std::vector matchedTestCases = filterTests( getAllTestCasesSorted( config ), testSpec, config ); + for( auto const& testCaseInfo : matchedTestCases ) { + matchedTests++; + if( startsWith( testCaseInfo.name, '#' ) ) + Catch::cout() << '"' << testCaseInfo.name << '"'; + else + Catch::cout() << testCaseInfo.name; + if ( config.verbosity() >= Verbosity::High ) + Catch::cout() << "\t@" << testCaseInfo.lineInfo; + Catch::cout() << std::endl; + } + return matchedTests; + } + + void TagInfo::add( std::string const& spelling ) { + ++count; + spellings.insert( spelling ); + } + + std::string TagInfo::all() const { + std::string out; + for( auto const& spelling : spellings ) + out += "[" + spelling + "]"; + return out; + } + + std::size_t listTags( Config const& config ) { + TestSpec testSpec = config.testSpec(); + if( config.hasTestFilters() ) + Catch::cout() << "Tags for matching test cases:\n"; + else { + Catch::cout() << "All available tags:\n"; + } + + std::map tagCounts; + + std::vector matchedTestCases = filterTests( getAllTestCasesSorted( config ), testSpec, config ); + for( auto const& testCase : matchedTestCases ) { + for( auto const& tagName : testCase.getTestCaseInfo().tags ) { + std::string lcaseTagName = toLower( tagName ); + auto countIt = tagCounts.find( lcaseTagName ); + if( countIt == tagCounts.end() ) + countIt = tagCounts.insert( std::make_pair( lcaseTagName, TagInfo() ) ).first; + countIt->second.add( tagName ); + } + } + + for( auto const& tagCount : tagCounts ) { + ReusableStringStream rss; + rss << " " << std::setw(2) << tagCount.second.count << " "; + auto str = rss.str(); + auto wrapper = Column( tagCount.second.all() ) + .initialIndent( 0 ) + .indent( str.size() ) + .width( CATCH_CONFIG_CONSOLE_WIDTH-10 ); + Catch::cout() << str << wrapper << '\n'; + } + Catch::cout() << pluralise( tagCounts.size(), "tag" ) << '\n' << std::endl; + return tagCounts.size(); + } + + std::size_t listReporters() { + Catch::cout() << "Available reporters:\n"; + IReporterRegistry::FactoryMap const& factories = getRegistryHub().getReporterRegistry().getFactories(); + std::size_t maxNameLen = 0; + for( auto const& factoryKvp : factories ) + maxNameLen = (std::max)( maxNameLen, factoryKvp.first.size() ); + + for( auto const& factoryKvp : factories ) { + Catch::cout() + << Column( factoryKvp.first + ":" ) + .indent(2) + .width( 5+maxNameLen ) + + Column( factoryKvp.second->getDescription() ) + .initialIndent(0) + .indent(2) + .width( CATCH_CONFIG_CONSOLE_WIDTH - maxNameLen-8 ) + << "\n"; + } + Catch::cout() << std::endl; + return factories.size(); + } + + Option list( std::shared_ptr const& config ) { + Option listedCount; + getCurrentMutableContext().setConfig( config ); + if( config->listTests() ) + listedCount = listedCount.valueOr(0) + listTests( *config ); + if( config->listTestNamesOnly() ) + listedCount = listedCount.valueOr(0) + listTestsNamesOnly( *config ); + if( config->listTags() ) + listedCount = listedCount.valueOr(0) + listTags( *config ); + if( config->listReporters() ) + listedCount = listedCount.valueOr(0) + listReporters(); + return listedCount; + } + +} // end namespace Catch +// end catch_list.cpp +// start catch_matchers.cpp + +namespace Catch { +namespace Matchers { + namespace Impl { + + std::string MatcherUntypedBase::toString() const { + if( m_cachedToString.empty() ) + m_cachedToString = describe(); + return m_cachedToString; + } + + MatcherUntypedBase::~MatcherUntypedBase() = default; + + } // namespace Impl +} // namespace Matchers + +using namespace Matchers; +using Matchers::Impl::MatcherBase; + +} // namespace Catch +// end catch_matchers.cpp +// start catch_matchers_floating.cpp + +// start catch_polyfills.hpp + +namespace Catch { + bool isnan(float f); + bool isnan(double d); +} + +// end catch_polyfills.hpp +// start catch_to_string.hpp + +#include + +namespace Catch { + template + std::string to_string(T const& t) { +#if defined(CATCH_CONFIG_CPP11_TO_STRING) + return std::to_string(t); +#else + ReusableStringStream rss; + rss << t; + return rss.str(); +#endif + } +} // end namespace Catch + +// end catch_to_string.hpp +#include +#include +#include + +namespace Catch { +namespace Matchers { +namespace Floating { +enum class FloatingPointKind : uint8_t { + Float, + Double +}; +} +} +} + +namespace { + +template +struct Converter; + +template <> +struct Converter { + static_assert(sizeof(float) == sizeof(int32_t), "Important ULP matcher assumption violated"); + Converter(float f) { + std::memcpy(&i, &f, sizeof(f)); + } + int32_t i; +}; + +template <> +struct Converter { + static_assert(sizeof(double) == sizeof(int64_t), "Important ULP matcher assumption violated"); + Converter(double d) { + std::memcpy(&i, &d, sizeof(d)); + } + int64_t i; +}; + +template +auto convert(T t) -> Converter { + return Converter(t); +} + +template +bool almostEqualUlps(FP lhs, FP rhs, int maxUlpDiff) { + // Comparison with NaN should always be false. + // This way we can rule it out before getting into the ugly details + if (Catch::isnan(lhs) || Catch::isnan(rhs)) { + return false; + } + + auto lc = convert(lhs); + auto rc = convert(rhs); + + if ((lc.i < 0) != (rc.i < 0)) { + // Potentially we can have +0 and -0 + return lhs == rhs; + } + + auto ulpDiff = std::abs(lc.i - rc.i); + return ulpDiff <= maxUlpDiff; +} + +} + +namespace Catch { +namespace Matchers { +namespace Floating { + WithinAbsMatcher::WithinAbsMatcher(double target, double margin) + :m_target{ target }, m_margin{ margin } { + CATCH_ENFORCE(margin >= 0, "Invalid margin: " << margin << '.' + << " Margin has to be non-negative."); + } + + // Performs equivalent check of std::fabs(lhs - rhs) <= margin + // But without the subtraction to allow for INFINITY in comparison + bool WithinAbsMatcher::match(double const& matchee) const { + return (matchee + m_margin >= m_target) && (m_target + m_margin >= matchee); + } + + std::string WithinAbsMatcher::describe() const { + return "is within " + ::Catch::Detail::stringify(m_margin) + " of " + ::Catch::Detail::stringify(m_target); + } + + WithinUlpsMatcher::WithinUlpsMatcher(double target, int ulps, FloatingPointKind baseType) + :m_target{ target }, m_ulps{ ulps }, m_type{ baseType } { + CATCH_ENFORCE(ulps >= 0, "Invalid ULP setting: " << ulps << '.' + << " ULPs have to be non-negative."); + } + +#if defined(__clang__) +#pragma clang diagnostic push +// Clang <3.5 reports on the default branch in the switch below +#pragma clang diagnostic ignored "-Wunreachable-code" +#endif + + bool WithinUlpsMatcher::match(double const& matchee) const { + switch (m_type) { + case FloatingPointKind::Float: + return almostEqualUlps(static_cast(matchee), static_cast(m_target), m_ulps); + case FloatingPointKind::Double: + return almostEqualUlps(matchee, m_target, m_ulps); + default: + CATCH_INTERNAL_ERROR( "Unknown FloatingPointKind value" ); + } + } + +#if defined(__clang__) +#pragma clang diagnostic pop +#endif + + std::string WithinUlpsMatcher::describe() const { + return "is within " + Catch::to_string(m_ulps) + " ULPs of " + ::Catch::Detail::stringify(m_target) + ((m_type == FloatingPointKind::Float)? "f" : ""); + } + +}// namespace Floating + +Floating::WithinUlpsMatcher WithinULP(double target, int maxUlpDiff) { + return Floating::WithinUlpsMatcher(target, maxUlpDiff, Floating::FloatingPointKind::Double); +} + +Floating::WithinUlpsMatcher WithinULP(float target, int maxUlpDiff) { + return Floating::WithinUlpsMatcher(target, maxUlpDiff, Floating::FloatingPointKind::Float); +} + +Floating::WithinAbsMatcher WithinAbs(double target, double margin) { + return Floating::WithinAbsMatcher(target, margin); +} + +} // namespace Matchers +} // namespace Catch + +// end catch_matchers_floating.cpp +// start catch_matchers_generic.cpp + +std::string Catch::Matchers::Generic::Detail::finalizeDescription(const std::string& desc) { + if (desc.empty()) { + return "matches undescribed predicate"; + } else { + return "matches predicate: \"" + desc + '"'; + } +} +// end catch_matchers_generic.cpp +// start catch_matchers_string.cpp + +#include + +namespace Catch { +namespace Matchers { + + namespace StdString { + + CasedString::CasedString( std::string const& str, CaseSensitive::Choice caseSensitivity ) + : m_caseSensitivity( caseSensitivity ), + m_str( adjustString( str ) ) + {} + std::string CasedString::adjustString( std::string const& str ) const { + return m_caseSensitivity == CaseSensitive::No + ? toLower( str ) + : str; + } + std::string CasedString::caseSensitivitySuffix() const { + return m_caseSensitivity == CaseSensitive::No + ? " (case insensitive)" + : std::string(); + } + + StringMatcherBase::StringMatcherBase( std::string const& operation, CasedString const& comparator ) + : m_comparator( comparator ), + m_operation( operation ) { + } + + std::string StringMatcherBase::describe() const { + std::string description; + description.reserve(5 + m_operation.size() + m_comparator.m_str.size() + + m_comparator.caseSensitivitySuffix().size()); + description += m_operation; + description += ": \""; + description += m_comparator.m_str; + description += "\""; + description += m_comparator.caseSensitivitySuffix(); + return description; + } + + EqualsMatcher::EqualsMatcher( CasedString const& comparator ) : StringMatcherBase( "equals", comparator ) {} + + bool EqualsMatcher::match( std::string const& source ) const { + return m_comparator.adjustString( source ) == m_comparator.m_str; + } + + ContainsMatcher::ContainsMatcher( CasedString const& comparator ) : StringMatcherBase( "contains", comparator ) {} + + bool ContainsMatcher::match( std::string const& source ) const { + return contains( m_comparator.adjustString( source ), m_comparator.m_str ); + } + + StartsWithMatcher::StartsWithMatcher( CasedString const& comparator ) : StringMatcherBase( "starts with", comparator ) {} + + bool StartsWithMatcher::match( std::string const& source ) const { + return startsWith( m_comparator.adjustString( source ), m_comparator.m_str ); + } + + EndsWithMatcher::EndsWithMatcher( CasedString const& comparator ) : StringMatcherBase( "ends with", comparator ) {} + + bool EndsWithMatcher::match( std::string const& source ) const { + return endsWith( m_comparator.adjustString( source ), m_comparator.m_str ); + } + + RegexMatcher::RegexMatcher(std::string regex, CaseSensitive::Choice caseSensitivity): m_regex(std::move(regex)), m_caseSensitivity(caseSensitivity) {} + + bool RegexMatcher::match(std::string const& matchee) const { + auto flags = std::regex::ECMAScript; // ECMAScript is the default syntax option anyway + if (m_caseSensitivity == CaseSensitive::Choice::No) { + flags |= std::regex::icase; + } + auto reg = std::regex(m_regex, flags); + return std::regex_match(matchee, reg); + } + + std::string RegexMatcher::describe() const { + return "matches " + ::Catch::Detail::stringify(m_regex) + ((m_caseSensitivity == CaseSensitive::Choice::Yes)? " case sensitively" : " case insensitively"); + } + + } // namespace StdString + + StdString::EqualsMatcher Equals( std::string const& str, CaseSensitive::Choice caseSensitivity ) { + return StdString::EqualsMatcher( StdString::CasedString( str, caseSensitivity) ); + } + StdString::ContainsMatcher Contains( std::string const& str, CaseSensitive::Choice caseSensitivity ) { + return StdString::ContainsMatcher( StdString::CasedString( str, caseSensitivity) ); + } + StdString::EndsWithMatcher EndsWith( std::string const& str, CaseSensitive::Choice caseSensitivity ) { + return StdString::EndsWithMatcher( StdString::CasedString( str, caseSensitivity) ); + } + StdString::StartsWithMatcher StartsWith( std::string const& str, CaseSensitive::Choice caseSensitivity ) { + return StdString::StartsWithMatcher( StdString::CasedString( str, caseSensitivity) ); + } + + StdString::RegexMatcher Matches(std::string const& regex, CaseSensitive::Choice caseSensitivity) { + return StdString::RegexMatcher(regex, caseSensitivity); + } + +} // namespace Matchers +} // namespace Catch +// end catch_matchers_string.cpp +// start catch_message.cpp + +// start catch_uncaught_exceptions.h + +namespace Catch { + bool uncaught_exceptions(); +} // end namespace Catch + +// end catch_uncaught_exceptions.h +#include +#include + +namespace Catch { + + MessageInfo::MessageInfo( StringRef const& _macroName, + SourceLineInfo const& _lineInfo, + ResultWas::OfType _type ) + : macroName( _macroName ), + lineInfo( _lineInfo ), + type( _type ), + sequence( ++globalCount ) + {} + + bool MessageInfo::operator==( MessageInfo const& other ) const { + return sequence == other.sequence; + } + + bool MessageInfo::operator<( MessageInfo const& other ) const { + return sequence < other.sequence; + } + + // This may need protecting if threading support is added + unsigned int MessageInfo::globalCount = 0; + + //////////////////////////////////////////////////////////////////////////// + + Catch::MessageBuilder::MessageBuilder( StringRef const& macroName, + SourceLineInfo const& lineInfo, + ResultWas::OfType type ) + :m_info(macroName, lineInfo, type) {} + + //////////////////////////////////////////////////////////////////////////// + + ScopedMessage::ScopedMessage( MessageBuilder const& builder ) + : m_info( builder.m_info ), m_moved() + { + m_info.message = builder.m_stream.str(); + getResultCapture().pushScopedMessage( m_info ); + } + + ScopedMessage::ScopedMessage( ScopedMessage&& old ) + : m_info( old.m_info ), m_moved() + { + old.m_moved = true; + } + + ScopedMessage::~ScopedMessage() { + if ( !uncaught_exceptions() && !m_moved ){ + getResultCapture().popScopedMessage(m_info); + } + } + + Capturer::Capturer( StringRef macroName, SourceLineInfo const& lineInfo, ResultWas::OfType resultType, StringRef names ) { + auto trimmed = [&] (size_t start, size_t end) { + while (names[start] == ',' || isspace(names[start])) { + ++start; + } + while (names[end] == ',' || isspace(names[end])) { + --end; + } + return names.substr(start, end - start + 1); + }; + + size_t start = 0; + std::stack openings; + for (size_t pos = 0; pos < names.size(); ++pos) { + char c = names[pos]; + switch (c) { + case '[': + case '{': + case '(': + // It is basically impossible to disambiguate between + // comparison and start of template args in this context +// case '<': + openings.push(c); + break; + case ']': + case '}': + case ')': +// case '>': + openings.pop(); + break; + case ',': + if (start != pos && openings.size() == 0) { + m_messages.emplace_back(macroName, lineInfo, resultType); + m_messages.back().message = trimmed(start, pos); + m_messages.back().message += " := "; + start = pos; + } + } + } + assert(openings.size() == 0 && "Mismatched openings"); + m_messages.emplace_back(macroName, lineInfo, resultType); + m_messages.back().message = trimmed(start, names.size() - 1); + m_messages.back().message += " := "; + } + Capturer::~Capturer() { + if ( !uncaught_exceptions() ){ + assert( m_captured == m_messages.size() ); + for( size_t i = 0; i < m_captured; ++i ) + m_resultCapture.popScopedMessage( m_messages[i] ); + } + } + + void Capturer::captureValue( size_t index, std::string const& value ) { + assert( index < m_messages.size() ); + m_messages[index].message += value; + m_resultCapture.pushScopedMessage( m_messages[index] ); + m_captured++; + } + +} // end namespace Catch +// end catch_message.cpp +// start catch_output_redirect.cpp + +// start catch_output_redirect.h +#ifndef TWOBLUECUBES_CATCH_OUTPUT_REDIRECT_H +#define TWOBLUECUBES_CATCH_OUTPUT_REDIRECT_H + +#include +#include +#include + +namespace Catch { + + class RedirectedStream { + std::ostream& m_originalStream; + std::ostream& m_redirectionStream; + std::streambuf* m_prevBuf; + + public: + RedirectedStream( std::ostream& originalStream, std::ostream& redirectionStream ); + ~RedirectedStream(); + }; + + class RedirectedStdOut { + ReusableStringStream m_rss; + RedirectedStream m_cout; + public: + RedirectedStdOut(); + auto str() const -> std::string; + }; + + // StdErr has two constituent streams in C++, std::cerr and std::clog + // This means that we need to redirect 2 streams into 1 to keep proper + // order of writes + class RedirectedStdErr { + ReusableStringStream m_rss; + RedirectedStream m_cerr; + RedirectedStream m_clog; + public: + RedirectedStdErr(); + auto str() const -> std::string; + }; + + class RedirectedStreams { + public: + RedirectedStreams(RedirectedStreams const&) = delete; + RedirectedStreams& operator=(RedirectedStreams const&) = delete; + RedirectedStreams(RedirectedStreams&&) = delete; + RedirectedStreams& operator=(RedirectedStreams&&) = delete; + + RedirectedStreams(std::string& redirectedCout, std::string& redirectedCerr); + ~RedirectedStreams(); + private: + std::string& m_redirectedCout; + std::string& m_redirectedCerr; + RedirectedStdOut m_redirectedStdOut; + RedirectedStdErr m_redirectedStdErr; + }; + +#if defined(CATCH_CONFIG_NEW_CAPTURE) + + // Windows's implementation of std::tmpfile is terrible (it tries + // to create a file inside system folder, thus requiring elevated + // privileges for the binary), so we have to use tmpnam(_s) and + // create the file ourselves there. + class TempFile { + public: + TempFile(TempFile const&) = delete; + TempFile& operator=(TempFile const&) = delete; + TempFile(TempFile&&) = delete; + TempFile& operator=(TempFile&&) = delete; + + TempFile(); + ~TempFile(); + + std::FILE* getFile(); + std::string getContents(); + + private: + std::FILE* m_file = nullptr; + #if defined(_MSC_VER) + char m_buffer[L_tmpnam] = { 0 }; + #endif + }; + + class OutputRedirect { + public: + OutputRedirect(OutputRedirect const&) = delete; + OutputRedirect& operator=(OutputRedirect const&) = delete; + OutputRedirect(OutputRedirect&&) = delete; + OutputRedirect& operator=(OutputRedirect&&) = delete; + + OutputRedirect(std::string& stdout_dest, std::string& stderr_dest); + ~OutputRedirect(); + + private: + int m_originalStdout = -1; + int m_originalStderr = -1; + TempFile m_stdoutFile; + TempFile m_stderrFile; + std::string& m_stdoutDest; + std::string& m_stderrDest; + }; + +#endif + +} // end namespace Catch + +#endif // TWOBLUECUBES_CATCH_OUTPUT_REDIRECT_H +// end catch_output_redirect.h +#include +#include +#include +#include +#include + +#if defined(CATCH_CONFIG_NEW_CAPTURE) + #if defined(_MSC_VER) + #include //_dup and _dup2 + #define dup _dup + #define dup2 _dup2 + #define fileno _fileno + #else + #include // dup and dup2 + #endif +#endif + +namespace Catch { + + RedirectedStream::RedirectedStream( std::ostream& originalStream, std::ostream& redirectionStream ) + : m_originalStream( originalStream ), + m_redirectionStream( redirectionStream ), + m_prevBuf( m_originalStream.rdbuf() ) + { + m_originalStream.rdbuf( m_redirectionStream.rdbuf() ); + } + + RedirectedStream::~RedirectedStream() { + m_originalStream.rdbuf( m_prevBuf ); + } + + RedirectedStdOut::RedirectedStdOut() : m_cout( Catch::cout(), m_rss.get() ) {} + auto RedirectedStdOut::str() const -> std::string { return m_rss.str(); } + + RedirectedStdErr::RedirectedStdErr() + : m_cerr( Catch::cerr(), m_rss.get() ), + m_clog( Catch::clog(), m_rss.get() ) + {} + auto RedirectedStdErr::str() const -> std::string { return m_rss.str(); } + + RedirectedStreams::RedirectedStreams(std::string& redirectedCout, std::string& redirectedCerr) + : m_redirectedCout(redirectedCout), + m_redirectedCerr(redirectedCerr) + {} + + RedirectedStreams::~RedirectedStreams() { + m_redirectedCout += m_redirectedStdOut.str(); + m_redirectedCerr += m_redirectedStdErr.str(); + } + +#if defined(CATCH_CONFIG_NEW_CAPTURE) + +#if defined(_MSC_VER) + TempFile::TempFile() { + if (tmpnam_s(m_buffer)) { + CATCH_RUNTIME_ERROR("Could not get a temp filename"); + } + if (fopen_s(&m_file, m_buffer, "w")) { + char buffer[100]; + if (strerror_s(buffer, errno)) { + CATCH_RUNTIME_ERROR("Could not translate errno to a string"); + } + CATCH_RUNTIME_ERROR("Coul dnot open the temp file: '" << m_buffer << "' because: " << buffer); + } + } +#else + TempFile::TempFile() { + m_file = std::tmpfile(); + if (!m_file) { + CATCH_RUNTIME_ERROR("Could not create a temp file."); + } + } + +#endif + + TempFile::~TempFile() { + // TBD: What to do about errors here? + std::fclose(m_file); + // We manually create the file on Windows only, on Linux + // it will be autodeleted +#if defined(_MSC_VER) + std::remove(m_buffer); +#endif + } + + FILE* TempFile::getFile() { + return m_file; + } + + std::string TempFile::getContents() { + std::stringstream sstr; + char buffer[100] = {}; + std::rewind(m_file); + while (std::fgets(buffer, sizeof(buffer), m_file)) { + sstr << buffer; + } + return sstr.str(); + } + + OutputRedirect::OutputRedirect(std::string& stdout_dest, std::string& stderr_dest) : + m_originalStdout(dup(1)), + m_originalStderr(dup(2)), + m_stdoutDest(stdout_dest), + m_stderrDest(stderr_dest) { + dup2(fileno(m_stdoutFile.getFile()), 1); + dup2(fileno(m_stderrFile.getFile()), 2); + } + + OutputRedirect::~OutputRedirect() { + Catch::cout() << std::flush; + fflush(stdout); + // Since we support overriding these streams, we flush cerr + // even though std::cerr is unbuffered + Catch::cerr() << std::flush; + Catch::clog() << std::flush; + fflush(stderr); + + dup2(m_originalStdout, 1); + dup2(m_originalStderr, 2); + + m_stdoutDest += m_stdoutFile.getContents(); + m_stderrDest += m_stderrFile.getContents(); + } + +#endif // CATCH_CONFIG_NEW_CAPTURE + +} // namespace Catch + +#if defined(CATCH_CONFIG_NEW_CAPTURE) + #if defined(_MSC_VER) + #undef dup + #undef dup2 + #undef fileno + #endif +#endif +// end catch_output_redirect.cpp +// start catch_polyfills.cpp + +#include + +namespace Catch { + +#if !defined(CATCH_CONFIG_POLYFILL_ISNAN) + bool isnan(float f) { + return std::isnan(f); + } + bool isnan(double d) { + return std::isnan(d); + } +#else + // For now we only use this for embarcadero + bool isnan(float f) { + return std::_isnan(f); + } + bool isnan(double d) { + return std::_isnan(d); + } +#endif + +} // end namespace Catch +// end catch_polyfills.cpp +// start catch_random_number_generator.cpp + +namespace Catch { + + std::mt19937& rng() { + static std::mt19937 s_rng; + return s_rng; + } + + void seedRng( IConfig const& config ) { + if( config.rngSeed() != 0 ) { + std::srand( config.rngSeed() ); + rng().seed( config.rngSeed() ); + } + } + + unsigned int rngSeed() { + return getCurrentContext().getConfig()->rngSeed(); + } +} +// end catch_random_number_generator.cpp +// start catch_registry_hub.cpp + +// start catch_test_case_registry_impl.h + +#include +#include +#include +#include + +namespace Catch { + + class TestCase; + struct IConfig; + + std::vector sortTests( IConfig const& config, std::vector const& unsortedTestCases ); + bool matchTest( TestCase const& testCase, TestSpec const& testSpec, IConfig const& config ); + + void enforceNoDuplicateTestCases( std::vector const& functions ); + + std::vector filterTests( std::vector const& testCases, TestSpec const& testSpec, IConfig const& config ); + std::vector const& getAllTestCasesSorted( IConfig const& config ); + + class TestRegistry : public ITestCaseRegistry { + public: + virtual ~TestRegistry() = default; + + virtual void registerTest( TestCase const& testCase ); + + std::vector const& getAllTests() const override; + std::vector const& getAllTestsSorted( IConfig const& config ) const override; + + private: + std::vector m_functions; + mutable RunTests::InWhatOrder m_currentSortOrder = RunTests::InDeclarationOrder; + mutable std::vector m_sortedFunctions; + std::size_t m_unnamedCount = 0; + std::ios_base::Init m_ostreamInit; // Forces cout/ cerr to be initialised + }; + + /////////////////////////////////////////////////////////////////////////// + + class TestInvokerAsFunction : public ITestInvoker { + void(*m_testAsFunction)(); + public: + TestInvokerAsFunction( void(*testAsFunction)() ) noexcept; + + void invoke() const override; + }; + + std::string extractClassName( StringRef const& classOrQualifiedMethodName ); + + /////////////////////////////////////////////////////////////////////////// + +} // end namespace Catch + +// end catch_test_case_registry_impl.h +// start catch_reporter_registry.h + +#include + +namespace Catch { + + class ReporterRegistry : public IReporterRegistry { + + public: + + ~ReporterRegistry() override; + + IStreamingReporterPtr create( std::string const& name, IConfigPtr const& config ) const override; + + void registerReporter( std::string const& name, IReporterFactoryPtr const& factory ); + void registerListener( IReporterFactoryPtr const& factory ); + + FactoryMap const& getFactories() const override; + Listeners const& getListeners() const override; + + private: + FactoryMap m_factories; + Listeners m_listeners; + }; +} + +// end catch_reporter_registry.h +// start catch_tag_alias_registry.h + +// start catch_tag_alias.h + +#include + +namespace Catch { + + struct TagAlias { + TagAlias(std::string const& _tag, SourceLineInfo _lineInfo); + + std::string tag; + SourceLineInfo lineInfo; + }; + +} // end namespace Catch + +// end catch_tag_alias.h +#include + +namespace Catch { + + class TagAliasRegistry : public ITagAliasRegistry { + public: + ~TagAliasRegistry() override; + TagAlias const* find( std::string const& alias ) const override; + std::string expandAliases( std::string const& unexpandedTestSpec ) const override; + void add( std::string const& alias, std::string const& tag, SourceLineInfo const& lineInfo ); + + private: + std::map m_registry; + }; + +} // end namespace Catch + +// end catch_tag_alias_registry.h +// start catch_startup_exception_registry.h + +#include +#include + +namespace Catch { + + class StartupExceptionRegistry { + public: + void add(std::exception_ptr const& exception) noexcept; + std::vector const& getExceptions() const noexcept; + private: + std::vector m_exceptions; + }; + +} // end namespace Catch + +// end catch_startup_exception_registry.h +// start catch_singletons.hpp + +namespace Catch { + + struct ISingleton { + virtual ~ISingleton(); + }; + + void addSingleton( ISingleton* singleton ); + void cleanupSingletons(); + + template + class Singleton : SingletonImplT, public ISingleton { + + static auto getInternal() -> Singleton* { + static Singleton* s_instance = nullptr; + if( !s_instance ) { + s_instance = new Singleton; + addSingleton( s_instance ); + } + return s_instance; + } + + public: + static auto get() -> InterfaceT const& { + return *getInternal(); + } + static auto getMutable() -> MutableInterfaceT& { + return *getInternal(); + } + }; + +} // namespace Catch + +// end catch_singletons.hpp +namespace Catch { + + namespace { + + class RegistryHub : public IRegistryHub, public IMutableRegistryHub, + private NonCopyable { + + public: // IRegistryHub + RegistryHub() = default; + IReporterRegistry const& getReporterRegistry() const override { + return m_reporterRegistry; + } + ITestCaseRegistry const& getTestCaseRegistry() const override { + return m_testCaseRegistry; + } + IExceptionTranslatorRegistry const& getExceptionTranslatorRegistry() const override { + return m_exceptionTranslatorRegistry; + } + ITagAliasRegistry const& getTagAliasRegistry() const override { + return m_tagAliasRegistry; + } + StartupExceptionRegistry const& getStartupExceptionRegistry() const override { + return m_exceptionRegistry; + } + + public: // IMutableRegistryHub + void registerReporter( std::string const& name, IReporterFactoryPtr const& factory ) override { + m_reporterRegistry.registerReporter( name, factory ); + } + void registerListener( IReporterFactoryPtr const& factory ) override { + m_reporterRegistry.registerListener( factory ); + } + void registerTest( TestCase const& testInfo ) override { + m_testCaseRegistry.registerTest( testInfo ); + } + void registerTranslator( const IExceptionTranslator* translator ) override { + m_exceptionTranslatorRegistry.registerTranslator( translator ); + } + void registerTagAlias( std::string const& alias, std::string const& tag, SourceLineInfo const& lineInfo ) override { + m_tagAliasRegistry.add( alias, tag, lineInfo ); + } + void registerStartupException() noexcept override { + m_exceptionRegistry.add(std::current_exception()); + } + + private: + TestRegistry m_testCaseRegistry; + ReporterRegistry m_reporterRegistry; + ExceptionTranslatorRegistry m_exceptionTranslatorRegistry; + TagAliasRegistry m_tagAliasRegistry; + StartupExceptionRegistry m_exceptionRegistry; + }; + } + + using RegistryHubSingleton = Singleton; + + IRegistryHub const& getRegistryHub() { + return RegistryHubSingleton::get(); + } + IMutableRegistryHub& getMutableRegistryHub() { + return RegistryHubSingleton::getMutable(); + } + void cleanUp() { + cleanupSingletons(); + cleanUpContext(); + } + std::string translateActiveException() { + return getRegistryHub().getExceptionTranslatorRegistry().translateActiveException(); + } + +} // end namespace Catch +// end catch_registry_hub.cpp +// start catch_reporter_registry.cpp + +namespace Catch { + + ReporterRegistry::~ReporterRegistry() = default; + + IStreamingReporterPtr ReporterRegistry::create( std::string const& name, IConfigPtr const& config ) const { + auto it = m_factories.find( name ); + if( it == m_factories.end() ) + return nullptr; + return it->second->create( ReporterConfig( config ) ); + } + + void ReporterRegistry::registerReporter( std::string const& name, IReporterFactoryPtr const& factory ) { + m_factories.emplace(name, factory); + } + void ReporterRegistry::registerListener( IReporterFactoryPtr const& factory ) { + m_listeners.push_back( factory ); + } + + IReporterRegistry::FactoryMap const& ReporterRegistry::getFactories() const { + return m_factories; + } + IReporterRegistry::Listeners const& ReporterRegistry::getListeners() const { + return m_listeners; + } + +} +// end catch_reporter_registry.cpp +// start catch_result_type.cpp + +namespace Catch { + + bool isOk( ResultWas::OfType resultType ) { + return ( resultType & ResultWas::FailureBit ) == 0; + } + bool isJustInfo( int flags ) { + return flags == ResultWas::Info; + } + + ResultDisposition::Flags operator | ( ResultDisposition::Flags lhs, ResultDisposition::Flags rhs ) { + return static_cast( static_cast( lhs ) | static_cast( rhs ) ); + } + + bool shouldContinueOnFailure( int flags ) { return ( flags & ResultDisposition::ContinueOnFailure ) != 0; } + bool shouldSuppressFailure( int flags ) { return ( flags & ResultDisposition::SuppressFail ) != 0; } + +} // end namespace Catch +// end catch_result_type.cpp +// start catch_run_context.cpp + +#include +#include +#include + +namespace Catch { + + namespace Generators { + struct GeneratorTracker : TestCaseTracking::TrackerBase, IGeneratorTracker { + GeneratorBasePtr m_generator; + + GeneratorTracker( TestCaseTracking::NameAndLocation const& nameAndLocation, TrackerContext& ctx, ITracker* parent ) + : TrackerBase( nameAndLocation, ctx, parent ) + {} + ~GeneratorTracker(); + + static GeneratorTracker& acquire( TrackerContext& ctx, TestCaseTracking::NameAndLocation const& nameAndLocation ) { + std::shared_ptr tracker; + + ITracker& currentTracker = ctx.currentTracker(); + if( TestCaseTracking::ITrackerPtr childTracker = currentTracker.findChild( nameAndLocation ) ) { + assert( childTracker ); + assert( childTracker->isGeneratorTracker() ); + tracker = std::static_pointer_cast( childTracker ); + } + else { + tracker = std::make_shared( nameAndLocation, ctx, ¤tTracker ); + currentTracker.addChild( tracker ); + } + + if( !ctx.completedCycle() && !tracker->isComplete() ) { + tracker->open(); + } + + return *tracker; + } + + // TrackerBase interface + bool isGeneratorTracker() const override { return true; } + auto hasGenerator() const -> bool override { + return !!m_generator; + } + void close() override { + TrackerBase::close(); + // Generator interface only finds out if it has another item on atual move + if (m_runState == CompletedSuccessfully && m_generator->next()) { + m_children.clear(); + m_runState = Executing; + } + } + + // IGeneratorTracker interface + auto getGenerator() const -> GeneratorBasePtr const& override { + return m_generator; + } + void setGenerator( GeneratorBasePtr&& generator ) override { + m_generator = std::move( generator ); + } + }; + GeneratorTracker::~GeneratorTracker() {} + } + + RunContext::RunContext(IConfigPtr const& _config, IStreamingReporterPtr&& reporter) + : m_runInfo(_config->name()), + m_context(getCurrentMutableContext()), + m_config(_config), + m_reporter(std::move(reporter)), + m_lastAssertionInfo{ StringRef(), SourceLineInfo("",0), StringRef(), ResultDisposition::Normal }, + m_includeSuccessfulResults( m_config->includeSuccessfulResults() || m_reporter->getPreferences().shouldReportAllAssertions ) + { + m_context.setRunner(this); + m_context.setConfig(m_config); + m_context.setResultCapture(this); + m_reporter->testRunStarting(m_runInfo); + } + + RunContext::~RunContext() { + m_reporter->testRunEnded(TestRunStats(m_runInfo, m_totals, aborting())); + } + + void RunContext::testGroupStarting(std::string const& testSpec, std::size_t groupIndex, std::size_t groupsCount) { + m_reporter->testGroupStarting(GroupInfo(testSpec, groupIndex, groupsCount)); + } + + void RunContext::testGroupEnded(std::string const& testSpec, Totals const& totals, std::size_t groupIndex, std::size_t groupsCount) { + m_reporter->testGroupEnded(TestGroupStats(GroupInfo(testSpec, groupIndex, groupsCount), totals, aborting())); + } + + Totals RunContext::runTest(TestCase const& testCase) { + Totals prevTotals = m_totals; + + std::string redirectedCout; + std::string redirectedCerr; + + auto const& testInfo = testCase.getTestCaseInfo(); + + m_reporter->testCaseStarting(testInfo); + + m_activeTestCase = &testCase; + + ITracker& rootTracker = m_trackerContext.startRun(); + assert(rootTracker.isSectionTracker()); + static_cast(rootTracker).addInitialFilters(m_config->getSectionsToRun()); + do { + m_trackerContext.startCycle(); + m_testCaseTracker = &SectionTracker::acquire(m_trackerContext, TestCaseTracking::NameAndLocation(testInfo.name, testInfo.lineInfo)); + runCurrentTest(redirectedCout, redirectedCerr); + } while (!m_testCaseTracker->isSuccessfullyCompleted() && !aborting()); + + Totals deltaTotals = m_totals.delta(prevTotals); + if (testInfo.expectedToFail() && deltaTotals.testCases.passed > 0) { + deltaTotals.assertions.failed++; + deltaTotals.testCases.passed--; + deltaTotals.testCases.failed++; + } + m_totals.testCases += deltaTotals.testCases; + m_reporter->testCaseEnded(TestCaseStats(testInfo, + deltaTotals, + redirectedCout, + redirectedCerr, + aborting())); + + m_activeTestCase = nullptr; + m_testCaseTracker = nullptr; + + return deltaTotals; + } + + IConfigPtr RunContext::config() const { + return m_config; + } + + IStreamingReporter& RunContext::reporter() const { + return *m_reporter; + } + + void RunContext::assertionEnded(AssertionResult const & result) { + if (result.getResultType() == ResultWas::Ok) { + m_totals.assertions.passed++; + m_lastAssertionPassed = true; + } else if (!result.isOk()) { + m_lastAssertionPassed = false; + if( m_activeTestCase->getTestCaseInfo().okToFail() ) + m_totals.assertions.failedButOk++; + else + m_totals.assertions.failed++; + } + else { + m_lastAssertionPassed = true; + } + + // We have no use for the return value (whether messages should be cleared), because messages were made scoped + // and should be let to clear themselves out. + static_cast(m_reporter->assertionEnded(AssertionStats(result, m_messages, m_totals))); + + if (result.getResultType() != ResultWas::Warning) + m_messageScopes.clear(); + + // Reset working state + resetAssertionInfo(); + m_lastResult = result; + } + void RunContext::resetAssertionInfo() { + m_lastAssertionInfo.macroName = StringRef(); + m_lastAssertionInfo.capturedExpression = "{Unknown expression after the reported line}"_sr; + } + + bool RunContext::sectionStarted(SectionInfo const & sectionInfo, Counts & assertions) { + ITracker& sectionTracker = SectionTracker::acquire(m_trackerContext, TestCaseTracking::NameAndLocation(sectionInfo.name, sectionInfo.lineInfo)); + if (!sectionTracker.isOpen()) + return false; + m_activeSections.push_back(§ionTracker); + + m_lastAssertionInfo.lineInfo = sectionInfo.lineInfo; + + m_reporter->sectionStarting(sectionInfo); + + assertions = m_totals.assertions; + + return true; + } + auto RunContext::acquireGeneratorTracker( SourceLineInfo const& lineInfo ) -> IGeneratorTracker& { + using namespace Generators; + GeneratorTracker& tracker = GeneratorTracker::acquire( m_trackerContext, TestCaseTracking::NameAndLocation( "generator", lineInfo ) ); + assert( tracker.isOpen() ); + m_lastAssertionInfo.lineInfo = lineInfo; + return tracker; + } + + bool RunContext::testForMissingAssertions(Counts& assertions) { + if (assertions.total() != 0) + return false; + if (!m_config->warnAboutMissingAssertions()) + return false; + if (m_trackerContext.currentTracker().hasChildren()) + return false; + m_totals.assertions.failed++; + assertions.failed++; + return true; + } + + void RunContext::sectionEnded(SectionEndInfo const & endInfo) { + Counts assertions = m_totals.assertions - endInfo.prevAssertions; + bool missingAssertions = testForMissingAssertions(assertions); + + if (!m_activeSections.empty()) { + m_activeSections.back()->close(); + m_activeSections.pop_back(); + } + + m_reporter->sectionEnded(SectionStats(endInfo.sectionInfo, assertions, endInfo.durationInSeconds, missingAssertions)); + m_messages.clear(); + m_messageScopes.clear(); + } + + void RunContext::sectionEndedEarly(SectionEndInfo const & endInfo) { + if (m_unfinishedSections.empty()) + m_activeSections.back()->fail(); + else + m_activeSections.back()->close(); + m_activeSections.pop_back(); + + m_unfinishedSections.push_back(endInfo); + } + void RunContext::benchmarkStarting( BenchmarkInfo const& info ) { + m_reporter->benchmarkStarting( info ); + } + void RunContext::benchmarkEnded( BenchmarkStats const& stats ) { + m_reporter->benchmarkEnded( stats ); + } + + void RunContext::pushScopedMessage(MessageInfo const & message) { + m_messages.push_back(message); + } + + void RunContext::popScopedMessage(MessageInfo const & message) { + m_messages.erase(std::remove(m_messages.begin(), m_messages.end(), message), m_messages.end()); + } + + void RunContext::emplaceUnscopedMessage( MessageBuilder const& builder ) { + m_messageScopes.emplace_back( builder ); + } + + std::string RunContext::getCurrentTestName() const { + return m_activeTestCase + ? m_activeTestCase->getTestCaseInfo().name + : std::string(); + } + + const AssertionResult * RunContext::getLastResult() const { + return &(*m_lastResult); + } + + void RunContext::exceptionEarlyReported() { + m_shouldReportUnexpected = false; + } + + void RunContext::handleFatalErrorCondition( StringRef message ) { + // First notify reporter that bad things happened + m_reporter->fatalErrorEncountered(message); + + // Don't rebuild the result -- the stringification itself can cause more fatal errors + // Instead, fake a result data. + AssertionResultData tempResult( ResultWas::FatalErrorCondition, { false } ); + tempResult.message = message; + AssertionResult result(m_lastAssertionInfo, tempResult); + + assertionEnded(result); + + handleUnfinishedSections(); + + // Recreate section for test case (as we will lose the one that was in scope) + auto const& testCaseInfo = m_activeTestCase->getTestCaseInfo(); + SectionInfo testCaseSection(testCaseInfo.lineInfo, testCaseInfo.name); + + Counts assertions; + assertions.failed = 1; + SectionStats testCaseSectionStats(testCaseSection, assertions, 0, false); + m_reporter->sectionEnded(testCaseSectionStats); + + auto const& testInfo = m_activeTestCase->getTestCaseInfo(); + + Totals deltaTotals; + deltaTotals.testCases.failed = 1; + deltaTotals.assertions.failed = 1; + m_reporter->testCaseEnded(TestCaseStats(testInfo, + deltaTotals, + std::string(), + std::string(), + false)); + m_totals.testCases.failed++; + testGroupEnded(std::string(), m_totals, 1, 1); + m_reporter->testRunEnded(TestRunStats(m_runInfo, m_totals, false)); + } + + bool RunContext::lastAssertionPassed() { + return m_lastAssertionPassed; + } + + void RunContext::assertionPassed() { + m_lastAssertionPassed = true; + ++m_totals.assertions.passed; + resetAssertionInfo(); + m_messageScopes.clear(); + } + + bool RunContext::aborting() const { + return m_totals.assertions.failed >= static_cast(m_config->abortAfter()); + } + + void RunContext::runCurrentTest(std::string & redirectedCout, std::string & redirectedCerr) { + auto const& testCaseInfo = m_activeTestCase->getTestCaseInfo(); + SectionInfo testCaseSection(testCaseInfo.lineInfo, testCaseInfo.name); + m_reporter->sectionStarting(testCaseSection); + Counts prevAssertions = m_totals.assertions; + double duration = 0; + m_shouldReportUnexpected = true; + m_lastAssertionInfo = { "TEST_CASE"_sr, testCaseInfo.lineInfo, StringRef(), ResultDisposition::Normal }; + + seedRng(*m_config); + + Timer timer; + CATCH_TRY { + if (m_reporter->getPreferences().shouldRedirectStdOut) { +#if !defined(CATCH_CONFIG_EXPERIMENTAL_REDIRECT) + RedirectedStreams redirectedStreams(redirectedCout, redirectedCerr); + + timer.start(); + invokeActiveTestCase(); +#else + OutputRedirect r(redirectedCout, redirectedCerr); + timer.start(); + invokeActiveTestCase(); +#endif + } else { + timer.start(); + invokeActiveTestCase(); + } + duration = timer.getElapsedSeconds(); + } CATCH_CATCH_ANON (TestFailureException&) { + // This just means the test was aborted due to failure + } CATCH_CATCH_ALL { + // Under CATCH_CONFIG_FAST_COMPILE, unexpected exceptions under REQUIRE assertions + // are reported without translation at the point of origin. + if( m_shouldReportUnexpected ) { + AssertionReaction dummyReaction; + handleUnexpectedInflightException( m_lastAssertionInfo, translateActiveException(), dummyReaction ); + } + } + Counts assertions = m_totals.assertions - prevAssertions; + bool missingAssertions = testForMissingAssertions(assertions); + + m_testCaseTracker->close(); + handleUnfinishedSections(); + m_messages.clear(); + m_messageScopes.clear(); + + SectionStats testCaseSectionStats(testCaseSection, assertions, duration, missingAssertions); + m_reporter->sectionEnded(testCaseSectionStats); + } + + void RunContext::invokeActiveTestCase() { + FatalConditionHandler fatalConditionHandler; // Handle signals + m_activeTestCase->invoke(); + fatalConditionHandler.reset(); + } + + void RunContext::handleUnfinishedSections() { + // If sections ended prematurely due to an exception we stored their + // infos here so we can tear them down outside the unwind process. + for (auto it = m_unfinishedSections.rbegin(), + itEnd = m_unfinishedSections.rend(); + it != itEnd; + ++it) + sectionEnded(*it); + m_unfinishedSections.clear(); + } + + void RunContext::handleExpr( + AssertionInfo const& info, + ITransientExpression const& expr, + AssertionReaction& reaction + ) { + m_reporter->assertionStarting( info ); + + bool negated = isFalseTest( info.resultDisposition ); + bool result = expr.getResult() != negated; + + if( result ) { + if (!m_includeSuccessfulResults) { + assertionPassed(); + } + else { + reportExpr(info, ResultWas::Ok, &expr, negated); + } + } + else { + reportExpr(info, ResultWas::ExpressionFailed, &expr, negated ); + populateReaction( reaction ); + } + } + void RunContext::reportExpr( + AssertionInfo const &info, + ResultWas::OfType resultType, + ITransientExpression const *expr, + bool negated ) { + + m_lastAssertionInfo = info; + AssertionResultData data( resultType, LazyExpression( negated ) ); + + AssertionResult assertionResult{ info, data }; + assertionResult.m_resultData.lazyExpression.m_transientExpression = expr; + + assertionEnded( assertionResult ); + } + + void RunContext::handleMessage( + AssertionInfo const& info, + ResultWas::OfType resultType, + StringRef const& message, + AssertionReaction& reaction + ) { + m_reporter->assertionStarting( info ); + + m_lastAssertionInfo = info; + + AssertionResultData data( resultType, LazyExpression( false ) ); + data.message = message; + AssertionResult assertionResult{ m_lastAssertionInfo, data }; + assertionEnded( assertionResult ); + if( !assertionResult.isOk() ) + populateReaction( reaction ); + } + void RunContext::handleUnexpectedExceptionNotThrown( + AssertionInfo const& info, + AssertionReaction& reaction + ) { + handleNonExpr(info, Catch::ResultWas::DidntThrowException, reaction); + } + + void RunContext::handleUnexpectedInflightException( + AssertionInfo const& info, + std::string const& message, + AssertionReaction& reaction + ) { + m_lastAssertionInfo = info; + + AssertionResultData data( ResultWas::ThrewException, LazyExpression( false ) ); + data.message = message; + AssertionResult assertionResult{ info, data }; + assertionEnded( assertionResult ); + populateReaction( reaction ); + } + + void RunContext::populateReaction( AssertionReaction& reaction ) { + reaction.shouldDebugBreak = m_config->shouldDebugBreak(); + reaction.shouldThrow = aborting() || (m_lastAssertionInfo.resultDisposition & ResultDisposition::Normal); + } + + void RunContext::handleIncomplete( + AssertionInfo const& info + ) { + m_lastAssertionInfo = info; + + AssertionResultData data( ResultWas::ThrewException, LazyExpression( false ) ); + data.message = "Exception translation was disabled by CATCH_CONFIG_FAST_COMPILE"; + AssertionResult assertionResult{ info, data }; + assertionEnded( assertionResult ); + } + void RunContext::handleNonExpr( + AssertionInfo const &info, + ResultWas::OfType resultType, + AssertionReaction &reaction + ) { + m_lastAssertionInfo = info; + + AssertionResultData data( resultType, LazyExpression( false ) ); + AssertionResult assertionResult{ info, data }; + assertionEnded( assertionResult ); + + if( !assertionResult.isOk() ) + populateReaction( reaction ); + } + + IResultCapture& getResultCapture() { + if (auto* capture = getCurrentContext().getResultCapture()) + return *capture; + else + CATCH_INTERNAL_ERROR("No result capture instance"); + } +} +// end catch_run_context.cpp +// start catch_section.cpp + +namespace Catch { + + Section::Section( SectionInfo const& info ) + : m_info( info ), + m_sectionIncluded( getResultCapture().sectionStarted( m_info, m_assertions ) ) + { + m_timer.start(); + } + + Section::~Section() { + if( m_sectionIncluded ) { + SectionEndInfo endInfo{ m_info, m_assertions, m_timer.getElapsedSeconds() }; + if( uncaught_exceptions() ) + getResultCapture().sectionEndedEarly( endInfo ); + else + getResultCapture().sectionEnded( endInfo ); + } + } + + // This indicates whether the section should be executed or not + Section::operator bool() const { + return m_sectionIncluded; + } + +} // end namespace Catch +// end catch_section.cpp +// start catch_section_info.cpp + +namespace Catch { + + SectionInfo::SectionInfo + ( SourceLineInfo const& _lineInfo, + std::string const& _name ) + : name( _name ), + lineInfo( _lineInfo ) + {} + +} // end namespace Catch +// end catch_section_info.cpp +// start catch_session.cpp + +// start catch_session.h + +#include + +namespace Catch { + + class Session : NonCopyable { + public: + + Session(); + ~Session() override; + + void showHelp() const; + void libIdentify(); + + int applyCommandLine( int argc, char const * const * argv ); + #if defined(CATCH_CONFIG_WCHAR) && defined(WIN32) && defined(UNICODE) + int applyCommandLine( int argc, wchar_t const * const * argv ); + #endif + + void useConfigData( ConfigData const& configData ); + + template + int run(int argc, CharT const * const argv[]) { + if (m_startupExceptions) + return 1; + int returnCode = applyCommandLine(argc, argv); + if (returnCode == 0) + returnCode = run(); + return returnCode; + } + + int run(); + + clara::Parser const& cli() const; + void cli( clara::Parser const& newParser ); + ConfigData& configData(); + Config& config(); + private: + int runInternal(); + + clara::Parser m_cli; + ConfigData m_configData; + std::shared_ptr m_config; + bool m_startupExceptions = false; + }; + +} // end namespace Catch + +// end catch_session.h +// start catch_version.h + +#include + +namespace Catch { + + // Versioning information + struct Version { + Version( Version const& ) = delete; + Version& operator=( Version const& ) = delete; + Version( unsigned int _majorVersion, + unsigned int _minorVersion, + unsigned int _patchNumber, + char const * const _branchName, + unsigned int _buildNumber ); + + unsigned int const majorVersion; + unsigned int const minorVersion; + unsigned int const patchNumber; + + // buildNumber is only used if branchName is not null + char const * const branchName; + unsigned int const buildNumber; + + friend std::ostream& operator << ( std::ostream& os, Version const& version ); + }; + + Version const& libraryVersion(); +} + +// end catch_version.h +#include +#include + +namespace Catch { + + namespace { + const int MaxExitCode = 255; + + IStreamingReporterPtr createReporter(std::string const& reporterName, IConfigPtr const& config) { + auto reporter = Catch::getRegistryHub().getReporterRegistry().create(reporterName, config); + CATCH_ENFORCE(reporter, "No reporter registered with name: '" << reporterName << "'"); + + return reporter; + } + + IStreamingReporterPtr makeReporter(std::shared_ptr const& config) { + if (Catch::getRegistryHub().getReporterRegistry().getListeners().empty()) { + return createReporter(config->getReporterName(), config); + } + + // On older platforms, returning std::unique_ptr + // when the return type is std::unique_ptr + // doesn't compile without a std::move call. However, this causes + // a warning on newer platforms. Thus, we have to work around + // it a bit and downcast the pointer manually. + auto ret = std::unique_ptr(new ListeningReporter); + auto& multi = static_cast(*ret); + auto const& listeners = Catch::getRegistryHub().getReporterRegistry().getListeners(); + for (auto const& listener : listeners) { + multi.addListener(listener->create(Catch::ReporterConfig(config))); + } + multi.addReporter(createReporter(config->getReporterName(), config)); + return ret; + } + + Catch::Totals runTests(std::shared_ptr const& config) { + auto reporter = makeReporter(config); + + RunContext context(config, std::move(reporter)); + + Totals totals; + + context.testGroupStarting(config->name(), 1, 1); + + TestSpec testSpec = config->testSpec(); + + auto const& allTestCases = getAllTestCasesSorted(*config); + for (auto const& testCase : allTestCases) { + if (!context.aborting() && matchTest(testCase, testSpec, *config)) + totals += context.runTest(testCase); + else + context.reporter().skipTest(testCase); + } + + if (config->warnAboutNoTests() && totals.testCases.total() == 0) { + ReusableStringStream testConfig; + + bool first = true; + for (const auto& input : config->getTestsOrTags()) { + if (!first) { testConfig << ' '; } + first = false; + testConfig << input; + } + + context.reporter().noMatchingTestCases(testConfig.str()); + totals.error = -1; + } + + context.testGroupEnded(config->name(), totals, 1, 1); + return totals; + } + + void applyFilenamesAsTags(Catch::IConfig const& config) { + auto& tests = const_cast&>(getAllTestCasesSorted(config)); + for (auto& testCase : tests) { + auto tags = testCase.tags; + + std::string filename = testCase.lineInfo.file; + auto lastSlash = filename.find_last_of("\\/"); + if (lastSlash != std::string::npos) { + filename.erase(0, lastSlash); + filename[0] = '#'; + } + + auto lastDot = filename.find_last_of('.'); + if (lastDot != std::string::npos) { + filename.erase(lastDot); + } + + tags.push_back(std::move(filename)); + setTags(testCase, tags); + } + } + + } // anon namespace + + Session::Session() { + static bool alreadyInstantiated = false; + if( alreadyInstantiated ) { + CATCH_TRY { CATCH_INTERNAL_ERROR( "Only one instance of Catch::Session can ever be used" ); } + CATCH_CATCH_ALL { getMutableRegistryHub().registerStartupException(); } + } + + // There cannot be exceptions at startup in no-exception mode. +#if !defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) + const auto& exceptions = getRegistryHub().getStartupExceptionRegistry().getExceptions(); + if ( !exceptions.empty() ) { + m_startupExceptions = true; + Colour colourGuard( Colour::Red ); + Catch::cerr() << "Errors occurred during startup!" << '\n'; + // iterate over all exceptions and notify user + for ( const auto& ex_ptr : exceptions ) { + try { + std::rethrow_exception(ex_ptr); + } catch ( std::exception const& ex ) { + Catch::cerr() << Column( ex.what() ).indent(2) << '\n'; + } + } + } +#endif + + alreadyInstantiated = true; + m_cli = makeCommandLineParser( m_configData ); + } + Session::~Session() { + Catch::cleanUp(); + } + + void Session::showHelp() const { + Catch::cout() + << "\nCatch v" << libraryVersion() << "\n" + << m_cli << std::endl + << "For more detailed usage please see the project docs\n" << std::endl; + } + void Session::libIdentify() { + Catch::cout() + << std::left << std::setw(16) << "description: " << "A Catch test executable\n" + << std::left << std::setw(16) << "category: " << "testframework\n" + << std::left << std::setw(16) << "framework: " << "Catch Test\n" + << std::left << std::setw(16) << "version: " << libraryVersion() << std::endl; + } + + int Session::applyCommandLine( int argc, char const * const * argv ) { + if( m_startupExceptions ) + return 1; + + auto result = m_cli.parse( clara::Args( argc, argv ) ); + if( !result ) { + config(); + getCurrentMutableContext().setConfig(m_config); + Catch::cerr() + << Colour( Colour::Red ) + << "\nError(s) in input:\n" + << Column( result.errorMessage() ).indent( 2 ) + << "\n\n"; + Catch::cerr() << "Run with -? for usage\n" << std::endl; + return MaxExitCode; + } + + if( m_configData.showHelp ) + showHelp(); + if( m_configData.libIdentify ) + libIdentify(); + m_config.reset(); + return 0; + } + +#if defined(CATCH_CONFIG_WCHAR) && defined(WIN32) && defined(UNICODE) + int Session::applyCommandLine( int argc, wchar_t const * const * argv ) { + + char **utf8Argv = new char *[ argc ]; + + for ( int i = 0; i < argc; ++i ) { + int bufSize = WideCharToMultiByte( CP_UTF8, 0, argv[i], -1, NULL, 0, NULL, NULL ); + + utf8Argv[ i ] = new char[ bufSize ]; + + WideCharToMultiByte( CP_UTF8, 0, argv[i], -1, utf8Argv[i], bufSize, NULL, NULL ); + } + + int returnCode = applyCommandLine( argc, utf8Argv ); + + for ( int i = 0; i < argc; ++i ) + delete [] utf8Argv[ i ]; + + delete [] utf8Argv; + + return returnCode; + } +#endif + + void Session::useConfigData( ConfigData const& configData ) { + m_configData = configData; + m_config.reset(); + } + + int Session::run() { + if( ( m_configData.waitForKeypress & WaitForKeypress::BeforeStart ) != 0 ) { + Catch::cout() << "...waiting for enter/ return before starting" << std::endl; + static_cast(std::getchar()); + } + int exitCode = runInternal(); + if( ( m_configData.waitForKeypress & WaitForKeypress::BeforeExit ) != 0 ) { + Catch::cout() << "...waiting for enter/ return before exiting, with code: " << exitCode << std::endl; + static_cast(std::getchar()); + } + return exitCode; + } + + clara::Parser const& Session::cli() const { + return m_cli; + } + void Session::cli( clara::Parser const& newParser ) { + m_cli = newParser; + } + ConfigData& Session::configData() { + return m_configData; + } + Config& Session::config() { + if( !m_config ) + m_config = std::make_shared( m_configData ); + return *m_config; + } + + int Session::runInternal() { + if( m_startupExceptions ) + return 1; + + if (m_configData.showHelp || m_configData.libIdentify) { + return 0; + } + + CATCH_TRY { + config(); // Force config to be constructed + + seedRng( *m_config ); + + if( m_configData.filenamesAsTags ) + applyFilenamesAsTags( *m_config ); + + // Handle list request + if( Option listed = list( m_config ) ) + return static_cast( *listed ); + + auto totals = runTests( m_config ); + // Note that on unices only the lower 8 bits are usually used, clamping + // the return value to 255 prevents false negative when some multiple + // of 256 tests has failed + return (std::min) (MaxExitCode, (std::max) (totals.error, static_cast(totals.assertions.failed))); + } +#if !defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) + catch( std::exception& ex ) { + Catch::cerr() << ex.what() << std::endl; + return MaxExitCode; + } +#endif + } + +} // end namespace Catch +// end catch_session.cpp +// start catch_singletons.cpp + +#include + +namespace Catch { + + namespace { + static auto getSingletons() -> std::vector*& { + static std::vector* g_singletons = nullptr; + if( !g_singletons ) + g_singletons = new std::vector(); + return g_singletons; + } + } + + ISingleton::~ISingleton() {} + + void addSingleton(ISingleton* singleton ) { + getSingletons()->push_back( singleton ); + } + void cleanupSingletons() { + auto& singletons = getSingletons(); + for( auto singleton : *singletons ) + delete singleton; + delete singletons; + singletons = nullptr; + } + +} // namespace Catch +// end catch_singletons.cpp +// start catch_startup_exception_registry.cpp + +namespace Catch { +void StartupExceptionRegistry::add( std::exception_ptr const& exception ) noexcept { + CATCH_TRY { + m_exceptions.push_back(exception); + } CATCH_CATCH_ALL { + // If we run out of memory during start-up there's really not a lot more we can do about it + std::terminate(); + } + } + + std::vector const& StartupExceptionRegistry::getExceptions() const noexcept { + return m_exceptions; + } + +} // end namespace Catch +// end catch_startup_exception_registry.cpp +// start catch_stream.cpp + +#include +#include +#include +#include +#include +#include + +namespace Catch { + + Catch::IStream::~IStream() = default; + + namespace detail { namespace { + template + class StreamBufImpl : public std::streambuf { + char data[bufferSize]; + WriterF m_writer; + + public: + StreamBufImpl() { + setp( data, data + sizeof(data) ); + } + + ~StreamBufImpl() noexcept { + StreamBufImpl::sync(); + } + + private: + int overflow( int c ) override { + sync(); + + if( c != EOF ) { + if( pbase() == epptr() ) + m_writer( std::string( 1, static_cast( c ) ) ); + else + sputc( static_cast( c ) ); + } + return 0; + } + + int sync() override { + if( pbase() != pptr() ) { + m_writer( std::string( pbase(), static_cast( pptr() - pbase() ) ) ); + setp( pbase(), epptr() ); + } + return 0; + } + }; + + /////////////////////////////////////////////////////////////////////////// + + struct OutputDebugWriter { + + void operator()( std::string const&str ) { + writeToDebugConsole( str ); + } + }; + + /////////////////////////////////////////////////////////////////////////// + + class FileStream : public IStream { + mutable std::ofstream m_ofs; + public: + FileStream( StringRef filename ) { + m_ofs.open( filename.c_str() ); + CATCH_ENFORCE( !m_ofs.fail(), "Unable to open file: '" << filename << "'" ); + } + ~FileStream() override = default; + public: // IStream + std::ostream& stream() const override { + return m_ofs; + } + }; + + /////////////////////////////////////////////////////////////////////////// + + class CoutStream : public IStream { + mutable std::ostream m_os; + public: + // Store the streambuf from cout up-front because + // cout may get redirected when running tests + CoutStream() : m_os( Catch::cout().rdbuf() ) {} + ~CoutStream() override = default; + + public: // IStream + std::ostream& stream() const override { return m_os; } + }; + + /////////////////////////////////////////////////////////////////////////// + + class DebugOutStream : public IStream { + std::unique_ptr> m_streamBuf; + mutable std::ostream m_os; + public: + DebugOutStream() + : m_streamBuf( new StreamBufImpl() ), + m_os( m_streamBuf.get() ) + {} + + ~DebugOutStream() override = default; + + public: // IStream + std::ostream& stream() const override { return m_os; } + }; + + }} // namespace anon::detail + + /////////////////////////////////////////////////////////////////////////// + + auto makeStream( StringRef const &filename ) -> IStream const* { + if( filename.empty() ) + return new detail::CoutStream(); + else if( filename[0] == '%' ) { + if( filename == "%debug" ) + return new detail::DebugOutStream(); + else + CATCH_ERROR( "Unrecognised stream: '" << filename << "'" ); + } + else + return new detail::FileStream( filename ); + } + + // This class encapsulates the idea of a pool of ostringstreams that can be reused. + struct StringStreams { + std::vector> m_streams; + std::vector m_unused; + std::ostringstream m_referenceStream; // Used for copy state/ flags from + + auto add() -> std::size_t { + if( m_unused.empty() ) { + m_streams.push_back( std::unique_ptr( new std::ostringstream ) ); + return m_streams.size()-1; + } + else { + auto index = m_unused.back(); + m_unused.pop_back(); + return index; + } + } + + void release( std::size_t index ) { + m_streams[index]->copyfmt( m_referenceStream ); // Restore initial flags and other state + m_unused.push_back(index); + } + }; + + ReusableStringStream::ReusableStringStream() + : m_index( Singleton::getMutable().add() ), + m_oss( Singleton::getMutable().m_streams[m_index].get() ) + {} + + ReusableStringStream::~ReusableStringStream() { + static_cast( m_oss )->str(""); + m_oss->clear(); + Singleton::getMutable().release( m_index ); + } + + auto ReusableStringStream::str() const -> std::string { + return static_cast( m_oss )->str(); + } + + /////////////////////////////////////////////////////////////////////////// + +#ifndef CATCH_CONFIG_NOSTDOUT // If you #define this you must implement these functions + std::ostream& cout() { return std::cout; } + std::ostream& cerr() { return std::cerr; } + std::ostream& clog() { return std::clog; } +#endif +} +// end catch_stream.cpp +// start catch_string_manip.cpp + +#include +#include +#include +#include + +namespace Catch { + + namespace { + char toLowerCh(char c) { + return static_cast( std::tolower( c ) ); + } + } + + bool startsWith( std::string const& s, std::string const& prefix ) { + return s.size() >= prefix.size() && std::equal(prefix.begin(), prefix.end(), s.begin()); + } + bool startsWith( std::string const& s, char prefix ) { + return !s.empty() && s[0] == prefix; + } + bool endsWith( std::string const& s, std::string const& suffix ) { + return s.size() >= suffix.size() && std::equal(suffix.rbegin(), suffix.rend(), s.rbegin()); + } + bool endsWith( std::string const& s, char suffix ) { + return !s.empty() && s[s.size()-1] == suffix; + } + bool contains( std::string const& s, std::string const& infix ) { + return s.find( infix ) != std::string::npos; + } + void toLowerInPlace( std::string& s ) { + std::transform( s.begin(), s.end(), s.begin(), toLowerCh ); + } + std::string toLower( std::string const& s ) { + std::string lc = s; + toLowerInPlace( lc ); + return lc; + } + std::string trim( std::string const& str ) { + static char const* whitespaceChars = "\n\r\t "; + std::string::size_type start = str.find_first_not_of( whitespaceChars ); + std::string::size_type end = str.find_last_not_of( whitespaceChars ); + + return start != std::string::npos ? str.substr( start, 1+end-start ) : std::string(); + } + + bool replaceInPlace( std::string& str, std::string const& replaceThis, std::string const& withThis ) { + bool replaced = false; + std::size_t i = str.find( replaceThis ); + while( i != std::string::npos ) { + replaced = true; + str = str.substr( 0, i ) + withThis + str.substr( i+replaceThis.size() ); + if( i < str.size()-withThis.size() ) + i = str.find( replaceThis, i+withThis.size() ); + else + i = std::string::npos; + } + return replaced; + } + + pluralise::pluralise( std::size_t count, std::string const& label ) + : m_count( count ), + m_label( label ) + {} + + std::ostream& operator << ( std::ostream& os, pluralise const& pluraliser ) { + os << pluraliser.m_count << ' ' << pluraliser.m_label; + if( pluraliser.m_count != 1 ) + os << 's'; + return os; + } + +} +// end catch_string_manip.cpp +// start catch_stringref.cpp + +#if defined(__clang__) +# pragma clang diagnostic push +# pragma clang diagnostic ignored "-Wexit-time-destructors" +#endif + +#include +#include +#include + +namespace { + const uint32_t byte_2_lead = 0xC0; + const uint32_t byte_3_lead = 0xE0; + const uint32_t byte_4_lead = 0xF0; +} + +namespace Catch { + StringRef::StringRef( char const* rawChars ) noexcept + : StringRef( rawChars, static_cast(std::strlen(rawChars) ) ) + {} + + StringRef::operator std::string() const { + return std::string( m_start, m_size ); + } + + void StringRef::swap( StringRef& other ) noexcept { + std::swap( m_start, other.m_start ); + std::swap( m_size, other.m_size ); + std::swap( m_data, other.m_data ); + } + + auto StringRef::c_str() const -> char const* { + if( isSubstring() ) + const_cast( this )->takeOwnership(); + return m_start; + } + auto StringRef::currentData() const noexcept -> char const* { + return m_start; + } + + auto StringRef::isOwned() const noexcept -> bool { + return m_data != nullptr; + } + auto StringRef::isSubstring() const noexcept -> bool { + return m_start[m_size] != '\0'; + } + + void StringRef::takeOwnership() { + if( !isOwned() ) { + m_data = new char[m_size+1]; + memcpy( m_data, m_start, m_size ); + m_data[m_size] = '\0'; + m_start = m_data; + } + } + auto StringRef::substr( size_type start, size_type size ) const noexcept -> StringRef { + if( start < m_size ) + return StringRef( m_start+start, size ); + else + return StringRef(); + } + auto StringRef::operator == ( StringRef const& other ) const noexcept -> bool { + return + size() == other.size() && + (std::strncmp( m_start, other.m_start, size() ) == 0); + } + auto StringRef::operator != ( StringRef const& other ) const noexcept -> bool { + return !operator==( other ); + } + + auto StringRef::operator[](size_type index) const noexcept -> char { + return m_start[index]; + } + + auto StringRef::numberOfCharacters() const noexcept -> size_type { + size_type noChars = m_size; + // Make adjustments for uft encodings + for( size_type i=0; i < m_size; ++i ) { + char c = m_start[i]; + if( ( c & byte_2_lead ) == byte_2_lead ) { + noChars--; + if (( c & byte_3_lead ) == byte_3_lead ) + noChars--; + if( ( c & byte_4_lead ) == byte_4_lead ) + noChars--; + } + } + return noChars; + } + + auto operator + ( StringRef const& lhs, StringRef const& rhs ) -> std::string { + std::string str; + str.reserve( lhs.size() + rhs.size() ); + str += lhs; + str += rhs; + return str; + } + auto operator + ( StringRef const& lhs, const char* rhs ) -> std::string { + return std::string( lhs ) + std::string( rhs ); + } + auto operator + ( char const* lhs, StringRef const& rhs ) -> std::string { + return std::string( lhs ) + std::string( rhs ); + } + + auto operator << ( std::ostream& os, StringRef const& str ) -> std::ostream& { + return os.write(str.currentData(), str.size()); + } + + auto operator+=( std::string& lhs, StringRef const& rhs ) -> std::string& { + lhs.append(rhs.currentData(), rhs.size()); + return lhs; + } + +} // namespace Catch + +#if defined(__clang__) +# pragma clang diagnostic pop +#endif +// end catch_stringref.cpp +// start catch_tag_alias.cpp + +namespace Catch { + TagAlias::TagAlias(std::string const & _tag, SourceLineInfo _lineInfo): tag(_tag), lineInfo(_lineInfo) {} +} +// end catch_tag_alias.cpp +// start catch_tag_alias_autoregistrar.cpp + +namespace Catch { + + RegistrarForTagAliases::RegistrarForTagAliases(char const* alias, char const* tag, SourceLineInfo const& lineInfo) { + CATCH_TRY { + getMutableRegistryHub().registerTagAlias(alias, tag, lineInfo); + } CATCH_CATCH_ALL { + // Do not throw when constructing global objects, instead register the exception to be processed later + getMutableRegistryHub().registerStartupException(); + } + } + +} +// end catch_tag_alias_autoregistrar.cpp +// start catch_tag_alias_registry.cpp + +#include + +namespace Catch { + + TagAliasRegistry::~TagAliasRegistry() {} + + TagAlias const* TagAliasRegistry::find( std::string const& alias ) const { + auto it = m_registry.find( alias ); + if( it != m_registry.end() ) + return &(it->second); + else + return nullptr; + } + + std::string TagAliasRegistry::expandAliases( std::string const& unexpandedTestSpec ) const { + std::string expandedTestSpec = unexpandedTestSpec; + for( auto const& registryKvp : m_registry ) { + std::size_t pos = expandedTestSpec.find( registryKvp.first ); + if( pos != std::string::npos ) { + expandedTestSpec = expandedTestSpec.substr( 0, pos ) + + registryKvp.second.tag + + expandedTestSpec.substr( pos + registryKvp.first.size() ); + } + } + return expandedTestSpec; + } + + void TagAliasRegistry::add( std::string const& alias, std::string const& tag, SourceLineInfo const& lineInfo ) { + CATCH_ENFORCE( startsWith(alias, "[@") && endsWith(alias, ']'), + "error: tag alias, '" << alias << "' is not of the form [@alias name].\n" << lineInfo ); + + CATCH_ENFORCE( m_registry.insert(std::make_pair(alias, TagAlias(tag, lineInfo))).second, + "error: tag alias, '" << alias << "' already registered.\n" + << "\tFirst seen at: " << find(alias)->lineInfo << "\n" + << "\tRedefined at: " << lineInfo ); + } + + ITagAliasRegistry::~ITagAliasRegistry() {} + + ITagAliasRegistry const& ITagAliasRegistry::get() { + return getRegistryHub().getTagAliasRegistry(); + } + +} // end namespace Catch +// end catch_tag_alias_registry.cpp +// start catch_test_case_info.cpp + +#include +#include +#include +#include + +namespace Catch { + + namespace { + TestCaseInfo::SpecialProperties parseSpecialTag( std::string const& tag ) { + if( startsWith( tag, '.' ) || + tag == "!hide" ) + return TestCaseInfo::IsHidden; + else if( tag == "!throws" ) + return TestCaseInfo::Throws; + else if( tag == "!shouldfail" ) + return TestCaseInfo::ShouldFail; + else if( tag == "!mayfail" ) + return TestCaseInfo::MayFail; + else if( tag == "!nonportable" ) + return TestCaseInfo::NonPortable; + else if( tag == "!benchmark" ) + return static_cast( TestCaseInfo::Benchmark | TestCaseInfo::IsHidden ); + else + return TestCaseInfo::None; + } + bool isReservedTag( std::string const& tag ) { + return parseSpecialTag( tag ) == TestCaseInfo::None && tag.size() > 0 && !std::isalnum( static_cast(tag[0]) ); + } + void enforceNotReservedTag( std::string const& tag, SourceLineInfo const& _lineInfo ) { + CATCH_ENFORCE( !isReservedTag(tag), + "Tag name: [" << tag << "] is not allowed.\n" + << "Tag names starting with non alpha-numeric characters are reserved\n" + << _lineInfo ); + } + } + + TestCase makeTestCase( ITestInvoker* _testCase, + std::string const& _className, + NameAndTags const& nameAndTags, + SourceLineInfo const& _lineInfo ) + { + bool isHidden = false; + + // Parse out tags + std::vector tags; + std::string desc, tag; + bool inTag = false; + std::string _descOrTags = nameAndTags.tags; + for (char c : _descOrTags) { + if( !inTag ) { + if( c == '[' ) + inTag = true; + else + desc += c; + } + else { + if( c == ']' ) { + TestCaseInfo::SpecialProperties prop = parseSpecialTag( tag ); + if( ( prop & TestCaseInfo::IsHidden ) != 0 ) + isHidden = true; + else if( prop == TestCaseInfo::None ) + enforceNotReservedTag( tag, _lineInfo ); + + tags.push_back( tag ); + tag.clear(); + inTag = false; + } + else + tag += c; + } + } + if( isHidden ) { + tags.push_back( "." ); + } + + TestCaseInfo info( nameAndTags.name, _className, desc, tags, _lineInfo ); + return TestCase( _testCase, std::move(info) ); + } + + void setTags( TestCaseInfo& testCaseInfo, std::vector tags ) { + std::sort(begin(tags), end(tags)); + tags.erase(std::unique(begin(tags), end(tags)), end(tags)); + testCaseInfo.lcaseTags.clear(); + + for( auto const& tag : tags ) { + std::string lcaseTag = toLower( tag ); + testCaseInfo.properties = static_cast( testCaseInfo.properties | parseSpecialTag( lcaseTag ) ); + testCaseInfo.lcaseTags.push_back( lcaseTag ); + } + testCaseInfo.tags = std::move(tags); + } + + TestCaseInfo::TestCaseInfo( std::string const& _name, + std::string const& _className, + std::string const& _description, + std::vector const& _tags, + SourceLineInfo const& _lineInfo ) + : name( _name ), + className( _className ), + description( _description ), + lineInfo( _lineInfo ), + properties( None ) + { + setTags( *this, _tags ); + } + + bool TestCaseInfo::isHidden() const { + return ( properties & IsHidden ) != 0; + } + bool TestCaseInfo::throws() const { + return ( properties & Throws ) != 0; + } + bool TestCaseInfo::okToFail() const { + return ( properties & (ShouldFail | MayFail ) ) != 0; + } + bool TestCaseInfo::expectedToFail() const { + return ( properties & (ShouldFail ) ) != 0; + } + + std::string TestCaseInfo::tagsAsString() const { + std::string ret; + // '[' and ']' per tag + std::size_t full_size = 2 * tags.size(); + for (const auto& tag : tags) { + full_size += tag.size(); + } + ret.reserve(full_size); + for (const auto& tag : tags) { + ret.push_back('['); + ret.append(tag); + ret.push_back(']'); + } + + return ret; + } + + TestCase::TestCase( ITestInvoker* testCase, TestCaseInfo&& info ) : TestCaseInfo( std::move(info) ), test( testCase ) {} + + TestCase TestCase::withName( std::string const& _newName ) const { + TestCase other( *this ); + other.name = _newName; + return other; + } + + void TestCase::invoke() const { + test->invoke(); + } + + bool TestCase::operator == ( TestCase const& other ) const { + return test.get() == other.test.get() && + name == other.name && + className == other.className; + } + + bool TestCase::operator < ( TestCase const& other ) const { + return name < other.name; + } + + TestCaseInfo const& TestCase::getTestCaseInfo() const + { + return *this; + } + +} // end namespace Catch +// end catch_test_case_info.cpp +// start catch_test_case_registry_impl.cpp + +#include + +namespace Catch { + + std::vector sortTests( IConfig const& config, std::vector const& unsortedTestCases ) { + + std::vector sorted = unsortedTestCases; + + switch( config.runOrder() ) { + case RunTests::InLexicographicalOrder: + std::sort( sorted.begin(), sorted.end() ); + break; + case RunTests::InRandomOrder: + seedRng( config ); + std::shuffle( sorted.begin(), sorted.end(), rng() ); + break; + case RunTests::InDeclarationOrder: + // already in declaration order + break; + } + return sorted; + } + bool matchTest( TestCase const& testCase, TestSpec const& testSpec, IConfig const& config ) { + return testSpec.matches( testCase ) && ( config.allowThrows() || !testCase.throws() ); + } + + void enforceNoDuplicateTestCases( std::vector const& functions ) { + std::set seenFunctions; + for( auto const& function : functions ) { + auto prev = seenFunctions.insert( function ); + CATCH_ENFORCE( prev.second, + "error: TEST_CASE( \"" << function.name << "\" ) already defined.\n" + << "\tFirst seen at " << prev.first->getTestCaseInfo().lineInfo << "\n" + << "\tRedefined at " << function.getTestCaseInfo().lineInfo ); + } + } + + std::vector filterTests( std::vector const& testCases, TestSpec const& testSpec, IConfig const& config ) { + std::vector filtered; + filtered.reserve( testCases.size() ); + for( auto const& testCase : testCases ) + if( matchTest( testCase, testSpec, config ) ) + filtered.push_back( testCase ); + return filtered; + } + std::vector const& getAllTestCasesSorted( IConfig const& config ) { + return getRegistryHub().getTestCaseRegistry().getAllTestsSorted( config ); + } + + void TestRegistry::registerTest( TestCase const& testCase ) { + std::string name = testCase.getTestCaseInfo().name; + if( name.empty() ) { + ReusableStringStream rss; + rss << "Anonymous test case " << ++m_unnamedCount; + return registerTest( testCase.withName( rss.str() ) ); + } + m_functions.push_back( testCase ); + } + + std::vector const& TestRegistry::getAllTests() const { + return m_functions; + } + std::vector const& TestRegistry::getAllTestsSorted( IConfig const& config ) const { + if( m_sortedFunctions.empty() ) + enforceNoDuplicateTestCases( m_functions ); + + if( m_currentSortOrder != config.runOrder() || m_sortedFunctions.empty() ) { + m_sortedFunctions = sortTests( config, m_functions ); + m_currentSortOrder = config.runOrder(); + } + return m_sortedFunctions; + } + + /////////////////////////////////////////////////////////////////////////// + TestInvokerAsFunction::TestInvokerAsFunction( void(*testAsFunction)() ) noexcept : m_testAsFunction( testAsFunction ) {} + + void TestInvokerAsFunction::invoke() const { + m_testAsFunction(); + } + + std::string extractClassName( StringRef const& classOrQualifiedMethodName ) { + std::string className = classOrQualifiedMethodName; + if( startsWith( className, '&' ) ) + { + std::size_t lastColons = className.rfind( "::" ); + std::size_t penultimateColons = className.rfind( "::", lastColons-1 ); + if( penultimateColons == std::string::npos ) + penultimateColons = 1; + className = className.substr( penultimateColons, lastColons-penultimateColons ); + } + return className; + } + +} // end namespace Catch +// end catch_test_case_registry_impl.cpp +// start catch_test_case_tracker.cpp + +#include +#include +#include +#include +#include + +#if defined(__clang__) +# pragma clang diagnostic push +# pragma clang diagnostic ignored "-Wexit-time-destructors" +#endif + +namespace Catch { +namespace TestCaseTracking { + + NameAndLocation::NameAndLocation( std::string const& _name, SourceLineInfo const& _location ) + : name( _name ), + location( _location ) + {} + + ITracker::~ITracker() = default; + + TrackerContext& TrackerContext::instance() { + static TrackerContext s_instance; + return s_instance; + } + + ITracker& TrackerContext::startRun() { + m_rootTracker = std::make_shared( NameAndLocation( "{root}", CATCH_INTERNAL_LINEINFO ), *this, nullptr ); + m_currentTracker = nullptr; + m_runState = Executing; + return *m_rootTracker; + } + + void TrackerContext::endRun() { + m_rootTracker.reset(); + m_currentTracker = nullptr; + m_runState = NotStarted; + } + + void TrackerContext::startCycle() { + m_currentTracker = m_rootTracker.get(); + m_runState = Executing; + } + void TrackerContext::completeCycle() { + m_runState = CompletedCycle; + } + + bool TrackerContext::completedCycle() const { + return m_runState == CompletedCycle; + } + ITracker& TrackerContext::currentTracker() { + return *m_currentTracker; + } + void TrackerContext::setCurrentTracker( ITracker* tracker ) { + m_currentTracker = tracker; + } + + TrackerBase::TrackerBase( NameAndLocation const& nameAndLocation, TrackerContext& ctx, ITracker* parent ) + : m_nameAndLocation( nameAndLocation ), + m_ctx( ctx ), + m_parent( parent ) + {} + + NameAndLocation const& TrackerBase::nameAndLocation() const { + return m_nameAndLocation; + } + bool TrackerBase::isComplete() const { + return m_runState == CompletedSuccessfully || m_runState == Failed; + } + bool TrackerBase::isSuccessfullyCompleted() const { + return m_runState == CompletedSuccessfully; + } + bool TrackerBase::isOpen() const { + return m_runState != NotStarted && !isComplete(); + } + bool TrackerBase::hasChildren() const { + return !m_children.empty(); + } + + void TrackerBase::addChild( ITrackerPtr const& child ) { + m_children.push_back( child ); + } + + ITrackerPtr TrackerBase::findChild( NameAndLocation const& nameAndLocation ) { + auto it = std::find_if( m_children.begin(), m_children.end(), + [&nameAndLocation]( ITrackerPtr const& tracker ){ + return + tracker->nameAndLocation().location == nameAndLocation.location && + tracker->nameAndLocation().name == nameAndLocation.name; + } ); + return( it != m_children.end() ) + ? *it + : nullptr; + } + ITracker& TrackerBase::parent() { + assert( m_parent ); // Should always be non-null except for root + return *m_parent; + } + + void TrackerBase::openChild() { + if( m_runState != ExecutingChildren ) { + m_runState = ExecutingChildren; + if( m_parent ) + m_parent->openChild(); + } + } + + bool TrackerBase::isSectionTracker() const { return false; } + bool TrackerBase::isGeneratorTracker() const { return false; } + + void TrackerBase::open() { + m_runState = Executing; + moveToThis(); + if( m_parent ) + m_parent->openChild(); + } + + void TrackerBase::close() { + + // Close any still open children (e.g. generators) + while( &m_ctx.currentTracker() != this ) + m_ctx.currentTracker().close(); + + switch( m_runState ) { + case NeedsAnotherRun: + break; + + case Executing: + m_runState = CompletedSuccessfully; + break; + case ExecutingChildren: + if( m_children.empty() || m_children.back()->isComplete() ) + m_runState = CompletedSuccessfully; + break; + + case NotStarted: + case CompletedSuccessfully: + case Failed: + CATCH_INTERNAL_ERROR( "Illogical state: " << m_runState ); + + default: + CATCH_INTERNAL_ERROR( "Unknown state: " << m_runState ); + } + moveToParent(); + m_ctx.completeCycle(); + } + void TrackerBase::fail() { + m_runState = Failed; + if( m_parent ) + m_parent->markAsNeedingAnotherRun(); + moveToParent(); + m_ctx.completeCycle(); + } + void TrackerBase::markAsNeedingAnotherRun() { + m_runState = NeedsAnotherRun; + } + + void TrackerBase::moveToParent() { + assert( m_parent ); + m_ctx.setCurrentTracker( m_parent ); + } + void TrackerBase::moveToThis() { + m_ctx.setCurrentTracker( this ); + } + + SectionTracker::SectionTracker( NameAndLocation const& nameAndLocation, TrackerContext& ctx, ITracker* parent ) + : TrackerBase( nameAndLocation, ctx, parent ) + { + if( parent ) { + while( !parent->isSectionTracker() ) + parent = &parent->parent(); + + SectionTracker& parentSection = static_cast( *parent ); + addNextFilters( parentSection.m_filters ); + } + } + + bool SectionTracker::isComplete() const { + bool complete = true; + + if ((m_filters.empty() || m_filters[0] == "") || + std::find(m_filters.begin(), m_filters.end(), + m_nameAndLocation.name) != m_filters.end()) + complete = TrackerBase::isComplete(); + return complete; + + } + + bool SectionTracker::isSectionTracker() const { return true; } + + SectionTracker& SectionTracker::acquire( TrackerContext& ctx, NameAndLocation const& nameAndLocation ) { + std::shared_ptr section; + + ITracker& currentTracker = ctx.currentTracker(); + if( ITrackerPtr childTracker = currentTracker.findChild( nameAndLocation ) ) { + assert( childTracker ); + assert( childTracker->isSectionTracker() ); + section = std::static_pointer_cast( childTracker ); + } + else { + section = std::make_shared( nameAndLocation, ctx, ¤tTracker ); + currentTracker.addChild( section ); + } + if( !ctx.completedCycle() ) + section->tryOpen(); + return *section; + } + + void SectionTracker::tryOpen() { + if( !isComplete() && (m_filters.empty() || m_filters[0].empty() || m_filters[0] == m_nameAndLocation.name ) ) + open(); + } + + void SectionTracker::addInitialFilters( std::vector const& filters ) { + if( !filters.empty() ) { + m_filters.push_back(""); // Root - should never be consulted + m_filters.push_back(""); // Test Case - not a section filter + m_filters.insert( m_filters.end(), filters.begin(), filters.end() ); + } + } + void SectionTracker::addNextFilters( std::vector const& filters ) { + if( filters.size() > 1 ) + m_filters.insert( m_filters.end(), ++filters.begin(), filters.end() ); + } + +} // namespace TestCaseTracking + +using TestCaseTracking::ITracker; +using TestCaseTracking::TrackerContext; +using TestCaseTracking::SectionTracker; + +} // namespace Catch + +#if defined(__clang__) +# pragma clang diagnostic pop +#endif +// end catch_test_case_tracker.cpp +// start catch_test_registry.cpp + +namespace Catch { + + auto makeTestInvoker( void(*testAsFunction)() ) noexcept -> ITestInvoker* { + return new(std::nothrow) TestInvokerAsFunction( testAsFunction ); + } + + NameAndTags::NameAndTags( StringRef const& name_ , StringRef const& tags_ ) noexcept : name( name_ ), tags( tags_ ) {} + + AutoReg::AutoReg( ITestInvoker* invoker, SourceLineInfo const& lineInfo, StringRef const& classOrMethod, NameAndTags const& nameAndTags ) noexcept { + CATCH_TRY { + getMutableRegistryHub() + .registerTest( + makeTestCase( + invoker, + extractClassName( classOrMethod ), + nameAndTags, + lineInfo)); + } CATCH_CATCH_ALL { + // Do not throw when constructing global objects, instead register the exception to be processed later + getMutableRegistryHub().registerStartupException(); + } + } + + AutoReg::~AutoReg() = default; +} +// end catch_test_registry.cpp +// start catch_test_spec.cpp + +#include +#include +#include +#include + +namespace Catch { + + TestSpec::Pattern::~Pattern() = default; + TestSpec::NamePattern::~NamePattern() = default; + TestSpec::TagPattern::~TagPattern() = default; + TestSpec::ExcludedPattern::~ExcludedPattern() = default; + + TestSpec::NamePattern::NamePattern( std::string const& name ) + : m_wildcardPattern( toLower( name ), CaseSensitive::No ) + {} + bool TestSpec::NamePattern::matches( TestCaseInfo const& testCase ) const { + return m_wildcardPattern.matches( toLower( testCase.name ) ); + } + + TestSpec::TagPattern::TagPattern( std::string const& tag ) : m_tag( toLower( tag ) ) {} + bool TestSpec::TagPattern::matches( TestCaseInfo const& testCase ) const { + return std::find(begin(testCase.lcaseTags), + end(testCase.lcaseTags), + m_tag) != end(testCase.lcaseTags); + } + + TestSpec::ExcludedPattern::ExcludedPattern( PatternPtr const& underlyingPattern ) : m_underlyingPattern( underlyingPattern ) {} + bool TestSpec::ExcludedPattern::matches( TestCaseInfo const& testCase ) const { return !m_underlyingPattern->matches( testCase ); } + + bool TestSpec::Filter::matches( TestCaseInfo const& testCase ) const { + // All patterns in a filter must match for the filter to be a match + for( auto const& pattern : m_patterns ) { + if( !pattern->matches( testCase ) ) + return false; + } + return true; + } + + bool TestSpec::hasFilters() const { + return !m_filters.empty(); + } + bool TestSpec::matches( TestCaseInfo const& testCase ) const { + // A TestSpec matches if any filter matches + for( auto const& filter : m_filters ) + if( filter.matches( testCase ) ) + return true; + return false; + } +} +// end catch_test_spec.cpp +// start catch_test_spec_parser.cpp + +namespace Catch { + + TestSpecParser::TestSpecParser( ITagAliasRegistry const& tagAliases ) : m_tagAliases( &tagAliases ) {} + + TestSpecParser& TestSpecParser::parse( std::string const& arg ) { + m_mode = None; + m_exclusion = false; + m_start = std::string::npos; + m_arg = m_tagAliases->expandAliases( arg ); + m_escapeChars.clear(); + for( m_pos = 0; m_pos < m_arg.size(); ++m_pos ) + visitChar( m_arg[m_pos] ); + if( m_mode == Name ) + addPattern(); + return *this; + } + TestSpec TestSpecParser::testSpec() { + addFilter(); + return m_testSpec; + } + + void TestSpecParser::visitChar( char c ) { + if( m_mode == None ) { + switch( c ) { + case ' ': return; + case '~': m_exclusion = true; return; + case '[': return startNewMode( Tag, ++m_pos ); + case '"': return startNewMode( QuotedName, ++m_pos ); + case '\\': return escape(); + default: startNewMode( Name, m_pos ); break; + } + } + if( m_mode == Name ) { + if( c == ',' ) { + addPattern(); + addFilter(); + } + else if( c == '[' ) { + if( subString() == "exclude:" ) + m_exclusion = true; + else + addPattern(); + startNewMode( Tag, ++m_pos ); + } + else if( c == '\\' ) + escape(); + } + else if( m_mode == EscapedName ) + m_mode = Name; + else if( m_mode == QuotedName && c == '"' ) + addPattern(); + else if( m_mode == Tag && c == ']' ) + addPattern(); + } + void TestSpecParser::startNewMode( Mode mode, std::size_t start ) { + m_mode = mode; + m_start = start; + } + void TestSpecParser::escape() { + if( m_mode == None ) + m_start = m_pos; + m_mode = EscapedName; + m_escapeChars.push_back( m_pos ); + } + std::string TestSpecParser::subString() const { return m_arg.substr( m_start, m_pos - m_start ); } + + void TestSpecParser::addFilter() { + if( !m_currentFilter.m_patterns.empty() ) { + m_testSpec.m_filters.push_back( m_currentFilter ); + m_currentFilter = TestSpec::Filter(); + } + } + + TestSpec parseTestSpec( std::string const& arg ) { + return TestSpecParser( ITagAliasRegistry::get() ).parse( arg ).testSpec(); + } + +} // namespace Catch +// end catch_test_spec_parser.cpp +// start catch_timer.cpp + +#include + +static const uint64_t nanosecondsInSecond = 1000000000; + +namespace Catch { + + auto getCurrentNanosecondsSinceEpoch() -> uint64_t { + return std::chrono::duration_cast( std::chrono::high_resolution_clock::now().time_since_epoch() ).count(); + } + + namespace { + auto estimateClockResolution() -> uint64_t { + uint64_t sum = 0; + static const uint64_t iterations = 1000000; + + auto startTime = getCurrentNanosecondsSinceEpoch(); + + for( std::size_t i = 0; i < iterations; ++i ) { + + uint64_t ticks; + uint64_t baseTicks = getCurrentNanosecondsSinceEpoch(); + do { + ticks = getCurrentNanosecondsSinceEpoch(); + } while( ticks == baseTicks ); + + auto delta = ticks - baseTicks; + sum += delta; + + // If we have been calibrating for over 3 seconds -- the clock + // is terrible and we should move on. + // TBD: How to signal that the measured resolution is probably wrong? + if (ticks > startTime + 3 * nanosecondsInSecond) { + return sum / ( i + 1u ); + } + } + + // We're just taking the mean, here. To do better we could take the std. dev and exclude outliers + // - and potentially do more iterations if there's a high variance. + return sum/iterations; + } + } + auto getEstimatedClockResolution() -> uint64_t { + static auto s_resolution = estimateClockResolution(); + return s_resolution; + } + + void Timer::start() { + m_nanoseconds = getCurrentNanosecondsSinceEpoch(); + } + auto Timer::getElapsedNanoseconds() const -> uint64_t { + return getCurrentNanosecondsSinceEpoch() - m_nanoseconds; + } + auto Timer::getElapsedMicroseconds() const -> uint64_t { + return getElapsedNanoseconds()/1000; + } + auto Timer::getElapsedMilliseconds() const -> unsigned int { + return static_cast(getElapsedMicroseconds()/1000); + } + auto Timer::getElapsedSeconds() const -> double { + return getElapsedMicroseconds()/1000000.0; + } + +} // namespace Catch +// end catch_timer.cpp +// start catch_tostring.cpp + +#if defined(__clang__) +# pragma clang diagnostic push +# pragma clang diagnostic ignored "-Wexit-time-destructors" +# pragma clang diagnostic ignored "-Wglobal-constructors" +#endif + +// Enable specific decls locally +#if !defined(CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER) +#define CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER +#endif + +#include +#include + +namespace Catch { + +namespace Detail { + + const std::string unprintableString = "{?}"; + + namespace { + const int hexThreshold = 255; + + struct Endianness { + enum Arch { Big, Little }; + + static Arch which() { + union _{ + int asInt; + char asChar[sizeof (int)]; + } u; + + u.asInt = 1; + return ( u.asChar[sizeof(int)-1] == 1 ) ? Big : Little; + } + }; + } + + std::string rawMemoryToString( const void *object, std::size_t size ) { + // Reverse order for little endian architectures + int i = 0, end = static_cast( size ), inc = 1; + if( Endianness::which() == Endianness::Little ) { + i = end-1; + end = inc = -1; + } + + unsigned char const *bytes = static_cast(object); + ReusableStringStream rss; + rss << "0x" << std::setfill('0') << std::hex; + for( ; i != end; i += inc ) + rss << std::setw(2) << static_cast(bytes[i]); + return rss.str(); + } +} + +template +std::string fpToString( T value, int precision ) { + if (Catch::isnan(value)) { + return "nan"; + } + + ReusableStringStream rss; + rss << std::setprecision( precision ) + << std::fixed + << value; + std::string d = rss.str(); + std::size_t i = d.find_last_not_of( '0' ); + if( i != std::string::npos && i != d.size()-1 ) { + if( d[i] == '.' ) + i++; + d = d.substr( 0, i+1 ); + } + return d; +} + +//// ======================================================= //// +// +// Out-of-line defs for full specialization of StringMaker +// +//// ======================================================= //// + +std::string StringMaker::convert(const std::string& str) { + if (!getCurrentContext().getConfig()->showInvisibles()) { + return '"' + str + '"'; + } + + std::string s("\""); + for (char c : str) { + switch (c) { + case '\n': + s.append("\\n"); + break; + case '\t': + s.append("\\t"); + break; + default: + s.push_back(c); + break; + } + } + s.append("\""); + return s; +} + +#ifdef CATCH_CONFIG_CPP17_STRING_VIEW +std::string StringMaker::convert(std::string_view str) { + return ::Catch::Detail::stringify(std::string{ str }); +} +#endif + +std::string StringMaker::convert(char const* str) { + if (str) { + return ::Catch::Detail::stringify(std::string{ str }); + } else { + return{ "{null string}" }; + } +} +std::string StringMaker::convert(char* str) { + if (str) { + return ::Catch::Detail::stringify(std::string{ str }); + } else { + return{ "{null string}" }; + } +} + +#ifdef CATCH_CONFIG_WCHAR +std::string StringMaker::convert(const std::wstring& wstr) { + std::string s; + s.reserve(wstr.size()); + for (auto c : wstr) { + s += (c <= 0xff) ? static_cast(c) : '?'; + } + return ::Catch::Detail::stringify(s); +} + +# ifdef CATCH_CONFIG_CPP17_STRING_VIEW +std::string StringMaker::convert(std::wstring_view str) { + return StringMaker::convert(std::wstring(str)); +} +# endif + +std::string StringMaker::convert(wchar_t const * str) { + if (str) { + return ::Catch::Detail::stringify(std::wstring{ str }); + } else { + return{ "{null string}" }; + } +} +std::string StringMaker::convert(wchar_t * str) { + if (str) { + return ::Catch::Detail::stringify(std::wstring{ str }); + } else { + return{ "{null string}" }; + } +} +#endif + +std::string StringMaker::convert(int value) { + return ::Catch::Detail::stringify(static_cast(value)); +} +std::string StringMaker::convert(long value) { + return ::Catch::Detail::stringify(static_cast(value)); +} +std::string StringMaker::convert(long long value) { + ReusableStringStream rss; + rss << value; + if (value > Detail::hexThreshold) { + rss << " (0x" << std::hex << value << ')'; + } + return rss.str(); +} + +std::string StringMaker::convert(unsigned int value) { + return ::Catch::Detail::stringify(static_cast(value)); +} +std::string StringMaker::convert(unsigned long value) { + return ::Catch::Detail::stringify(static_cast(value)); +} +std::string StringMaker::convert(unsigned long long value) { + ReusableStringStream rss; + rss << value; + if (value > Detail::hexThreshold) { + rss << " (0x" << std::hex << value << ')'; + } + return rss.str(); +} + +std::string StringMaker::convert(bool b) { + return b ? "true" : "false"; +} + +std::string StringMaker::convert(signed char value) { + if (value == '\r') { + return "'\\r'"; + } else if (value == '\f') { + return "'\\f'"; + } else if (value == '\n') { + return "'\\n'"; + } else if (value == '\t') { + return "'\\t'"; + } else if ('\0' <= value && value < ' ') { + return ::Catch::Detail::stringify(static_cast(value)); + } else { + char chstr[] = "' '"; + chstr[1] = value; + return chstr; + } +} +std::string StringMaker::convert(char c) { + return ::Catch::Detail::stringify(static_cast(c)); +} +std::string StringMaker::convert(unsigned char c) { + return ::Catch::Detail::stringify(static_cast(c)); +} + +std::string StringMaker::convert(std::nullptr_t) { + return "nullptr"; +} + +std::string StringMaker::convert(float value) { + return fpToString(value, 5) + 'f'; +} +std::string StringMaker::convert(double value) { + return fpToString(value, 10); +} + +std::string ratio_string::symbol() { return "a"; } +std::string ratio_string::symbol() { return "f"; } +std::string ratio_string::symbol() { return "p"; } +std::string ratio_string::symbol() { return "n"; } +std::string ratio_string::symbol() { return "u"; } +std::string ratio_string::symbol() { return "m"; } + +} // end namespace Catch + +#if defined(__clang__) +# pragma clang diagnostic pop +#endif + +// end catch_tostring.cpp +// start catch_totals.cpp + +namespace Catch { + + Counts Counts::operator - ( Counts const& other ) const { + Counts diff; + diff.passed = passed - other.passed; + diff.failed = failed - other.failed; + diff.failedButOk = failedButOk - other.failedButOk; + return diff; + } + + Counts& Counts::operator += ( Counts const& other ) { + passed += other.passed; + failed += other.failed; + failedButOk += other.failedButOk; + return *this; + } + + std::size_t Counts::total() const { + return passed + failed + failedButOk; + } + bool Counts::allPassed() const { + return failed == 0 && failedButOk == 0; + } + bool Counts::allOk() const { + return failed == 0; + } + + Totals Totals::operator - ( Totals const& other ) const { + Totals diff; + diff.assertions = assertions - other.assertions; + diff.testCases = testCases - other.testCases; + return diff; + } + + Totals& Totals::operator += ( Totals const& other ) { + assertions += other.assertions; + testCases += other.testCases; + return *this; + } + + Totals Totals::delta( Totals const& prevTotals ) const { + Totals diff = *this - prevTotals; + if( diff.assertions.failed > 0 ) + ++diff.testCases.failed; + else if( diff.assertions.failedButOk > 0 ) + ++diff.testCases.failedButOk; + else + ++diff.testCases.passed; + return diff; + } + +} +// end catch_totals.cpp +// start catch_uncaught_exceptions.cpp + +#include + +namespace Catch { + bool uncaught_exceptions() { +#if defined(CATCH_CONFIG_CPP17_UNCAUGHT_EXCEPTIONS) + return std::uncaught_exceptions() > 0; +#else + return std::uncaught_exception(); +#endif + } +} // end namespace Catch +// end catch_uncaught_exceptions.cpp +// start catch_version.cpp + +#include + +namespace Catch { + + Version::Version + ( unsigned int _majorVersion, + unsigned int _minorVersion, + unsigned int _patchNumber, + char const * const _branchName, + unsigned int _buildNumber ) + : majorVersion( _majorVersion ), + minorVersion( _minorVersion ), + patchNumber( _patchNumber ), + branchName( _branchName ), + buildNumber( _buildNumber ) + {} + + std::ostream& operator << ( std::ostream& os, Version const& version ) { + os << version.majorVersion << '.' + << version.minorVersion << '.' + << version.patchNumber; + // branchName is never null -> 0th char is \0 if it is empty + if (version.branchName[0]) { + os << '-' << version.branchName + << '.' << version.buildNumber; + } + return os; + } + + Version const& libraryVersion() { + static Version version( 2, 7, 0, "", 0 ); + return version; + } + +} +// end catch_version.cpp +// start catch_wildcard_pattern.cpp + +#include + +namespace Catch { + + WildcardPattern::WildcardPattern( std::string const& pattern, + CaseSensitive::Choice caseSensitivity ) + : m_caseSensitivity( caseSensitivity ), + m_pattern( adjustCase( pattern ) ) + { + if( startsWith( m_pattern, '*' ) ) { + m_pattern = m_pattern.substr( 1 ); + m_wildcard = WildcardAtStart; + } + if( endsWith( m_pattern, '*' ) ) { + m_pattern = m_pattern.substr( 0, m_pattern.size()-1 ); + m_wildcard = static_cast( m_wildcard | WildcardAtEnd ); + } + } + + bool WildcardPattern::matches( std::string const& str ) const { + switch( m_wildcard ) { + case NoWildcard: + return m_pattern == adjustCase( str ); + case WildcardAtStart: + return endsWith( adjustCase( str ), m_pattern ); + case WildcardAtEnd: + return startsWith( adjustCase( str ), m_pattern ); + case WildcardAtBothEnds: + return contains( adjustCase( str ), m_pattern ); + default: + CATCH_INTERNAL_ERROR( "Unknown enum" ); + } + } + + std::string WildcardPattern::adjustCase( std::string const& str ) const { + return m_caseSensitivity == CaseSensitive::No ? toLower( str ) : str; + } +} +// end catch_wildcard_pattern.cpp +// start catch_xmlwriter.cpp + +#include + +using uchar = unsigned char; + +namespace Catch { + +namespace { + + size_t trailingBytes(unsigned char c) { + if ((c & 0xE0) == 0xC0) { + return 2; + } + if ((c & 0xF0) == 0xE0) { + return 3; + } + if ((c & 0xF8) == 0xF0) { + return 4; + } + CATCH_INTERNAL_ERROR("Invalid multibyte utf-8 start byte encountered"); + } + + uint32_t headerValue(unsigned char c) { + if ((c & 0xE0) == 0xC0) { + return c & 0x1F; + } + if ((c & 0xF0) == 0xE0) { + return c & 0x0F; + } + if ((c & 0xF8) == 0xF0) { + return c & 0x07; + } + CATCH_INTERNAL_ERROR("Invalid multibyte utf-8 start byte encountered"); + } + + void hexEscapeChar(std::ostream& os, unsigned char c) { + std::ios_base::fmtflags f(os.flags()); + os << "\\x" + << std::uppercase << std::hex << std::setfill('0') << std::setw(2) + << static_cast(c); + os.flags(f); + } + +} // anonymous namespace + + XmlEncode::XmlEncode( std::string const& str, ForWhat forWhat ) + : m_str( str ), + m_forWhat( forWhat ) + {} + + void XmlEncode::encodeTo( std::ostream& os ) const { + // Apostrophe escaping not necessary if we always use " to write attributes + // (see: http://www.w3.org/TR/xml/#syntax) + + for( std::size_t idx = 0; idx < m_str.size(); ++ idx ) { + uchar c = m_str[idx]; + switch (c) { + case '<': os << "<"; break; + case '&': os << "&"; break; + + case '>': + // See: http://www.w3.org/TR/xml/#syntax + if (idx > 2 && m_str[idx - 1] == ']' && m_str[idx - 2] == ']') + os << ">"; + else + os << c; + break; + + case '\"': + if (m_forWhat == ForAttributes) + os << """; + else + os << c; + break; + + default: + // Check for control characters and invalid utf-8 + + // Escape control characters in standard ascii + // see http://stackoverflow.com/questions/404107/why-are-control-characters-illegal-in-xml-1-0 + if (c < 0x09 || (c > 0x0D && c < 0x20) || c == 0x7F) { + hexEscapeChar(os, c); + break; + } + + // Plain ASCII: Write it to stream + if (c < 0x7F) { + os << c; + break; + } + + // UTF-8 territory + // Check if the encoding is valid and if it is not, hex escape bytes. + // Important: We do not check the exact decoded values for validity, only the encoding format + // First check that this bytes is a valid lead byte: + // This means that it is not encoded as 1111 1XXX + // Or as 10XX XXXX + if (c < 0xC0 || + c >= 0xF8) { + hexEscapeChar(os, c); + break; + } + + auto encBytes = trailingBytes(c); + // Are there enough bytes left to avoid accessing out-of-bounds memory? + if (idx + encBytes - 1 >= m_str.size()) { + hexEscapeChar(os, c); + break; + } + // The header is valid, check data + // The next encBytes bytes must together be a valid utf-8 + // This means: bitpattern 10XX XXXX and the extracted value is sane (ish) + bool valid = true; + uint32_t value = headerValue(c); + for (std::size_t n = 1; n < encBytes; ++n) { + uchar nc = m_str[idx + n]; + valid &= ((nc & 0xC0) == 0x80); + value = (value << 6) | (nc & 0x3F); + } + + if ( + // Wrong bit pattern of following bytes + (!valid) || + // Overlong encodings + (value < 0x80) || + (0x80 <= value && value < 0x800 && encBytes > 2) || + (0x800 < value && value < 0x10000 && encBytes > 3) || + // Encoded value out of range + (value >= 0x110000) + ) { + hexEscapeChar(os, c); + break; + } + + // If we got here, this is in fact a valid(ish) utf-8 sequence + for (std::size_t n = 0; n < encBytes; ++n) { + os << m_str[idx + n]; + } + idx += encBytes - 1; + break; + } + } + } + + std::ostream& operator << ( std::ostream& os, XmlEncode const& xmlEncode ) { + xmlEncode.encodeTo( os ); + return os; + } + + XmlWriter::ScopedElement::ScopedElement( XmlWriter* writer ) + : m_writer( writer ) + {} + + XmlWriter::ScopedElement::ScopedElement( ScopedElement&& other ) noexcept + : m_writer( other.m_writer ){ + other.m_writer = nullptr; + } + XmlWriter::ScopedElement& XmlWriter::ScopedElement::operator=( ScopedElement&& other ) noexcept { + if ( m_writer ) { + m_writer->endElement(); + } + m_writer = other.m_writer; + other.m_writer = nullptr; + return *this; + } + + XmlWriter::ScopedElement::~ScopedElement() { + if( m_writer ) + m_writer->endElement(); + } + + XmlWriter::ScopedElement& XmlWriter::ScopedElement::writeText( std::string const& text, bool indent ) { + m_writer->writeText( text, indent ); + return *this; + } + + XmlWriter::XmlWriter( std::ostream& os ) : m_os( os ) + { + writeDeclaration(); + } + + XmlWriter::~XmlWriter() { + while( !m_tags.empty() ) + endElement(); + } + + XmlWriter& XmlWriter::startElement( std::string const& name ) { + ensureTagClosed(); + newlineIfNecessary(); + m_os << m_indent << '<' << name; + m_tags.push_back( name ); + m_indent += " "; + m_tagIsOpen = true; + return *this; + } + + XmlWriter::ScopedElement XmlWriter::scopedElement( std::string const& name ) { + ScopedElement scoped( this ); + startElement( name ); + return scoped; + } + + XmlWriter& XmlWriter::endElement() { + newlineIfNecessary(); + m_indent = m_indent.substr( 0, m_indent.size()-2 ); + if( m_tagIsOpen ) { + m_os << "/>"; + m_tagIsOpen = false; + } + else { + m_os << m_indent << ""; + } + m_os << std::endl; + m_tags.pop_back(); + return *this; + } + + XmlWriter& XmlWriter::writeAttribute( std::string const& name, std::string const& attribute ) { + if( !name.empty() && !attribute.empty() ) + m_os << ' ' << name << "=\"" << XmlEncode( attribute, XmlEncode::ForAttributes ) << '"'; + return *this; + } + + XmlWriter& XmlWriter::writeAttribute( std::string const& name, bool attribute ) { + m_os << ' ' << name << "=\"" << ( attribute ? "true" : "false" ) << '"'; + return *this; + } + + XmlWriter& XmlWriter::writeText( std::string const& text, bool indent ) { + if( !text.empty() ){ + bool tagWasOpen = m_tagIsOpen; + ensureTagClosed(); + if( tagWasOpen && indent ) + m_os << m_indent; + m_os << XmlEncode( text ); + m_needsNewline = true; + } + return *this; + } + + XmlWriter& XmlWriter::writeComment( std::string const& text ) { + ensureTagClosed(); + m_os << m_indent << ""; + m_needsNewline = true; + return *this; + } + + void XmlWriter::writeStylesheetRef( std::string const& url ) { + m_os << "\n"; + } + + XmlWriter& XmlWriter::writeBlankLine() { + ensureTagClosed(); + m_os << '\n'; + return *this; + } + + void XmlWriter::ensureTagClosed() { + if( m_tagIsOpen ) { + m_os << ">" << std::endl; + m_tagIsOpen = false; + } + } + + void XmlWriter::writeDeclaration() { + m_os << "\n"; + } + + void XmlWriter::newlineIfNecessary() { + if( m_needsNewline ) { + m_os << std::endl; + m_needsNewline = false; + } + } +} +// end catch_xmlwriter.cpp +// start catch_reporter_bases.cpp + +#include +#include +#include +#include +#include + +namespace Catch { + void prepareExpandedExpression(AssertionResult& result) { + result.getExpandedExpression(); + } + + // Because formatting using c++ streams is stateful, drop down to C is required + // Alternatively we could use stringstream, but its performance is... not good. + std::string getFormattedDuration( double duration ) { + // Max exponent + 1 is required to represent the whole part + // + 1 for decimal point + // + 3 for the 3 decimal places + // + 1 for null terminator + const std::size_t maxDoubleSize = DBL_MAX_10_EXP + 1 + 1 + 3 + 1; + char buffer[maxDoubleSize]; + + // Save previous errno, to prevent sprintf from overwriting it + ErrnoGuard guard; +#ifdef _MSC_VER + sprintf_s(buffer, "%.3f", duration); +#else + std::sprintf(buffer, "%.3f", duration); +#endif + return std::string(buffer); + } + + TestEventListenerBase::TestEventListenerBase(ReporterConfig const & _config) + :StreamingReporterBase(_config) {} + + std::set TestEventListenerBase::getSupportedVerbosities() { + return { Verbosity::Quiet, Verbosity::Normal, Verbosity::High }; + } + + void TestEventListenerBase::assertionStarting(AssertionInfo const &) {} + + bool TestEventListenerBase::assertionEnded(AssertionStats const &) { + return false; + } + +} // end namespace Catch +// end catch_reporter_bases.cpp +// start catch_reporter_compact.cpp + +namespace { + +#ifdef CATCH_PLATFORM_MAC + const char* failedString() { return "FAILED"; } + const char* passedString() { return "PASSED"; } +#else + const char* failedString() { return "failed"; } + const char* passedString() { return "passed"; } +#endif + + // Colour::LightGrey + Catch::Colour::Code dimColour() { return Catch::Colour::FileName; } + + std::string bothOrAll( std::size_t count ) { + return count == 1 ? std::string() : + count == 2 ? "both " : "all " ; + } + +} // anon namespace + +namespace Catch { +namespace { +// Colour, message variants: +// - white: No tests ran. +// - red: Failed [both/all] N test cases, failed [both/all] M assertions. +// - white: Passed [both/all] N test cases (no assertions). +// - red: Failed N tests cases, failed M assertions. +// - green: Passed [both/all] N tests cases with M assertions. +void printTotals(std::ostream& out, const Totals& totals) { + if (totals.testCases.total() == 0) { + out << "No tests ran."; + } else if (totals.testCases.failed == totals.testCases.total()) { + Colour colour(Colour::ResultError); + const std::string qualify_assertions_failed = + totals.assertions.failed == totals.assertions.total() ? + bothOrAll(totals.assertions.failed) : std::string(); + out << + "Failed " << bothOrAll(totals.testCases.failed) + << pluralise(totals.testCases.failed, "test case") << ", " + "failed " << qualify_assertions_failed << + pluralise(totals.assertions.failed, "assertion") << '.'; + } else if (totals.assertions.total() == 0) { + out << + "Passed " << bothOrAll(totals.testCases.total()) + << pluralise(totals.testCases.total(), "test case") + << " (no assertions)."; + } else if (totals.assertions.failed) { + Colour colour(Colour::ResultError); + out << + "Failed " << pluralise(totals.testCases.failed, "test case") << ", " + "failed " << pluralise(totals.assertions.failed, "assertion") << '.'; + } else { + Colour colour(Colour::ResultSuccess); + out << + "Passed " << bothOrAll(totals.testCases.passed) + << pluralise(totals.testCases.passed, "test case") << + " with " << pluralise(totals.assertions.passed, "assertion") << '.'; + } +} + +// Implementation of CompactReporter formatting +class AssertionPrinter { +public: + AssertionPrinter& operator= (AssertionPrinter const&) = delete; + AssertionPrinter(AssertionPrinter const&) = delete; + AssertionPrinter(std::ostream& _stream, AssertionStats const& _stats, bool _printInfoMessages) + : stream(_stream) + , result(_stats.assertionResult) + , messages(_stats.infoMessages) + , itMessage(_stats.infoMessages.begin()) + , printInfoMessages(_printInfoMessages) {} + + void print() { + printSourceInfo(); + + itMessage = messages.begin(); + + switch (result.getResultType()) { + case ResultWas::Ok: + printResultType(Colour::ResultSuccess, passedString()); + printOriginalExpression(); + printReconstructedExpression(); + if (!result.hasExpression()) + printRemainingMessages(Colour::None); + else + printRemainingMessages(); + break; + case ResultWas::ExpressionFailed: + if (result.isOk()) + printResultType(Colour::ResultSuccess, failedString() + std::string(" - but was ok")); + else + printResultType(Colour::Error, failedString()); + printOriginalExpression(); + printReconstructedExpression(); + printRemainingMessages(); + break; + case ResultWas::ThrewException: + printResultType(Colour::Error, failedString()); + printIssue("unexpected exception with message:"); + printMessage(); + printExpressionWas(); + printRemainingMessages(); + break; + case ResultWas::FatalErrorCondition: + printResultType(Colour::Error, failedString()); + printIssue("fatal error condition with message:"); + printMessage(); + printExpressionWas(); + printRemainingMessages(); + break; + case ResultWas::DidntThrowException: + printResultType(Colour::Error, failedString()); + printIssue("expected exception, got none"); + printExpressionWas(); + printRemainingMessages(); + break; + case ResultWas::Info: + printResultType(Colour::None, "info"); + printMessage(); + printRemainingMessages(); + break; + case ResultWas::Warning: + printResultType(Colour::None, "warning"); + printMessage(); + printRemainingMessages(); + break; + case ResultWas::ExplicitFailure: + printResultType(Colour::Error, failedString()); + printIssue("explicitly"); + printRemainingMessages(Colour::None); + break; + // These cases are here to prevent compiler warnings + case ResultWas::Unknown: + case ResultWas::FailureBit: + case ResultWas::Exception: + printResultType(Colour::Error, "** internal error **"); + break; + } + } + +private: + void printSourceInfo() const { + Colour colourGuard(Colour::FileName); + stream << result.getSourceInfo() << ':'; + } + + void printResultType(Colour::Code colour, std::string const& passOrFail) const { + if (!passOrFail.empty()) { + { + Colour colourGuard(colour); + stream << ' ' << passOrFail; + } + stream << ':'; + } + } + + void printIssue(std::string const& issue) const { + stream << ' ' << issue; + } + + void printExpressionWas() { + if (result.hasExpression()) { + stream << ';'; + { + Colour colour(dimColour()); + stream << " expression was:"; + } + printOriginalExpression(); + } + } + + void printOriginalExpression() const { + if (result.hasExpression()) { + stream << ' ' << result.getExpression(); + } + } + + void printReconstructedExpression() const { + if (result.hasExpandedExpression()) { + { + Colour colour(dimColour()); + stream << " for: "; + } + stream << result.getExpandedExpression(); + } + } + + void printMessage() { + if (itMessage != messages.end()) { + stream << " '" << itMessage->message << '\''; + ++itMessage; + } + } + + void printRemainingMessages(Colour::Code colour = dimColour()) { + if (itMessage == messages.end()) + return; + + // using messages.end() directly yields (or auto) compilation error: + std::vector::const_iterator itEnd = messages.end(); + const std::size_t N = static_cast(std::distance(itMessage, itEnd)); + + { + Colour colourGuard(colour); + stream << " with " << pluralise(N, "message") << ':'; + } + + for (; itMessage != itEnd; ) { + // If this assertion is a warning ignore any INFO messages + if (printInfoMessages || itMessage->type != ResultWas::Info) { + stream << " '" << itMessage->message << '\''; + if (++itMessage != itEnd) { + Colour colourGuard(dimColour()); + stream << " and"; + } + } + } + } + +private: + std::ostream& stream; + AssertionResult const& result; + std::vector messages; + std::vector::const_iterator itMessage; + bool printInfoMessages; +}; + +} // anon namespace + + std::string CompactReporter::getDescription() { + return "Reports test results on a single line, suitable for IDEs"; + } + + ReporterPreferences CompactReporter::getPreferences() const { + return m_reporterPrefs; + } + + void CompactReporter::noMatchingTestCases( std::string const& spec ) { + stream << "No test cases matched '" << spec << '\'' << std::endl; + } + + void CompactReporter::assertionStarting( AssertionInfo const& ) {} + + bool CompactReporter::assertionEnded( AssertionStats const& _assertionStats ) { + AssertionResult const& result = _assertionStats.assertionResult; + + bool printInfoMessages = true; + + // Drop out if result was successful and we're not printing those + if( !m_config->includeSuccessfulResults() && result.isOk() ) { + if( result.getResultType() != ResultWas::Warning ) + return false; + printInfoMessages = false; + } + + AssertionPrinter printer( stream, _assertionStats, printInfoMessages ); + printer.print(); + + stream << std::endl; + return true; + } + + void CompactReporter::sectionEnded(SectionStats const& _sectionStats) { + if (m_config->showDurations() == ShowDurations::Always) { + stream << getFormattedDuration(_sectionStats.durationInSeconds) << " s: " << _sectionStats.sectionInfo.name << std::endl; + } + } + + void CompactReporter::testRunEnded( TestRunStats const& _testRunStats ) { + printTotals( stream, _testRunStats.totals ); + stream << '\n' << std::endl; + StreamingReporterBase::testRunEnded( _testRunStats ); + } + + CompactReporter::~CompactReporter() {} + + CATCH_REGISTER_REPORTER( "compact", CompactReporter ) + +} // end namespace Catch +// end catch_reporter_compact.cpp +// start catch_reporter_console.cpp + +#include +#include + +#if defined(_MSC_VER) +#pragma warning(push) +#pragma warning(disable:4061) // Not all labels are EXPLICITLY handled in switch + // Note that 4062 (not all labels are handled + // and default is missing) is enabled +#endif + +namespace Catch { + +namespace { + +// Formatter impl for ConsoleReporter +class ConsoleAssertionPrinter { +public: + ConsoleAssertionPrinter& operator= (ConsoleAssertionPrinter const&) = delete; + ConsoleAssertionPrinter(ConsoleAssertionPrinter const&) = delete; + ConsoleAssertionPrinter(std::ostream& _stream, AssertionStats const& _stats, bool _printInfoMessages) + : stream(_stream), + stats(_stats), + result(_stats.assertionResult), + colour(Colour::None), + message(result.getMessage()), + messages(_stats.infoMessages), + printInfoMessages(_printInfoMessages) { + switch (result.getResultType()) { + case ResultWas::Ok: + colour = Colour::Success; + passOrFail = "PASSED"; + //if( result.hasMessage() ) + if (_stats.infoMessages.size() == 1) + messageLabel = "with message"; + if (_stats.infoMessages.size() > 1) + messageLabel = "with messages"; + break; + case ResultWas::ExpressionFailed: + if (result.isOk()) { + colour = Colour::Success; + passOrFail = "FAILED - but was ok"; + } else { + colour = Colour::Error; + passOrFail = "FAILED"; + } + if (_stats.infoMessages.size() == 1) + messageLabel = "with message"; + if (_stats.infoMessages.size() > 1) + messageLabel = "with messages"; + break; + case ResultWas::ThrewException: + colour = Colour::Error; + passOrFail = "FAILED"; + messageLabel = "due to unexpected exception with "; + if (_stats.infoMessages.size() == 1) + messageLabel += "message"; + if (_stats.infoMessages.size() > 1) + messageLabel += "messages"; + break; + case ResultWas::FatalErrorCondition: + colour = Colour::Error; + passOrFail = "FAILED"; + messageLabel = "due to a fatal error condition"; + break; + case ResultWas::DidntThrowException: + colour = Colour::Error; + passOrFail = "FAILED"; + messageLabel = "because no exception was thrown where one was expected"; + break; + case ResultWas::Info: + messageLabel = "info"; + break; + case ResultWas::Warning: + messageLabel = "warning"; + break; + case ResultWas::ExplicitFailure: + passOrFail = "FAILED"; + colour = Colour::Error; + if (_stats.infoMessages.size() == 1) + messageLabel = "explicitly with message"; + if (_stats.infoMessages.size() > 1) + messageLabel = "explicitly with messages"; + break; + // These cases are here to prevent compiler warnings + case ResultWas::Unknown: + case ResultWas::FailureBit: + case ResultWas::Exception: + passOrFail = "** internal error **"; + colour = Colour::Error; + break; + } + } + + void print() const { + printSourceInfo(); + if (stats.totals.assertions.total() > 0) { + printResultType(); + printOriginalExpression(); + printReconstructedExpression(); + } else { + stream << '\n'; + } + printMessage(); + } + +private: + void printResultType() const { + if (!passOrFail.empty()) { + Colour colourGuard(colour); + stream << passOrFail << ":\n"; + } + } + void printOriginalExpression() const { + if (result.hasExpression()) { + Colour colourGuard(Colour::OriginalExpression); + stream << " "; + stream << result.getExpressionInMacro(); + stream << '\n'; + } + } + void printReconstructedExpression() const { + if (result.hasExpandedExpression()) { + stream << "with expansion:\n"; + Colour colourGuard(Colour::ReconstructedExpression); + stream << Column(result.getExpandedExpression()).indent(2) << '\n'; + } + } + void printMessage() const { + if (!messageLabel.empty()) + stream << messageLabel << ':' << '\n'; + for (auto const& msg : messages) { + // If this assertion is a warning ignore any INFO messages + if (printInfoMessages || msg.type != ResultWas::Info) + stream << Column(msg.message).indent(2) << '\n'; + } + } + void printSourceInfo() const { + Colour colourGuard(Colour::FileName); + stream << result.getSourceInfo() << ": "; + } + + std::ostream& stream; + AssertionStats const& stats; + AssertionResult const& result; + Colour::Code colour; + std::string passOrFail; + std::string messageLabel; + std::string message; + std::vector messages; + bool printInfoMessages; +}; + +std::size_t makeRatio(std::size_t number, std::size_t total) { + std::size_t ratio = total > 0 ? CATCH_CONFIG_CONSOLE_WIDTH * number / total : 0; + return (ratio == 0 && number > 0) ? 1 : ratio; +} + +std::size_t& findMax(std::size_t& i, std::size_t& j, std::size_t& k) { + if (i > j && i > k) + return i; + else if (j > k) + return j; + else + return k; +} + +struct ColumnInfo { + enum Justification { Left, Right }; + std::string name; + int width; + Justification justification; +}; +struct ColumnBreak {}; +struct RowBreak {}; + +class Duration { + enum class Unit { + Auto, + Nanoseconds, + Microseconds, + Milliseconds, + Seconds, + Minutes + }; + static const uint64_t s_nanosecondsInAMicrosecond = 1000; + static const uint64_t s_nanosecondsInAMillisecond = 1000 * s_nanosecondsInAMicrosecond; + static const uint64_t s_nanosecondsInASecond = 1000 * s_nanosecondsInAMillisecond; + static const uint64_t s_nanosecondsInAMinute = 60 * s_nanosecondsInASecond; + + uint64_t m_inNanoseconds; + Unit m_units; + +public: + explicit Duration(uint64_t inNanoseconds, Unit units = Unit::Auto) + : m_inNanoseconds(inNanoseconds), + m_units(units) { + if (m_units == Unit::Auto) { + if (m_inNanoseconds < s_nanosecondsInAMicrosecond) + m_units = Unit::Nanoseconds; + else if (m_inNanoseconds < s_nanosecondsInAMillisecond) + m_units = Unit::Microseconds; + else if (m_inNanoseconds < s_nanosecondsInASecond) + m_units = Unit::Milliseconds; + else if (m_inNanoseconds < s_nanosecondsInAMinute) + m_units = Unit::Seconds; + else + m_units = Unit::Minutes; + } + + } + + auto value() const -> double { + switch (m_units) { + case Unit::Microseconds: + return m_inNanoseconds / static_cast(s_nanosecondsInAMicrosecond); + case Unit::Milliseconds: + return m_inNanoseconds / static_cast(s_nanosecondsInAMillisecond); + case Unit::Seconds: + return m_inNanoseconds / static_cast(s_nanosecondsInASecond); + case Unit::Minutes: + return m_inNanoseconds / static_cast(s_nanosecondsInAMinute); + default: + return static_cast(m_inNanoseconds); + } + } + auto unitsAsString() const -> std::string { + switch (m_units) { + case Unit::Nanoseconds: + return "ns"; + case Unit::Microseconds: + return "us"; + case Unit::Milliseconds: + return "ms"; + case Unit::Seconds: + return "s"; + case Unit::Minutes: + return "m"; + default: + return "** internal error **"; + } + + } + friend auto operator << (std::ostream& os, Duration const& duration) -> std::ostream& { + return os << duration.value() << " " << duration.unitsAsString(); + } +}; +} // end anon namespace + +class TablePrinter { + std::ostream& m_os; + std::vector m_columnInfos; + std::ostringstream m_oss; + int m_currentColumn = -1; + bool m_isOpen = false; + +public: + TablePrinter( std::ostream& os, std::vector columnInfos ) + : m_os( os ), + m_columnInfos( std::move( columnInfos ) ) {} + + auto columnInfos() const -> std::vector const& { + return m_columnInfos; + } + + void open() { + if (!m_isOpen) { + m_isOpen = true; + *this << RowBreak(); + for (auto const& info : m_columnInfos) + *this << info.name << ColumnBreak(); + *this << RowBreak(); + m_os << Catch::getLineOfChars<'-'>() << "\n"; + } + } + void close() { + if (m_isOpen) { + *this << RowBreak(); + m_os << std::endl; + m_isOpen = false; + } + } + + template + friend TablePrinter& operator << (TablePrinter& tp, T const& value) { + tp.m_oss << value; + return tp; + } + + friend TablePrinter& operator << (TablePrinter& tp, ColumnBreak) { + auto colStr = tp.m_oss.str(); + // This takes account of utf8 encodings + auto strSize = Catch::StringRef(colStr).numberOfCharacters(); + tp.m_oss.str(""); + tp.open(); + if (tp.m_currentColumn == static_cast(tp.m_columnInfos.size() - 1)) { + tp.m_currentColumn = -1; + tp.m_os << "\n"; + } + tp.m_currentColumn++; + + auto colInfo = tp.m_columnInfos[tp.m_currentColumn]; + auto padding = (strSize + 2 < static_cast(colInfo.width)) + ? std::string(colInfo.width - (strSize + 2), ' ') + : std::string(); + if (colInfo.justification == ColumnInfo::Left) + tp.m_os << colStr << padding << " "; + else + tp.m_os << padding << colStr << " "; + return tp; + } + + friend TablePrinter& operator << (TablePrinter& tp, RowBreak) { + if (tp.m_currentColumn > 0) { + tp.m_os << "\n"; + tp.m_currentColumn = -1; + } + return tp; + } +}; + +ConsoleReporter::ConsoleReporter(ReporterConfig const& config) + : StreamingReporterBase(config), + m_tablePrinter(new TablePrinter(config.stream(), + { + { "benchmark name", CATCH_CONFIG_CONSOLE_WIDTH - 32, ColumnInfo::Left }, + { "iters", 8, ColumnInfo::Right }, + { "elapsed ns", 14, ColumnInfo::Right }, + { "average", 14, ColumnInfo::Right } + })) {} +ConsoleReporter::~ConsoleReporter() = default; + +std::string ConsoleReporter::getDescription() { + return "Reports test results as plain lines of text"; +} + +void ConsoleReporter::noMatchingTestCases(std::string const& spec) { + stream << "No test cases matched '" << spec << '\'' << std::endl; +} + +void ConsoleReporter::assertionStarting(AssertionInfo const&) {} + +bool ConsoleReporter::assertionEnded(AssertionStats const& _assertionStats) { + AssertionResult const& result = _assertionStats.assertionResult; + + bool includeResults = m_config->includeSuccessfulResults() || !result.isOk(); + + // Drop out if result was successful but we're not printing them. + if (!includeResults && result.getResultType() != ResultWas::Warning) + return false; + + lazyPrint(); + + ConsoleAssertionPrinter printer(stream, _assertionStats, includeResults); + printer.print(); + stream << std::endl; + return true; +} + +void ConsoleReporter::sectionStarting(SectionInfo const& _sectionInfo) { + m_headerPrinted = false; + StreamingReporterBase::sectionStarting(_sectionInfo); +} +void ConsoleReporter::sectionEnded(SectionStats const& _sectionStats) { + m_tablePrinter->close(); + if (_sectionStats.missingAssertions) { + lazyPrint(); + Colour colour(Colour::ResultError); + if (m_sectionStack.size() > 1) + stream << "\nNo assertions in section"; + else + stream << "\nNo assertions in test case"; + stream << " '" << _sectionStats.sectionInfo.name << "'\n" << std::endl; + } + if (m_config->showDurations() == ShowDurations::Always) { + stream << getFormattedDuration(_sectionStats.durationInSeconds) << " s: " << _sectionStats.sectionInfo.name << std::endl; + } + if (m_headerPrinted) { + m_headerPrinted = false; + } + StreamingReporterBase::sectionEnded(_sectionStats); +} + +void ConsoleReporter::benchmarkStarting(BenchmarkInfo const& info) { + lazyPrintWithoutClosingBenchmarkTable(); + + auto nameCol = Column( info.name ).width( static_cast( m_tablePrinter->columnInfos()[0].width - 2 ) ); + + bool firstLine = true; + for (auto line : nameCol) { + if (!firstLine) + (*m_tablePrinter) << ColumnBreak() << ColumnBreak() << ColumnBreak(); + else + firstLine = false; + + (*m_tablePrinter) << line << ColumnBreak(); + } +} +void ConsoleReporter::benchmarkEnded(BenchmarkStats const& stats) { + Duration average(stats.elapsedTimeInNanoseconds / stats.iterations); + (*m_tablePrinter) + << stats.iterations << ColumnBreak() + << stats.elapsedTimeInNanoseconds << ColumnBreak() + << average << ColumnBreak(); +} + +void ConsoleReporter::testCaseEnded(TestCaseStats const& _testCaseStats) { + m_tablePrinter->close(); + StreamingReporterBase::testCaseEnded(_testCaseStats); + m_headerPrinted = false; +} +void ConsoleReporter::testGroupEnded(TestGroupStats const& _testGroupStats) { + if (currentGroupInfo.used) { + printSummaryDivider(); + stream << "Summary for group '" << _testGroupStats.groupInfo.name << "':\n"; + printTotals(_testGroupStats.totals); + stream << '\n' << std::endl; + } + StreamingReporterBase::testGroupEnded(_testGroupStats); +} +void ConsoleReporter::testRunEnded(TestRunStats const& _testRunStats) { + printTotalsDivider(_testRunStats.totals); + printTotals(_testRunStats.totals); + stream << std::endl; + StreamingReporterBase::testRunEnded(_testRunStats); +} + +void ConsoleReporter::lazyPrint() { + + m_tablePrinter->close(); + lazyPrintWithoutClosingBenchmarkTable(); +} + +void ConsoleReporter::lazyPrintWithoutClosingBenchmarkTable() { + + if (!currentTestRunInfo.used) + lazyPrintRunInfo(); + if (!currentGroupInfo.used) + lazyPrintGroupInfo(); + + if (!m_headerPrinted) { + printTestCaseAndSectionHeader(); + m_headerPrinted = true; + } +} +void ConsoleReporter::lazyPrintRunInfo() { + stream << '\n' << getLineOfChars<'~'>() << '\n'; + Colour colour(Colour::SecondaryText); + stream << currentTestRunInfo->name + << " is a Catch v" << libraryVersion() << " host application.\n" + << "Run with -? for options\n\n"; + + if (m_config->rngSeed() != 0) + stream << "Randomness seeded to: " << m_config->rngSeed() << "\n\n"; + + currentTestRunInfo.used = true; +} +void ConsoleReporter::lazyPrintGroupInfo() { + if (!currentGroupInfo->name.empty() && currentGroupInfo->groupsCounts > 1) { + printClosedHeader("Group: " + currentGroupInfo->name); + currentGroupInfo.used = true; + } +} +void ConsoleReporter::printTestCaseAndSectionHeader() { + assert(!m_sectionStack.empty()); + printOpenHeader(currentTestCaseInfo->name); + + if (m_sectionStack.size() > 1) { + Colour colourGuard(Colour::Headers); + + auto + it = m_sectionStack.begin() + 1, // Skip first section (test case) + itEnd = m_sectionStack.end(); + for (; it != itEnd; ++it) + printHeaderString(it->name, 2); + } + + SourceLineInfo lineInfo = m_sectionStack.back().lineInfo; + + if (!lineInfo.empty()) { + stream << getLineOfChars<'-'>() << '\n'; + Colour colourGuard(Colour::FileName); + stream << lineInfo << '\n'; + } + stream << getLineOfChars<'.'>() << '\n' << std::endl; +} + +void ConsoleReporter::printClosedHeader(std::string const& _name) { + printOpenHeader(_name); + stream << getLineOfChars<'.'>() << '\n'; +} +void ConsoleReporter::printOpenHeader(std::string const& _name) { + stream << getLineOfChars<'-'>() << '\n'; + { + Colour colourGuard(Colour::Headers); + printHeaderString(_name); + } +} + +// if string has a : in first line will set indent to follow it on +// subsequent lines +void ConsoleReporter::printHeaderString(std::string const& _string, std::size_t indent) { + std::size_t i = _string.find(": "); + if (i != std::string::npos) + i += 2; + else + i = 0; + stream << Column(_string).indent(indent + i).initialIndent(indent) << '\n'; +} + +struct SummaryColumn { + + SummaryColumn( std::string _label, Colour::Code _colour ) + : label( std::move( _label ) ), + colour( _colour ) {} + SummaryColumn addRow( std::size_t count ) { + ReusableStringStream rss; + rss << count; + std::string row = rss.str(); + for (auto& oldRow : rows) { + while (oldRow.size() < row.size()) + oldRow = ' ' + oldRow; + while (oldRow.size() > row.size()) + row = ' ' + row; + } + rows.push_back(row); + return *this; + } + + std::string label; + Colour::Code colour; + std::vector rows; + +}; + +void ConsoleReporter::printTotals( Totals const& totals ) { + if (totals.testCases.total() == 0) { + stream << Colour(Colour::Warning) << "No tests ran\n"; + } else if (totals.assertions.total() > 0 && totals.testCases.allPassed()) { + stream << Colour(Colour::ResultSuccess) << "All tests passed"; + stream << " (" + << pluralise(totals.assertions.passed, "assertion") << " in " + << pluralise(totals.testCases.passed, "test case") << ')' + << '\n'; + } else { + + std::vector columns; + columns.push_back(SummaryColumn("", Colour::None) + .addRow(totals.testCases.total()) + .addRow(totals.assertions.total())); + columns.push_back(SummaryColumn("passed", Colour::Success) + .addRow(totals.testCases.passed) + .addRow(totals.assertions.passed)); + columns.push_back(SummaryColumn("failed", Colour::ResultError) + .addRow(totals.testCases.failed) + .addRow(totals.assertions.failed)); + columns.push_back(SummaryColumn("failed as expected", Colour::ResultExpectedFailure) + .addRow(totals.testCases.failedButOk) + .addRow(totals.assertions.failedButOk)); + + printSummaryRow("test cases", columns, 0); + printSummaryRow("assertions", columns, 1); + } +} +void ConsoleReporter::printSummaryRow(std::string const& label, std::vector const& cols, std::size_t row) { + for (auto col : cols) { + std::string value = col.rows[row]; + if (col.label.empty()) { + stream << label << ": "; + if (value != "0") + stream << value; + else + stream << Colour(Colour::Warning) << "- none -"; + } else if (value != "0") { + stream << Colour(Colour::LightGrey) << " | "; + stream << Colour(col.colour) + << value << ' ' << col.label; + } + } + stream << '\n'; +} + +void ConsoleReporter::printTotalsDivider(Totals const& totals) { + if (totals.testCases.total() > 0) { + std::size_t failedRatio = makeRatio(totals.testCases.failed, totals.testCases.total()); + std::size_t failedButOkRatio = makeRatio(totals.testCases.failedButOk, totals.testCases.total()); + std::size_t passedRatio = makeRatio(totals.testCases.passed, totals.testCases.total()); + while (failedRatio + failedButOkRatio + passedRatio < CATCH_CONFIG_CONSOLE_WIDTH - 1) + findMax(failedRatio, failedButOkRatio, passedRatio)++; + while (failedRatio + failedButOkRatio + passedRatio > CATCH_CONFIG_CONSOLE_WIDTH - 1) + findMax(failedRatio, failedButOkRatio, passedRatio)--; + + stream << Colour(Colour::Error) << std::string(failedRatio, '='); + stream << Colour(Colour::ResultExpectedFailure) << std::string(failedButOkRatio, '='); + if (totals.testCases.allPassed()) + stream << Colour(Colour::ResultSuccess) << std::string(passedRatio, '='); + else + stream << Colour(Colour::Success) << std::string(passedRatio, '='); + } else { + stream << Colour(Colour::Warning) << std::string(CATCH_CONFIG_CONSOLE_WIDTH - 1, '='); + } + stream << '\n'; +} +void ConsoleReporter::printSummaryDivider() { + stream << getLineOfChars<'-'>() << '\n'; +} + +CATCH_REGISTER_REPORTER("console", ConsoleReporter) + +} // end namespace Catch + +#if defined(_MSC_VER) +#pragma warning(pop) +#endif +// end catch_reporter_console.cpp +// start catch_reporter_junit.cpp + +#include +#include +#include +#include + +namespace Catch { + + namespace { + std::string getCurrentTimestamp() { + // Beware, this is not reentrant because of backward compatibility issues + // Also, UTC only, again because of backward compatibility (%z is C++11) + time_t rawtime; + std::time(&rawtime); + auto const timeStampSize = sizeof("2017-01-16T17:06:45Z"); + +#ifdef _MSC_VER + std::tm timeInfo = {}; + gmtime_s(&timeInfo, &rawtime); +#else + std::tm* timeInfo; + timeInfo = std::gmtime(&rawtime); +#endif + + char timeStamp[timeStampSize]; + const char * const fmt = "%Y-%m-%dT%H:%M:%SZ"; + +#ifdef _MSC_VER + std::strftime(timeStamp, timeStampSize, fmt, &timeInfo); +#else + std::strftime(timeStamp, timeStampSize, fmt, timeInfo); +#endif + return std::string(timeStamp); + } + + std::string fileNameTag(const std::vector &tags) { + auto it = std::find_if(begin(tags), + end(tags), + [] (std::string const& tag) {return tag.front() == '#'; }); + if (it != tags.end()) + return it->substr(1); + return std::string(); + } + } // anonymous namespace + + JunitReporter::JunitReporter( ReporterConfig const& _config ) + : CumulativeReporterBase( _config ), + xml( _config.stream() ) + { + m_reporterPrefs.shouldRedirectStdOut = true; + m_reporterPrefs.shouldReportAllAssertions = true; + } + + JunitReporter::~JunitReporter() {} + + std::string JunitReporter::getDescription() { + return "Reports test results in an XML format that looks like Ant's junitreport target"; + } + + void JunitReporter::noMatchingTestCases( std::string const& /*spec*/ ) {} + + void JunitReporter::testRunStarting( TestRunInfo const& runInfo ) { + CumulativeReporterBase::testRunStarting( runInfo ); + xml.startElement( "testsuites" ); + if( m_config->rngSeed() != 0 ) { + xml.startElement( "properties" ); + xml.scopedElement( "property" ) + .writeAttribute( "name", "random-seed" ) + .writeAttribute( "value", m_config->rngSeed() ); + xml.endElement(); + } + } + + void JunitReporter::testGroupStarting( GroupInfo const& groupInfo ) { + suiteTimer.start(); + stdOutForSuite.clear(); + stdErrForSuite.clear(); + unexpectedExceptions = 0; + CumulativeReporterBase::testGroupStarting( groupInfo ); + } + + void JunitReporter::testCaseStarting( TestCaseInfo const& testCaseInfo ) { + m_okToFail = testCaseInfo.okToFail(); + } + + bool JunitReporter::assertionEnded( AssertionStats const& assertionStats ) { + if( assertionStats.assertionResult.getResultType() == ResultWas::ThrewException && !m_okToFail ) + unexpectedExceptions++; + return CumulativeReporterBase::assertionEnded( assertionStats ); + } + + void JunitReporter::testCaseEnded( TestCaseStats const& testCaseStats ) { + stdOutForSuite += testCaseStats.stdOut; + stdErrForSuite += testCaseStats.stdErr; + CumulativeReporterBase::testCaseEnded( testCaseStats ); + } + + void JunitReporter::testGroupEnded( TestGroupStats const& testGroupStats ) { + double suiteTime = suiteTimer.getElapsedSeconds(); + CumulativeReporterBase::testGroupEnded( testGroupStats ); + writeGroup( *m_testGroups.back(), suiteTime ); + } + + void JunitReporter::testRunEndedCumulative() { + xml.endElement(); + } + + void JunitReporter::writeGroup( TestGroupNode const& groupNode, double suiteTime ) { + XmlWriter::ScopedElement e = xml.scopedElement( "testsuite" ); + TestGroupStats const& stats = groupNode.value; + xml.writeAttribute( "name", stats.groupInfo.name ); + xml.writeAttribute( "errors", unexpectedExceptions ); + xml.writeAttribute( "failures", stats.totals.assertions.failed-unexpectedExceptions ); + xml.writeAttribute( "tests", stats.totals.assertions.total() ); + xml.writeAttribute( "hostname", "tbd" ); // !TBD + if( m_config->showDurations() == ShowDurations::Never ) + xml.writeAttribute( "time", "" ); + else + xml.writeAttribute( "time", suiteTime ); + xml.writeAttribute( "timestamp", getCurrentTimestamp() ); + + // Write test cases + for( auto const& child : groupNode.children ) + writeTestCase( *child ); + + xml.scopedElement( "system-out" ).writeText( trim( stdOutForSuite ), false ); + xml.scopedElement( "system-err" ).writeText( trim( stdErrForSuite ), false ); + } + + void JunitReporter::writeTestCase( TestCaseNode const& testCaseNode ) { + TestCaseStats const& stats = testCaseNode.value; + + // All test cases have exactly one section - which represents the + // test case itself. That section may have 0-n nested sections + assert( testCaseNode.children.size() == 1 ); + SectionNode const& rootSection = *testCaseNode.children.front(); + + std::string className = stats.testInfo.className; + + if( className.empty() ) { + className = fileNameTag(stats.testInfo.tags); + if ( className.empty() ) + className = "global"; + } + + if ( !m_config->name().empty() ) + className = m_config->name() + "." + className; + + writeSection( className, "", rootSection ); + } + + void JunitReporter::writeSection( std::string const& className, + std::string const& rootName, + SectionNode const& sectionNode ) { + std::string name = trim( sectionNode.stats.sectionInfo.name ); + if( !rootName.empty() ) + name = rootName + '/' + name; + + if( !sectionNode.assertions.empty() || + !sectionNode.stdOut.empty() || + !sectionNode.stdErr.empty() ) { + XmlWriter::ScopedElement e = xml.scopedElement( "testcase" ); + if( className.empty() ) { + xml.writeAttribute( "classname", name ); + xml.writeAttribute( "name", "root" ); + } + else { + xml.writeAttribute( "classname", className ); + xml.writeAttribute( "name", name ); + } + xml.writeAttribute( "time", ::Catch::Detail::stringify( sectionNode.stats.durationInSeconds ) ); + + writeAssertions( sectionNode ); + + if( !sectionNode.stdOut.empty() ) + xml.scopedElement( "system-out" ).writeText( trim( sectionNode.stdOut ), false ); + if( !sectionNode.stdErr.empty() ) + xml.scopedElement( "system-err" ).writeText( trim( sectionNode.stdErr ), false ); + } + for( auto const& childNode : sectionNode.childSections ) + if( className.empty() ) + writeSection( name, "", *childNode ); + else + writeSection( className, name, *childNode ); + } + + void JunitReporter::writeAssertions( SectionNode const& sectionNode ) { + for( auto const& assertion : sectionNode.assertions ) + writeAssertion( assertion ); + } + + void JunitReporter::writeAssertion( AssertionStats const& stats ) { + AssertionResult const& result = stats.assertionResult; + if( !result.isOk() ) { + std::string elementName; + switch( result.getResultType() ) { + case ResultWas::ThrewException: + case ResultWas::FatalErrorCondition: + elementName = "error"; + break; + case ResultWas::ExplicitFailure: + elementName = "failure"; + break; + case ResultWas::ExpressionFailed: + elementName = "failure"; + break; + case ResultWas::DidntThrowException: + elementName = "failure"; + break; + + // We should never see these here: + case ResultWas::Info: + case ResultWas::Warning: + case ResultWas::Ok: + case ResultWas::Unknown: + case ResultWas::FailureBit: + case ResultWas::Exception: + elementName = "internalError"; + break; + } + + XmlWriter::ScopedElement e = xml.scopedElement( elementName ); + + xml.writeAttribute( "message", result.getExpandedExpression() ); + xml.writeAttribute( "type", result.getTestMacroName() ); + + ReusableStringStream rss; + if( !result.getMessage().empty() ) + rss << result.getMessage() << '\n'; + for( auto const& msg : stats.infoMessages ) + if( msg.type == ResultWas::Info ) + rss << msg.message << '\n'; + + rss << "at " << result.getSourceInfo(); + xml.writeText( rss.str(), false ); + } + } + + CATCH_REGISTER_REPORTER( "junit", JunitReporter ) + +} // end namespace Catch +// end catch_reporter_junit.cpp +// start catch_reporter_listening.cpp + +#include + +namespace Catch { + + ListeningReporter::ListeningReporter() { + // We will assume that listeners will always want all assertions + m_preferences.shouldReportAllAssertions = true; + } + + void ListeningReporter::addListener( IStreamingReporterPtr&& listener ) { + m_listeners.push_back( std::move( listener ) ); + } + + void ListeningReporter::addReporter(IStreamingReporterPtr&& reporter) { + assert(!m_reporter && "Listening reporter can wrap only 1 real reporter"); + m_reporter = std::move( reporter ); + m_preferences.shouldRedirectStdOut = m_reporter->getPreferences().shouldRedirectStdOut; + } + + ReporterPreferences ListeningReporter::getPreferences() const { + return m_preferences; + } + + std::set ListeningReporter::getSupportedVerbosities() { + return std::set{ }; + } + + void ListeningReporter::noMatchingTestCases( std::string const& spec ) { + for ( auto const& listener : m_listeners ) { + listener->noMatchingTestCases( spec ); + } + m_reporter->noMatchingTestCases( spec ); + } + + void ListeningReporter::benchmarkStarting( BenchmarkInfo const& benchmarkInfo ) { + for ( auto const& listener : m_listeners ) { + listener->benchmarkStarting( benchmarkInfo ); + } + m_reporter->benchmarkStarting( benchmarkInfo ); + } + void ListeningReporter::benchmarkEnded( BenchmarkStats const& benchmarkStats ) { + for ( auto const& listener : m_listeners ) { + listener->benchmarkEnded( benchmarkStats ); + } + m_reporter->benchmarkEnded( benchmarkStats ); + } + + void ListeningReporter::testRunStarting( TestRunInfo const& testRunInfo ) { + for ( auto const& listener : m_listeners ) { + listener->testRunStarting( testRunInfo ); + } + m_reporter->testRunStarting( testRunInfo ); + } + + void ListeningReporter::testGroupStarting( GroupInfo const& groupInfo ) { + for ( auto const& listener : m_listeners ) { + listener->testGroupStarting( groupInfo ); + } + m_reporter->testGroupStarting( groupInfo ); + } + + void ListeningReporter::testCaseStarting( TestCaseInfo const& testInfo ) { + for ( auto const& listener : m_listeners ) { + listener->testCaseStarting( testInfo ); + } + m_reporter->testCaseStarting( testInfo ); + } + + void ListeningReporter::sectionStarting( SectionInfo const& sectionInfo ) { + for ( auto const& listener : m_listeners ) { + listener->sectionStarting( sectionInfo ); + } + m_reporter->sectionStarting( sectionInfo ); + } + + void ListeningReporter::assertionStarting( AssertionInfo const& assertionInfo ) { + for ( auto const& listener : m_listeners ) { + listener->assertionStarting( assertionInfo ); + } + m_reporter->assertionStarting( assertionInfo ); + } + + // The return value indicates if the messages buffer should be cleared: + bool ListeningReporter::assertionEnded( AssertionStats const& assertionStats ) { + for( auto const& listener : m_listeners ) { + static_cast( listener->assertionEnded( assertionStats ) ); + } + return m_reporter->assertionEnded( assertionStats ); + } + + void ListeningReporter::sectionEnded( SectionStats const& sectionStats ) { + for ( auto const& listener : m_listeners ) { + listener->sectionEnded( sectionStats ); + } + m_reporter->sectionEnded( sectionStats ); + } + + void ListeningReporter::testCaseEnded( TestCaseStats const& testCaseStats ) { + for ( auto const& listener : m_listeners ) { + listener->testCaseEnded( testCaseStats ); + } + m_reporter->testCaseEnded( testCaseStats ); + } + + void ListeningReporter::testGroupEnded( TestGroupStats const& testGroupStats ) { + for ( auto const& listener : m_listeners ) { + listener->testGroupEnded( testGroupStats ); + } + m_reporter->testGroupEnded( testGroupStats ); + } + + void ListeningReporter::testRunEnded( TestRunStats const& testRunStats ) { + for ( auto const& listener : m_listeners ) { + listener->testRunEnded( testRunStats ); + } + m_reporter->testRunEnded( testRunStats ); + } + + void ListeningReporter::skipTest( TestCaseInfo const& testInfo ) { + for ( auto const& listener : m_listeners ) { + listener->skipTest( testInfo ); + } + m_reporter->skipTest( testInfo ); + } + + bool ListeningReporter::isMulti() const { + return true; + } + +} // end namespace Catch +// end catch_reporter_listening.cpp +// start catch_reporter_xml.cpp + +#if defined(_MSC_VER) +#pragma warning(push) +#pragma warning(disable:4061) // Not all labels are EXPLICITLY handled in switch + // Note that 4062 (not all labels are handled + // and default is missing) is enabled +#endif + +namespace Catch { + XmlReporter::XmlReporter( ReporterConfig const& _config ) + : StreamingReporterBase( _config ), + m_xml(_config.stream()) + { + m_reporterPrefs.shouldRedirectStdOut = true; + m_reporterPrefs.shouldReportAllAssertions = true; + } + + XmlReporter::~XmlReporter() = default; + + std::string XmlReporter::getDescription() { + return "Reports test results as an XML document"; + } + + std::string XmlReporter::getStylesheetRef() const { + return std::string(); + } + + void XmlReporter::writeSourceInfo( SourceLineInfo const& sourceInfo ) { + m_xml + .writeAttribute( "filename", sourceInfo.file ) + .writeAttribute( "line", sourceInfo.line ); + } + + void XmlReporter::noMatchingTestCases( std::string const& s ) { + StreamingReporterBase::noMatchingTestCases( s ); + } + + void XmlReporter::testRunStarting( TestRunInfo const& testInfo ) { + StreamingReporterBase::testRunStarting( testInfo ); + std::string stylesheetRef = getStylesheetRef(); + if( !stylesheetRef.empty() ) + m_xml.writeStylesheetRef( stylesheetRef ); + m_xml.startElement( "Catch" ); + if( !m_config->name().empty() ) + m_xml.writeAttribute( "name", m_config->name() ); + if( m_config->rngSeed() != 0 ) + m_xml.scopedElement( "Randomness" ) + .writeAttribute( "seed", m_config->rngSeed() ); + } + + void XmlReporter::testGroupStarting( GroupInfo const& groupInfo ) { + StreamingReporterBase::testGroupStarting( groupInfo ); + m_xml.startElement( "Group" ) + .writeAttribute( "name", groupInfo.name ); + } + + void XmlReporter::testCaseStarting( TestCaseInfo const& testInfo ) { + StreamingReporterBase::testCaseStarting(testInfo); + m_xml.startElement( "TestCase" ) + .writeAttribute( "name", trim( testInfo.name ) ) + .writeAttribute( "description", testInfo.description ) + .writeAttribute( "tags", testInfo.tagsAsString() ); + + writeSourceInfo( testInfo.lineInfo ); + + if ( m_config->showDurations() == ShowDurations::Always ) + m_testCaseTimer.start(); + m_xml.ensureTagClosed(); + } + + void XmlReporter::sectionStarting( SectionInfo const& sectionInfo ) { + StreamingReporterBase::sectionStarting( sectionInfo ); + if( m_sectionDepth++ > 0 ) { + m_xml.startElement( "Section" ) + .writeAttribute( "name", trim( sectionInfo.name ) ); + writeSourceInfo( sectionInfo.lineInfo ); + m_xml.ensureTagClosed(); + } + } + + void XmlReporter::assertionStarting( AssertionInfo const& ) { } + + bool XmlReporter::assertionEnded( AssertionStats const& assertionStats ) { + + AssertionResult const& result = assertionStats.assertionResult; + + bool includeResults = m_config->includeSuccessfulResults() || !result.isOk(); + + if( includeResults || result.getResultType() == ResultWas::Warning ) { + // Print any info messages in tags. + for( auto const& msg : assertionStats.infoMessages ) { + if( msg.type == ResultWas::Info && includeResults ) { + m_xml.scopedElement( "Info" ) + .writeText( msg.message ); + } else if ( msg.type == ResultWas::Warning ) { + m_xml.scopedElement( "Warning" ) + .writeText( msg.message ); + } + } + } + + // Drop out if result was successful but we're not printing them. + if( !includeResults && result.getResultType() != ResultWas::Warning ) + return true; + + // Print the expression if there is one. + if( result.hasExpression() ) { + m_xml.startElement( "Expression" ) + .writeAttribute( "success", result.succeeded() ) + .writeAttribute( "type", result.getTestMacroName() ); + + writeSourceInfo( result.getSourceInfo() ); + + m_xml.scopedElement( "Original" ) + .writeText( result.getExpression() ); + m_xml.scopedElement( "Expanded" ) + .writeText( result.getExpandedExpression() ); + } + + // And... Print a result applicable to each result type. + switch( result.getResultType() ) { + case ResultWas::ThrewException: + m_xml.startElement( "Exception" ); + writeSourceInfo( result.getSourceInfo() ); + m_xml.writeText( result.getMessage() ); + m_xml.endElement(); + break; + case ResultWas::FatalErrorCondition: + m_xml.startElement( "FatalErrorCondition" ); + writeSourceInfo( result.getSourceInfo() ); + m_xml.writeText( result.getMessage() ); + m_xml.endElement(); + break; + case ResultWas::Info: + m_xml.scopedElement( "Info" ) + .writeText( result.getMessage() ); + break; + case ResultWas::Warning: + // Warning will already have been written + break; + case ResultWas::ExplicitFailure: + m_xml.startElement( "Failure" ); + writeSourceInfo( result.getSourceInfo() ); + m_xml.writeText( result.getMessage() ); + m_xml.endElement(); + break; + default: + break; + } + + if( result.hasExpression() ) + m_xml.endElement(); + + return true; + } + + void XmlReporter::sectionEnded( SectionStats const& sectionStats ) { + StreamingReporterBase::sectionEnded( sectionStats ); + if( --m_sectionDepth > 0 ) { + XmlWriter::ScopedElement e = m_xml.scopedElement( "OverallResults" ); + e.writeAttribute( "successes", sectionStats.assertions.passed ); + e.writeAttribute( "failures", sectionStats.assertions.failed ); + e.writeAttribute( "expectedFailures", sectionStats.assertions.failedButOk ); + + if ( m_config->showDurations() == ShowDurations::Always ) + e.writeAttribute( "durationInSeconds", sectionStats.durationInSeconds ); + + m_xml.endElement(); + } + } + + void XmlReporter::testCaseEnded( TestCaseStats const& testCaseStats ) { + StreamingReporterBase::testCaseEnded( testCaseStats ); + XmlWriter::ScopedElement e = m_xml.scopedElement( "OverallResult" ); + e.writeAttribute( "success", testCaseStats.totals.assertions.allOk() ); + + if ( m_config->showDurations() == ShowDurations::Always ) + e.writeAttribute( "durationInSeconds", m_testCaseTimer.getElapsedSeconds() ); + + if( !testCaseStats.stdOut.empty() ) + m_xml.scopedElement( "StdOut" ).writeText( trim( testCaseStats.stdOut ), false ); + if( !testCaseStats.stdErr.empty() ) + m_xml.scopedElement( "StdErr" ).writeText( trim( testCaseStats.stdErr ), false ); + + m_xml.endElement(); + } + + void XmlReporter::testGroupEnded( TestGroupStats const& testGroupStats ) { + StreamingReporterBase::testGroupEnded( testGroupStats ); + // TODO: Check testGroupStats.aborting and act accordingly. + m_xml.scopedElement( "OverallResults" ) + .writeAttribute( "successes", testGroupStats.totals.assertions.passed ) + .writeAttribute( "failures", testGroupStats.totals.assertions.failed ) + .writeAttribute( "expectedFailures", testGroupStats.totals.assertions.failedButOk ); + m_xml.endElement(); + } + + void XmlReporter::testRunEnded( TestRunStats const& testRunStats ) { + StreamingReporterBase::testRunEnded( testRunStats ); + m_xml.scopedElement( "OverallResults" ) + .writeAttribute( "successes", testRunStats.totals.assertions.passed ) + .writeAttribute( "failures", testRunStats.totals.assertions.failed ) + .writeAttribute( "expectedFailures", testRunStats.totals.assertions.failedButOk ); + m_xml.endElement(); + } + + CATCH_REGISTER_REPORTER( "xml", XmlReporter ) + +} // end namespace Catch + +#if defined(_MSC_VER) +#pragma warning(pop) +#endif +// end catch_reporter_xml.cpp + +namespace Catch { + LeakDetector leakDetector; +} + +#ifdef __clang__ +#pragma clang diagnostic pop +#endif + +// end catch_impl.hpp +#endif + +#ifdef CATCH_CONFIG_MAIN +// start catch_default_main.hpp + +#ifndef __OBJC__ + +#if defined(CATCH_CONFIG_WCHAR) && defined(WIN32) && defined(_UNICODE) && !defined(DO_NOT_USE_WMAIN) +// Standard C/C++ Win32 Unicode wmain entry point +extern "C" int wmain (int argc, wchar_t * argv[], wchar_t * []) { +#else +// Standard C/C++ main entry point +int main (int argc, char * argv[]) { +#endif + + return Catch::Session().run( argc, argv ); +} + +#else // __OBJC__ + +// Objective-C entry point +int main (int argc, char * const argv[]) { +#if !CATCH_ARC_ENABLED + NSAutoreleasePool * pool = [[NSAutoreleasePool alloc] init]; +#endif + + Catch::registerTestMethods(); + int result = Catch::Session().run( argc, (char**)argv ); + +#if !CATCH_ARC_ENABLED + [pool drain]; +#endif + + return result; +} + +#endif // __OBJC__ + +// end catch_default_main.hpp +#endif + +#if !defined(CATCH_CONFIG_IMPL_ONLY) + +#ifdef CLARA_CONFIG_MAIN_NOT_DEFINED +# undef CLARA_CONFIG_MAIN +#endif + +#if !defined(CATCH_CONFIG_DISABLE) +////// +// If this config identifier is defined then all CATCH macros are prefixed with CATCH_ +#ifdef CATCH_CONFIG_PREFIX_ALL + +#define CATCH_REQUIRE( ... ) INTERNAL_CATCH_TEST( "CATCH_REQUIRE", Catch::ResultDisposition::Normal, __VA_ARGS__ ) +#define CATCH_REQUIRE_FALSE( ... ) INTERNAL_CATCH_TEST( "CATCH_REQUIRE_FALSE", Catch::ResultDisposition::Normal | Catch::ResultDisposition::FalseTest, __VA_ARGS__ ) + +#define CATCH_REQUIRE_THROWS( ... ) INTERNAL_CATCH_THROWS( "CATCH_REQUIRE_THROWS", Catch::ResultDisposition::Normal, __VA_ARGS__ ) +#define CATCH_REQUIRE_THROWS_AS( expr, exceptionType ) INTERNAL_CATCH_THROWS_AS( "CATCH_REQUIRE_THROWS_AS", exceptionType, Catch::ResultDisposition::Normal, expr ) +#define CATCH_REQUIRE_THROWS_WITH( expr, matcher ) INTERNAL_CATCH_THROWS_STR_MATCHES( "CATCH_REQUIRE_THROWS_WITH", Catch::ResultDisposition::Normal, matcher, expr ) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CATCH_REQUIRE_THROWS_MATCHES( expr, exceptionType, matcher ) INTERNAL_CATCH_THROWS_MATCHES( "CATCH_REQUIRE_THROWS_MATCHES", exceptionType, Catch::ResultDisposition::Normal, matcher, expr ) +#endif// CATCH_CONFIG_DISABLE_MATCHERS +#define CATCH_REQUIRE_NOTHROW( ... ) INTERNAL_CATCH_NO_THROW( "CATCH_REQUIRE_NOTHROW", Catch::ResultDisposition::Normal, __VA_ARGS__ ) + +#define CATCH_CHECK( ... ) INTERNAL_CATCH_TEST( "CATCH_CHECK", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CATCH_CHECK_FALSE( ... ) INTERNAL_CATCH_TEST( "CATCH_CHECK_FALSE", Catch::ResultDisposition::ContinueOnFailure | Catch::ResultDisposition::FalseTest, __VA_ARGS__ ) +#define CATCH_CHECKED_IF( ... ) INTERNAL_CATCH_IF( "CATCH_CHECKED_IF", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CATCH_CHECKED_ELSE( ... ) INTERNAL_CATCH_ELSE( "CATCH_CHECKED_ELSE", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CATCH_CHECK_NOFAIL( ... ) INTERNAL_CATCH_TEST( "CATCH_CHECK_NOFAIL", Catch::ResultDisposition::ContinueOnFailure | Catch::ResultDisposition::SuppressFail, __VA_ARGS__ ) + +#define CATCH_CHECK_THROWS( ... ) INTERNAL_CATCH_THROWS( "CATCH_CHECK_THROWS", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CATCH_CHECK_THROWS_AS( expr, exceptionType ) INTERNAL_CATCH_THROWS_AS( "CATCH_CHECK_THROWS_AS", exceptionType, Catch::ResultDisposition::ContinueOnFailure, expr ) +#define CATCH_CHECK_THROWS_WITH( expr, matcher ) INTERNAL_CATCH_THROWS_STR_MATCHES( "CATCH_CHECK_THROWS_WITH", Catch::ResultDisposition::ContinueOnFailure, matcher, expr ) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CATCH_CHECK_THROWS_MATCHES( expr, exceptionType, matcher ) INTERNAL_CATCH_THROWS_MATCHES( "CATCH_CHECK_THROWS_MATCHES", exceptionType, Catch::ResultDisposition::ContinueOnFailure, matcher, expr ) +#endif // CATCH_CONFIG_DISABLE_MATCHERS +#define CATCH_CHECK_NOTHROW( ... ) INTERNAL_CATCH_NO_THROW( "CATCH_CHECK_NOTHROW", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) + +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CATCH_CHECK_THAT( arg, matcher ) INTERNAL_CHECK_THAT( "CATCH_CHECK_THAT", matcher, Catch::ResultDisposition::ContinueOnFailure, arg ) + +#define CATCH_REQUIRE_THAT( arg, matcher ) INTERNAL_CHECK_THAT( "CATCH_REQUIRE_THAT", matcher, Catch::ResultDisposition::Normal, arg ) +#endif // CATCH_CONFIG_DISABLE_MATCHERS + +#define CATCH_INFO( msg ) INTERNAL_CATCH_INFO( "CATCH_INFO", msg ) +#define CATCH_WARN( msg ) INTERNAL_CATCH_MSG( "CATCH_WARN", Catch::ResultWas::Warning, Catch::ResultDisposition::ContinueOnFailure, msg ) +#define CATCH_CAPTURE( ... ) INTERNAL_CATCH_CAPTURE( INTERNAL_CATCH_UNIQUE_NAME(capturer), "CATCH_CAPTURE",__VA_ARGS__ ) + +#define CATCH_TEST_CASE( ... ) INTERNAL_CATCH_TESTCASE( __VA_ARGS__ ) +#define CATCH_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#define CATCH_METHOD_AS_TEST_CASE( method, ... ) INTERNAL_CATCH_METHOD_AS_TEST_CASE( method, __VA_ARGS__ ) +#define CATCH_REGISTER_TEST_CASE( Function, ... ) INTERNAL_CATCH_REGISTER_TESTCASE( Function, __VA_ARGS__ ) +#define CATCH_SECTION( ... ) INTERNAL_CATCH_SECTION( __VA_ARGS__ ) +#define CATCH_DYNAMIC_SECTION( ... ) INTERNAL_CATCH_DYNAMIC_SECTION( __VA_ARGS__ ) +#define CATCH_FAIL( ... ) INTERNAL_CATCH_MSG( "CATCH_FAIL", Catch::ResultWas::ExplicitFailure, Catch::ResultDisposition::Normal, __VA_ARGS__ ) +#define CATCH_FAIL_CHECK( ... ) INTERNAL_CATCH_MSG( "CATCH_FAIL_CHECK", Catch::ResultWas::ExplicitFailure, Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CATCH_SUCCEED( ... ) INTERNAL_CATCH_MSG( "CATCH_SUCCEED", Catch::ResultWas::Ok, Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) + +#define CATCH_ANON_TEST_CASE() INTERNAL_CATCH_TESTCASE() + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define CATCH_TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE( __VA_ARGS__ ) +#define CATCH_TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE( ... ) INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE( __VA_ARGS__ ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#else +#define CATCH_TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE( __VA_ARGS__ ) ) +#define CATCH_TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE( ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE( __VA_ARGS__ ) ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, __VA_ARGS__ ) ) +#endif + +#if !defined(CATCH_CONFIG_RUNTIME_STATIC_REQUIRE) +#define CATCH_STATIC_REQUIRE( ... ) static_assert( __VA_ARGS__ , #__VA_ARGS__ ); CATCH_SUCCEED( #__VA_ARGS__ ) +#define CATCH_STATIC_REQUIRE_FALSE( ... ) static_assert( !(__VA_ARGS__), "!(" #__VA_ARGS__ ")" ); CATCH_SUCCEED( #__VA_ARGS__ ) +#else +#define CATCH_STATIC_REQUIRE( ... ) CATCH_REQUIRE( __VA_ARGS__ ) +#define CATCH_STATIC_REQUIRE_FALSE( ... ) CATCH_REQUIRE_FALSE( __VA_ARGS__ ) +#endif + +// "BDD-style" convenience wrappers +#define CATCH_SCENARIO( ... ) CATCH_TEST_CASE( "Scenario: " __VA_ARGS__ ) +#define CATCH_SCENARIO_METHOD( className, ... ) INTERNAL_CATCH_TEST_CASE_METHOD( className, "Scenario: " __VA_ARGS__ ) +#define CATCH_GIVEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " Given: " << desc ) +#define CATCH_AND_GIVEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( "And given: " << desc ) +#define CATCH_WHEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " When: " << desc ) +#define CATCH_AND_WHEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " And when: " << desc ) +#define CATCH_THEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " Then: " << desc ) +#define CATCH_AND_THEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " And: " << desc ) + +// If CATCH_CONFIG_PREFIX_ALL is not defined then the CATCH_ prefix is not required +#else + +#define REQUIRE( ... ) INTERNAL_CATCH_TEST( "REQUIRE", Catch::ResultDisposition::Normal, __VA_ARGS__ ) +#define REQUIRE_FALSE( ... ) INTERNAL_CATCH_TEST( "REQUIRE_FALSE", Catch::ResultDisposition::Normal | Catch::ResultDisposition::FalseTest, __VA_ARGS__ ) + +#define REQUIRE_THROWS( ... ) INTERNAL_CATCH_THROWS( "REQUIRE_THROWS", Catch::ResultDisposition::Normal, __VA_ARGS__ ) +#define REQUIRE_THROWS_AS( expr, exceptionType ) INTERNAL_CATCH_THROWS_AS( "REQUIRE_THROWS_AS", exceptionType, Catch::ResultDisposition::Normal, expr ) +#define REQUIRE_THROWS_WITH( expr, matcher ) INTERNAL_CATCH_THROWS_STR_MATCHES( "REQUIRE_THROWS_WITH", Catch::ResultDisposition::Normal, matcher, expr ) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define REQUIRE_THROWS_MATCHES( expr, exceptionType, matcher ) INTERNAL_CATCH_THROWS_MATCHES( "REQUIRE_THROWS_MATCHES", exceptionType, Catch::ResultDisposition::Normal, matcher, expr ) +#endif // CATCH_CONFIG_DISABLE_MATCHERS +#define REQUIRE_NOTHROW( ... ) INTERNAL_CATCH_NO_THROW( "REQUIRE_NOTHROW", Catch::ResultDisposition::Normal, __VA_ARGS__ ) + +#define CHECK( ... ) INTERNAL_CATCH_TEST( "CHECK", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CHECK_FALSE( ... ) INTERNAL_CATCH_TEST( "CHECK_FALSE", Catch::ResultDisposition::ContinueOnFailure | Catch::ResultDisposition::FalseTest, __VA_ARGS__ ) +#define CHECKED_IF( ... ) INTERNAL_CATCH_IF( "CHECKED_IF", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CHECKED_ELSE( ... ) INTERNAL_CATCH_ELSE( "CHECKED_ELSE", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CHECK_NOFAIL( ... ) INTERNAL_CATCH_TEST( "CHECK_NOFAIL", Catch::ResultDisposition::ContinueOnFailure | Catch::ResultDisposition::SuppressFail, __VA_ARGS__ ) + +#define CHECK_THROWS( ... ) INTERNAL_CATCH_THROWS( "CHECK_THROWS", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CHECK_THROWS_AS( expr, exceptionType ) INTERNAL_CATCH_THROWS_AS( "CHECK_THROWS_AS", exceptionType, Catch::ResultDisposition::ContinueOnFailure, expr ) +#define CHECK_THROWS_WITH( expr, matcher ) INTERNAL_CATCH_THROWS_STR_MATCHES( "CHECK_THROWS_WITH", Catch::ResultDisposition::ContinueOnFailure, matcher, expr ) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CHECK_THROWS_MATCHES( expr, exceptionType, matcher ) INTERNAL_CATCH_THROWS_MATCHES( "CHECK_THROWS_MATCHES", exceptionType, Catch::ResultDisposition::ContinueOnFailure, matcher, expr ) +#endif // CATCH_CONFIG_DISABLE_MATCHERS +#define CHECK_NOTHROW( ... ) INTERNAL_CATCH_NO_THROW( "CHECK_NOTHROW", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) + +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CHECK_THAT( arg, matcher ) INTERNAL_CHECK_THAT( "CHECK_THAT", matcher, Catch::ResultDisposition::ContinueOnFailure, arg ) + +#define REQUIRE_THAT( arg, matcher ) INTERNAL_CHECK_THAT( "REQUIRE_THAT", matcher, Catch::ResultDisposition::Normal, arg ) +#endif // CATCH_CONFIG_DISABLE_MATCHERS + +#define INFO( msg ) INTERNAL_CATCH_INFO( "INFO", msg ) +#define UNSCOPED_INFO( msg ) INTERNAL_CATCH_UNSCOPED_INFO( "UNSCOPED_INFO", msg ) +#define WARN( msg ) INTERNAL_CATCH_MSG( "WARN", Catch::ResultWas::Warning, Catch::ResultDisposition::ContinueOnFailure, msg ) +#define CAPTURE( ... ) INTERNAL_CATCH_CAPTURE( INTERNAL_CATCH_UNIQUE_NAME(capturer), "CAPTURE",__VA_ARGS__ ) + +#define TEST_CASE( ... ) INTERNAL_CATCH_TESTCASE( __VA_ARGS__ ) +#define TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#define METHOD_AS_TEST_CASE( method, ... ) INTERNAL_CATCH_METHOD_AS_TEST_CASE( method, __VA_ARGS__ ) +#define REGISTER_TEST_CASE( Function, ... ) INTERNAL_CATCH_REGISTER_TESTCASE( Function, __VA_ARGS__ ) +#define SECTION( ... ) INTERNAL_CATCH_SECTION( __VA_ARGS__ ) +#define DYNAMIC_SECTION( ... ) INTERNAL_CATCH_DYNAMIC_SECTION( __VA_ARGS__ ) +#define FAIL( ... ) INTERNAL_CATCH_MSG( "FAIL", Catch::ResultWas::ExplicitFailure, Catch::ResultDisposition::Normal, __VA_ARGS__ ) +#define FAIL_CHECK( ... ) INTERNAL_CATCH_MSG( "FAIL_CHECK", Catch::ResultWas::ExplicitFailure, Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define SUCCEED( ... ) INTERNAL_CATCH_MSG( "SUCCEED", Catch::ResultWas::Ok, Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define ANON_TEST_CASE() INTERNAL_CATCH_TESTCASE() + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE( __VA_ARGS__ ) +#define TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#define TEMPLATE_PRODUCT_TEST_CASE( ... ) INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE( __VA_ARGS__ ) +#define TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#else +#define TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE( __VA_ARGS__ ) ) +#define TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) ) +#define TEMPLATE_PRODUCT_TEST_CASE( ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE( __VA_ARGS__ ) ) +#define TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, __VA_ARGS__ ) ) +#endif + +#if !defined(CATCH_CONFIG_RUNTIME_STATIC_REQUIRE) +#define STATIC_REQUIRE( ... ) static_assert( __VA_ARGS__, #__VA_ARGS__ ); SUCCEED( #__VA_ARGS__ ) +#define STATIC_REQUIRE_FALSE( ... ) static_assert( !(__VA_ARGS__), "!(" #__VA_ARGS__ ")" ); SUCCEED( "!(" #__VA_ARGS__ ")" ) +#else +#define STATIC_REQUIRE( ... ) REQUIRE( __VA_ARGS__ ) +#define STATIC_REQUIRE_FALSE( ... ) REQUIRE_FALSE( __VA_ARGS__ ) +#endif + +#endif + +#define CATCH_TRANSLATE_EXCEPTION( signature ) INTERNAL_CATCH_TRANSLATE_EXCEPTION( signature ) + +// "BDD-style" convenience wrappers +#define SCENARIO( ... ) TEST_CASE( "Scenario: " __VA_ARGS__ ) +#define SCENARIO_METHOD( className, ... ) INTERNAL_CATCH_TEST_CASE_METHOD( className, "Scenario: " __VA_ARGS__ ) + +#define GIVEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " Given: " << desc ) +#define AND_GIVEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( "And given: " << desc ) +#define WHEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " When: " << desc ) +#define AND_WHEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " And when: " << desc ) +#define THEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " Then: " << desc ) +#define AND_THEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " And: " << desc ) + +using Catch::Detail::Approx; + +#else // CATCH_CONFIG_DISABLE + +////// +// If this config identifier is defined then all CATCH macros are prefixed with CATCH_ +#ifdef CATCH_CONFIG_PREFIX_ALL + +#define CATCH_REQUIRE( ... ) (void)(0) +#define CATCH_REQUIRE_FALSE( ... ) (void)(0) + +#define CATCH_REQUIRE_THROWS( ... ) (void)(0) +#define CATCH_REQUIRE_THROWS_AS( expr, exceptionType ) (void)(0) +#define CATCH_REQUIRE_THROWS_WITH( expr, matcher ) (void)(0) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CATCH_REQUIRE_THROWS_MATCHES( expr, exceptionType, matcher ) (void)(0) +#endif// CATCH_CONFIG_DISABLE_MATCHERS +#define CATCH_REQUIRE_NOTHROW( ... ) (void)(0) + +#define CATCH_CHECK( ... ) (void)(0) +#define CATCH_CHECK_FALSE( ... ) (void)(0) +#define CATCH_CHECKED_IF( ... ) if (__VA_ARGS__) +#define CATCH_CHECKED_ELSE( ... ) if (!(__VA_ARGS__)) +#define CATCH_CHECK_NOFAIL( ... ) (void)(0) + +#define CATCH_CHECK_THROWS( ... ) (void)(0) +#define CATCH_CHECK_THROWS_AS( expr, exceptionType ) (void)(0) +#define CATCH_CHECK_THROWS_WITH( expr, matcher ) (void)(0) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CATCH_CHECK_THROWS_MATCHES( expr, exceptionType, matcher ) (void)(0) +#endif // CATCH_CONFIG_DISABLE_MATCHERS +#define CATCH_CHECK_NOTHROW( ... ) (void)(0) + +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CATCH_CHECK_THAT( arg, matcher ) (void)(0) + +#define CATCH_REQUIRE_THAT( arg, matcher ) (void)(0) +#endif // CATCH_CONFIG_DISABLE_MATCHERS + +#define CATCH_INFO( msg ) (void)(0) +#define CATCH_WARN( msg ) (void)(0) +#define CATCH_CAPTURE( msg ) (void)(0) + +#define CATCH_TEST_CASE( ... ) INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )) +#define CATCH_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )) +#define CATCH_METHOD_AS_TEST_CASE( method, ... ) +#define CATCH_REGISTER_TEST_CASE( Function, ... ) (void)(0) +#define CATCH_SECTION( ... ) +#define CATCH_DYNAMIC_SECTION( ... ) +#define CATCH_FAIL( ... ) (void)(0) +#define CATCH_FAIL_CHECK( ... ) (void)(0) +#define CATCH_SUCCEED( ... ) (void)(0) + +#define CATCH_ANON_TEST_CASE() INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )) + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define CATCH_TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ) ) +#define CATCH_TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), className ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE( ... ) CATCH_TEMPLATE_TEST_CASE( __VA_ARGS__ ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) CATCH_TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#else +#define CATCH_TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ) ) ) +#define CATCH_TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), className ) ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE( ... ) CATCH_TEMPLATE_TEST_CASE( __VA_ARGS__ ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) CATCH_TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#endif + +// "BDD-style" convenience wrappers +#define CATCH_SCENARIO( ... ) INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )) +#define CATCH_SCENARIO_METHOD( className, ... ) INTERNAL_CATCH_TESTCASE_METHOD_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ ), className ) +#define CATCH_GIVEN( desc ) +#define CATCH_AND_GIVEN( desc ) +#define CATCH_WHEN( desc ) +#define CATCH_AND_WHEN( desc ) +#define CATCH_THEN( desc ) +#define CATCH_AND_THEN( desc ) + +#define CATCH_STATIC_REQUIRE( ... ) (void)(0) +#define CATCH_STATIC_REQUIRE_FALSE( ... ) (void)(0) + +// If CATCH_CONFIG_PREFIX_ALL is not defined then the CATCH_ prefix is not required +#else + +#define REQUIRE( ... ) (void)(0) +#define REQUIRE_FALSE( ... ) (void)(0) + +#define REQUIRE_THROWS( ... ) (void)(0) +#define REQUIRE_THROWS_AS( expr, exceptionType ) (void)(0) +#define REQUIRE_THROWS_WITH( expr, matcher ) (void)(0) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define REQUIRE_THROWS_MATCHES( expr, exceptionType, matcher ) (void)(0) +#endif // CATCH_CONFIG_DISABLE_MATCHERS +#define REQUIRE_NOTHROW( ... ) (void)(0) + +#define CHECK( ... ) (void)(0) +#define CHECK_FALSE( ... ) (void)(0) +#define CHECKED_IF( ... ) if (__VA_ARGS__) +#define CHECKED_ELSE( ... ) if (!(__VA_ARGS__)) +#define CHECK_NOFAIL( ... ) (void)(0) + +#define CHECK_THROWS( ... ) (void)(0) +#define CHECK_THROWS_AS( expr, exceptionType ) (void)(0) +#define CHECK_THROWS_WITH( expr, matcher ) (void)(0) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CHECK_THROWS_MATCHES( expr, exceptionType, matcher ) (void)(0) +#endif // CATCH_CONFIG_DISABLE_MATCHERS +#define CHECK_NOTHROW( ... ) (void)(0) + +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CHECK_THAT( arg, matcher ) (void)(0) + +#define REQUIRE_THAT( arg, matcher ) (void)(0) +#endif // CATCH_CONFIG_DISABLE_MATCHERS + +#define INFO( msg ) (void)(0) +#define WARN( msg ) (void)(0) +#define CAPTURE( msg ) (void)(0) + +#define TEST_CASE( ... ) INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )) +#define TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )) +#define METHOD_AS_TEST_CASE( method, ... ) +#define REGISTER_TEST_CASE( Function, ... ) (void)(0) +#define SECTION( ... ) +#define DYNAMIC_SECTION( ... ) +#define FAIL( ... ) (void)(0) +#define FAIL_CHECK( ... ) (void)(0) +#define SUCCEED( ... ) (void)(0) +#define ANON_TEST_CASE() INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )) + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ) ) +#define TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), className ) +#define TEMPLATE_PRODUCT_TEST_CASE( ... ) TEMPLATE_TEST_CASE( __VA_ARGS__ ) +#define TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#else +#define TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ) ) ) +#define TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), className ) ) +#define TEMPLATE_PRODUCT_TEST_CASE( ... ) TEMPLATE_TEST_CASE( __VA_ARGS__ ) +#define TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#endif + +#define STATIC_REQUIRE( ... ) (void)(0) +#define STATIC_REQUIRE_FALSE( ... ) (void)(0) + +#endif + +#define CATCH_TRANSLATE_EXCEPTION( signature ) INTERNAL_CATCH_TRANSLATE_EXCEPTION_NO_REG( INTERNAL_CATCH_UNIQUE_NAME( catch_internal_ExceptionTranslator ), signature ) + +// "BDD-style" convenience wrappers +#define SCENARIO( ... ) INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ ) ) +#define SCENARIO_METHOD( className, ... ) INTERNAL_CATCH_TESTCASE_METHOD_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ ), className ) + +#define GIVEN( desc ) +#define AND_GIVEN( desc ) +#define WHEN( desc ) +#define AND_WHEN( desc ) +#define THEN( desc ) +#define AND_THEN( desc ) + +using Catch::Detail::Approx; + +#endif + +#endif // ! CATCH_CONFIG_IMPL_ONLY + +// start catch_reenable_warnings.h + + +#ifdef __clang__ +# ifdef __ICC // icpc defines the __clang__ macro +# pragma warning(pop) +# else +# pragma clang diagnostic pop +# endif +#elif defined __GNUC__ +# pragma GCC diagnostic pop +#endif + +// end catch_reenable_warnings.h +// end catch.hpp +#endif // TWOBLUECUBES_SINGLE_INCLUDE_CATCH_HPP_INCLUDED + diff --git a/exercises/rna-transcription/CMakeLists.txt b/exercises/rna-transcription/CMakeLists.txt index 97f8615d..b81b3564 100644 --- a/exercises/rna-transcription/CMakeLists.txt +++ b/exercises/rna-transcription/CMakeLists.txt @@ -7,12 +7,6 @@ cmake_minimum_required(VERSION 3.1.3) # Name the project after the exercise project(${exercise} CXX) -# Locate Boost libraries: unit_test_framework and date_time -set(Boost_USE_STATIC_LIBS ON) -set(Boost_USE_MULTITHREADED ON) -set(Boost_USE_STATIC_RUNTIME OFF) -find_package(Boost 1.59 REQUIRED COMPONENTS unit_test_framework date_time) - # Get a source filename from the exercise name by replacing -'s with _'s string(REPLACE "-" "_" file ${exercise}) @@ -38,13 +32,6 @@ if("${CMAKE_CXX_COMPILER_ID}" MATCHES "(GNU|Clang)") ) endif() -# We need boost libraries -target_link_libraries(${exercise} - PRIVATE - Boost::unit_test_framework - Boost::date_time -) - # Configure to run all the tests? if(${EXERCISM_RUN_ALL_TESTS}) target_compile_definitions(${exercise} PRIVATE EXERCISM_RUN_ALL_TESTS) diff --git a/exercises/rna-transcription/rna_transcription_test.cpp b/exercises/rna-transcription/rna_transcription_test.cpp index 3b5f6390..366a2d69 100644 --- a/exercises/rna-transcription/rna_transcription_test.cpp +++ b/exercises/rna-transcription/rna_transcription_test.cpp @@ -1,30 +1,30 @@ #include "rna_transcription.h" -#define BOOST_TEST_MAIN -#include +#define CATCH_CONFIG_MAIN +#include "test/catch.hpp" -BOOST_AUTO_TEST_CASE(transcribes_cytidine_to_guanosine) +TEST_CASE("transcribes_cytidine_to_guanosine") { - BOOST_REQUIRE_EQUAL('G', transcription::to_rna('C')); + REQUIRE('G' == transcription::to_rna('C')); } #if defined(EXERCISM_RUN_ALL_TESTS) -BOOST_AUTO_TEST_CASE(transcribes_guanosine_to_cytidine) +TEST_CASE("transcribes_guanosine_to_cytidine") { - BOOST_REQUIRE_EQUAL('C', transcription::to_rna('G')); + REQUIRE('C' == transcription::to_rna('G')); } -BOOST_AUTO_TEST_CASE(transcribes_adenosine_to_uracil) +TEST_CASE("transcribes_adenosine_to_uracil") { - BOOST_REQUIRE_EQUAL('U', transcription::to_rna('A')); + REQUIRE('U' == transcription::to_rna('A')); } -BOOST_AUTO_TEST_CASE(transcribes_thymidine_to_adenosine) +TEST_CASE("transcribes_thymidine_to_adenosine") { - BOOST_REQUIRE_EQUAL('A', transcription::to_rna('T')); + REQUIRE('A' == transcription::to_rna('T')); } -BOOST_AUTO_TEST_CASE(transcribes_all_dna_nucleotides_to_their_rna_complements) +TEST_CASE("transcribes_all_dna_nucleotides_to_their_rna_complements") { - BOOST_REQUIRE_EQUAL("UGCACCAGAAUU", transcription::to_rna("ACGTGGTCTTAA")); + REQUIRE("UGCACCAGAAUU" == transcription::to_rna("ACGTGGTCTTAA")); } #endif diff --git a/exercises/rna-transcription/test/catch.hpp b/exercises/rna-transcription/test/catch.hpp new file mode 100644 index 00000000..1850fff1 --- /dev/null +++ b/exercises/rna-transcription/test/catch.hpp @@ -0,0 +1,14934 @@ +/* + * Catch v2.7.0 + * Generated: 2019-03-07 21:34:30.252164 + * ---------------------------------------------------------- + * This file has been merged from multiple headers. Please don't edit it directly + * Copyright (c) 2019 Two Blue Cubes Ltd. All rights reserved. + * + * Distributed under the Boost Software License, Version 1.0. (See accompanying + * file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt) + */ +#ifndef TWOBLUECUBES_SINGLE_INCLUDE_CATCH_HPP_INCLUDED +#define TWOBLUECUBES_SINGLE_INCLUDE_CATCH_HPP_INCLUDED +// start catch.hpp + + +#define CATCH_VERSION_MAJOR 2 +#define CATCH_VERSION_MINOR 7 +#define CATCH_VERSION_PATCH 0 + +#ifdef __clang__ +# pragma clang system_header +#elif defined __GNUC__ +# pragma GCC system_header +#endif + +// start catch_suppress_warnings.h + +#ifdef __clang__ +# ifdef __ICC // icpc defines the __clang__ macro +# pragma warning(push) +# pragma warning(disable: 161 1682) +# else // __ICC +# pragma clang diagnostic push +# pragma clang diagnostic ignored "-Wpadded" +# pragma clang diagnostic ignored "-Wswitch-enum" +# pragma clang diagnostic ignored "-Wcovered-switch-default" +# endif +#elif defined __GNUC__ + // Because REQUIREs trigger GCC's -Wparentheses, and because still + // supported version of g++ have only buggy support for _Pragmas, + // Wparentheses have to be suppressed globally. +# pragma GCC diagnostic ignored "-Wparentheses" // See #674 for details + +# pragma GCC diagnostic push +# pragma GCC diagnostic ignored "-Wunused-variable" +# pragma GCC diagnostic ignored "-Wpadded" +#endif +// end catch_suppress_warnings.h +#if defined(CATCH_CONFIG_MAIN) || defined(CATCH_CONFIG_RUNNER) +# define CATCH_IMPL +# define CATCH_CONFIG_ALL_PARTS +#endif + +// In the impl file, we want to have access to all parts of the headers +// Can also be used to sanely support PCHs +#if defined(CATCH_CONFIG_ALL_PARTS) +# define CATCH_CONFIG_EXTERNAL_INTERFACES +# if defined(CATCH_CONFIG_DISABLE_MATCHERS) +# undef CATCH_CONFIG_DISABLE_MATCHERS +# endif +# if !defined(CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER) +# define CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER +# endif +#endif + +#if !defined(CATCH_CONFIG_IMPL_ONLY) +// start catch_platform.h + +#ifdef __APPLE__ +# include +# if TARGET_OS_OSX == 1 +# define CATCH_PLATFORM_MAC +# elif TARGET_OS_IPHONE == 1 +# define CATCH_PLATFORM_IPHONE +# endif + +#elif defined(linux) || defined(__linux) || defined(__linux__) +# define CATCH_PLATFORM_LINUX + +#elif defined(WIN32) || defined(__WIN32__) || defined(_WIN32) || defined(_MSC_VER) || defined(__MINGW32__) +# define CATCH_PLATFORM_WINDOWS +#endif + +// end catch_platform.h + +#ifdef CATCH_IMPL +# ifndef CLARA_CONFIG_MAIN +# define CLARA_CONFIG_MAIN_NOT_DEFINED +# define CLARA_CONFIG_MAIN +# endif +#endif + +// start catch_user_interfaces.h + +namespace Catch { + unsigned int rngSeed(); +} + +// end catch_user_interfaces.h +// start catch_tag_alias_autoregistrar.h + +// start catch_common.h + +// start catch_compiler_capabilities.h + +// Detect a number of compiler features - by compiler +// The following features are defined: +// +// CATCH_CONFIG_COUNTER : is the __COUNTER__ macro supported? +// CATCH_CONFIG_WINDOWS_SEH : is Windows SEH supported? +// CATCH_CONFIG_POSIX_SIGNALS : are POSIX signals supported? +// CATCH_CONFIG_DISABLE_EXCEPTIONS : Are exceptions enabled? +// **************** +// Note to maintainers: if new toggles are added please document them +// in configuration.md, too +// **************** + +// In general each macro has a _NO_ form +// (e.g. CATCH_CONFIG_NO_POSIX_SIGNALS) which disables the feature. +// Many features, at point of detection, define an _INTERNAL_ macro, so they +// can be combined, en-mass, with the _NO_ forms later. + +#ifdef __cplusplus + +# if (__cplusplus >= 201402L) || (defined(_MSVC_LANG) && _MSVC_LANG >= 201402L) +# define CATCH_CPP14_OR_GREATER +# endif + +# if (__cplusplus >= 201703L) || (defined(_MSVC_LANG) && _MSVC_LANG >= 201703L) +# define CATCH_CPP17_OR_GREATER +# endif + +#endif + +#if defined(CATCH_CPP17_OR_GREATER) +# define CATCH_INTERNAL_CONFIG_CPP17_UNCAUGHT_EXCEPTIONS +#endif + +#ifdef __clang__ + +# define CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + _Pragma( "clang diagnostic push" ) \ + _Pragma( "clang diagnostic ignored \"-Wexit-time-destructors\"" ) \ + _Pragma( "clang diagnostic ignored \"-Wglobal-constructors\"") +# define CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS \ + _Pragma( "clang diagnostic pop" ) + +# define CATCH_INTERNAL_SUPPRESS_PARENTHESES_WARNINGS \ + _Pragma( "clang diagnostic push" ) \ + _Pragma( "clang diagnostic ignored \"-Wparentheses\"" ) +# define CATCH_INTERNAL_UNSUPPRESS_PARENTHESES_WARNINGS \ + _Pragma( "clang diagnostic pop" ) + +# define CATCH_INTERNAL_SUPPRESS_UNUSED_WARNINGS \ + _Pragma( "clang diagnostic push" ) \ + _Pragma( "clang diagnostic ignored \"-Wunused-variable\"" ) +# define CATCH_INTERNAL_UNSUPPRESS_UNUSED_WARNINGS \ + _Pragma( "clang diagnostic pop" ) + +#endif // __clang__ + +//////////////////////////////////////////////////////////////////////////////// +// Assume that non-Windows platforms support posix signals by default +#if !defined(CATCH_PLATFORM_WINDOWS) + #define CATCH_INTERNAL_CONFIG_POSIX_SIGNALS +#endif + +//////////////////////////////////////////////////////////////////////////////// +// We know some environments not to support full POSIX signals +#if defined(__CYGWIN__) || defined(__QNX__) || defined(__EMSCRIPTEN__) || defined(__DJGPP__) + #define CATCH_INTERNAL_CONFIG_NO_POSIX_SIGNALS +#endif + +#ifdef __OS400__ +# define CATCH_INTERNAL_CONFIG_NO_POSIX_SIGNALS +# define CATCH_CONFIG_COLOUR_NONE +#endif + +//////////////////////////////////////////////////////////////////////////////// +// Android somehow still does not support std::to_string +#if defined(__ANDROID__) +# define CATCH_INTERNAL_CONFIG_NO_CPP11_TO_STRING +#endif + +//////////////////////////////////////////////////////////////////////////////// +// Not all Windows environments support SEH properly +#if defined(__MINGW32__) +# define CATCH_INTERNAL_CONFIG_NO_WINDOWS_SEH +#endif + +//////////////////////////////////////////////////////////////////////////////// +// PS4 +#if defined(__ORBIS__) +# define CATCH_INTERNAL_CONFIG_NO_NEW_CAPTURE +#endif + +//////////////////////////////////////////////////////////////////////////////// +// Cygwin +#ifdef __CYGWIN__ + +// Required for some versions of Cygwin to declare gettimeofday +// see: http://stackoverflow.com/questions/36901803/gettimeofday-not-declared-in-this-scope-cygwin +# define _BSD_SOURCE +// some versions of cygwin (most) do not support std::to_string. Use the libstd check. +// https://gcc.gnu.org/onlinedocs/gcc-4.8.2/libstdc++/api/a01053_source.html line 2812-2813 +# if !((__cplusplus >= 201103L) && defined(_GLIBCXX_USE_C99) \ + && !defined(_GLIBCXX_HAVE_BROKEN_VSWPRINTF)) + +# define CATCH_INTERNAL_CONFIG_NO_CPP11_TO_STRING + +# endif +#endif // __CYGWIN__ + +//////////////////////////////////////////////////////////////////////////////// +// Visual C++ +#ifdef _MSC_VER + +# if _MSC_VER >= 1900 // Visual Studio 2015 or newer +# define CATCH_INTERNAL_CONFIG_CPP17_UNCAUGHT_EXCEPTIONS +# endif + +// Universal Windows platform does not support SEH +// Or console colours (or console at all...) +# if defined(WINAPI_FAMILY) && (WINAPI_FAMILY == WINAPI_FAMILY_APP) +# define CATCH_CONFIG_COLOUR_NONE +# else +# define CATCH_INTERNAL_CONFIG_WINDOWS_SEH +# endif + +// MSVC traditional preprocessor needs some workaround for __VA_ARGS__ +// _MSVC_TRADITIONAL == 0 means new conformant preprocessor +// _MSVC_TRADITIONAL == 1 means old traditional non-conformant preprocessor +# if !defined(_MSVC_TRADITIONAL) || (defined(_MSVC_TRADITIONAL) && _MSVC_TRADITIONAL) +# define CATCH_INTERNAL_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +# endif + +#endif // _MSC_VER + +//////////////////////////////////////////////////////////////////////////////// +// Check if we are compiled with -fno-exceptions or equivalent +#if defined(__EXCEPTIONS) || defined(__cpp_exceptions) || defined(_CPPUNWIND) +# define CATCH_INTERNAL_CONFIG_EXCEPTIONS_ENABLED +#endif + +//////////////////////////////////////////////////////////////////////////////// +// DJGPP +#ifdef __DJGPP__ +# define CATCH_INTERNAL_CONFIG_NO_WCHAR +#endif // __DJGPP__ + +//////////////////////////////////////////////////////////////////////////////// +// Embarcadero C++Build +#if defined(__BORLANDC__) + #define CATCH_INTERNAL_CONFIG_POLYFILL_ISNAN +#endif + +//////////////////////////////////////////////////////////////////////////////// + +// Use of __COUNTER__ is suppressed during code analysis in +// CLion/AppCode 2017.2.x and former, because __COUNTER__ is not properly +// handled by it. +// Otherwise all supported compilers support COUNTER macro, +// but user still might want to turn it off +#if ( !defined(__JETBRAINS_IDE__) || __JETBRAINS_IDE__ >= 20170300L ) + #define CATCH_INTERNAL_CONFIG_COUNTER +#endif + +//////////////////////////////////////////////////////////////////////////////// +// Check if string_view is available and usable +// The check is split apart to work around v140 (VS2015) preprocessor issue... +#if defined(__has_include) +#if __has_include() && defined(CATCH_CPP17_OR_GREATER) +# define CATCH_INTERNAL_CONFIG_CPP17_STRING_VIEW +#endif +#endif + +//////////////////////////////////////////////////////////////////////////////// +// Check if optional is available and usable +#if defined(__has_include) +# if __has_include() && defined(CATCH_CPP17_OR_GREATER) +# define CATCH_INTERNAL_CONFIG_CPP17_OPTIONAL +# endif // __has_include() && defined(CATCH_CPP17_OR_GREATER) +#endif // __has_include + +//////////////////////////////////////////////////////////////////////////////// +// Check if variant is available and usable +#if defined(__has_include) +# if __has_include() && defined(CATCH_CPP17_OR_GREATER) +# if defined(__clang__) && (__clang_major__ < 8) + // work around clang bug with libstdc++ https://bugs.llvm.org/show_bug.cgi?id=31852 + // fix should be in clang 8, workaround in libstdc++ 8.2 +# include +# if defined(__GLIBCXX__) && defined(_GLIBCXX_RELEASE) && (_GLIBCXX_RELEASE < 9) +# define CATCH_CONFIG_NO_CPP17_VARIANT +# else +# define CATCH_INTERNAL_CONFIG_CPP17_VARIANT +# endif // defined(__GLIBCXX__) && defined(_GLIBCXX_RELEASE) && (_GLIBCXX_RELEASE < 9) +# else +# define CATCH_INTERNAL_CONFIG_CPP17_VARIANT +# endif // defined(__clang__) && (__clang_major__ < 8) +# endif // __has_include() && defined(CATCH_CPP17_OR_GREATER) +#endif // __has_include + +#if defined(CATCH_INTERNAL_CONFIG_COUNTER) && !defined(CATCH_CONFIG_NO_COUNTER) && !defined(CATCH_CONFIG_COUNTER) +# define CATCH_CONFIG_COUNTER +#endif +#if defined(CATCH_INTERNAL_CONFIG_WINDOWS_SEH) && !defined(CATCH_CONFIG_NO_WINDOWS_SEH) && !defined(CATCH_CONFIG_WINDOWS_SEH) && !defined(CATCH_INTERNAL_CONFIG_NO_WINDOWS_SEH) +# define CATCH_CONFIG_WINDOWS_SEH +#endif +// This is set by default, because we assume that unix compilers are posix-signal-compatible by default. +#if defined(CATCH_INTERNAL_CONFIG_POSIX_SIGNALS) && !defined(CATCH_INTERNAL_CONFIG_NO_POSIX_SIGNALS) && !defined(CATCH_CONFIG_NO_POSIX_SIGNALS) && !defined(CATCH_CONFIG_POSIX_SIGNALS) +# define CATCH_CONFIG_POSIX_SIGNALS +#endif +// This is set by default, because we assume that compilers with no wchar_t support are just rare exceptions. +#if !defined(CATCH_INTERNAL_CONFIG_NO_WCHAR) && !defined(CATCH_CONFIG_NO_WCHAR) && !defined(CATCH_CONFIG_WCHAR) +# define CATCH_CONFIG_WCHAR +#endif + +#if !defined(CATCH_INTERNAL_CONFIG_NO_CPP11_TO_STRING) && !defined(CATCH_CONFIG_NO_CPP11_TO_STRING) && !defined(CATCH_CONFIG_CPP11_TO_STRING) +# define CATCH_CONFIG_CPP11_TO_STRING +#endif + +#if defined(CATCH_INTERNAL_CONFIG_CPP17_OPTIONAL) && !defined(CATCH_CONFIG_NO_CPP17_OPTIONAL) && !defined(CATCH_CONFIG_CPP17_OPTIONAL) +# define CATCH_CONFIG_CPP17_OPTIONAL +#endif + +#if defined(CATCH_INTERNAL_CONFIG_CPP17_UNCAUGHT_EXCEPTIONS) && !defined(CATCH_CONFIG_NO_CPP17_UNCAUGHT_EXCEPTIONS) && !defined(CATCH_CONFIG_CPP17_UNCAUGHT_EXCEPTIONS) +# define CATCH_CONFIG_CPP17_UNCAUGHT_EXCEPTIONS +#endif + +#if defined(CATCH_INTERNAL_CONFIG_CPP17_STRING_VIEW) && !defined(CATCH_CONFIG_NO_CPP17_STRING_VIEW) && !defined(CATCH_CONFIG_CPP17_STRING_VIEW) +# define CATCH_CONFIG_CPP17_STRING_VIEW +#endif + +#if defined(CATCH_INTERNAL_CONFIG_CPP17_VARIANT) && !defined(CATCH_CONFIG_NO_CPP17_VARIANT) && !defined(CATCH_CONFIG_CPP17_VARIANT) +# define CATCH_CONFIG_CPP17_VARIANT +#endif + +#if defined(CATCH_CONFIG_EXPERIMENTAL_REDIRECT) +# define CATCH_INTERNAL_CONFIG_NEW_CAPTURE +#endif + +#if defined(CATCH_INTERNAL_CONFIG_NEW_CAPTURE) && !defined(CATCH_INTERNAL_CONFIG_NO_NEW_CAPTURE) && !defined(CATCH_CONFIG_NO_NEW_CAPTURE) && !defined(CATCH_CONFIG_NEW_CAPTURE) +# define CATCH_CONFIG_NEW_CAPTURE +#endif + +#if !defined(CATCH_INTERNAL_CONFIG_EXCEPTIONS_ENABLED) && !defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) +# define CATCH_CONFIG_DISABLE_EXCEPTIONS +#endif + +#if defined(CATCH_INTERNAL_CONFIG_POLYFILL_ISNAN) && !defined(CATCH_CONFIG_NO_POLYFILL_ISNAN) && !defined(CATCH_CONFIG_POLYFILL_ISNAN) +# define CATCH_CONFIG_POLYFILL_ISNAN +#endif + +#if !defined(CATCH_INTERNAL_SUPPRESS_PARENTHESES_WARNINGS) +# define CATCH_INTERNAL_SUPPRESS_PARENTHESES_WARNINGS +# define CATCH_INTERNAL_UNSUPPRESS_PARENTHESES_WARNINGS +#endif +#if !defined(CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS) +# define CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS +# define CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS +#endif +#if !defined(CATCH_INTERNAL_SUPPRESS_UNUSED_WARNINGS) +# define CATCH_INTERNAL_SUPPRESS_UNUSED_WARNINGS +# define CATCH_INTERNAL_UNSUPPRESS_UNUSED_WARNINGS +#endif + +#if defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) +#define CATCH_TRY if ((true)) +#define CATCH_CATCH_ALL if ((false)) +#define CATCH_CATCH_ANON(type) if ((false)) +#else +#define CATCH_TRY try +#define CATCH_CATCH_ALL catch (...) +#define CATCH_CATCH_ANON(type) catch (type) +#endif + +#if defined(CATCH_INTERNAL_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR) && !defined(CATCH_CONFIG_NO_TRADITIONAL_MSVC_PREPROCESSOR) && !defined(CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR) +#define CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#endif + +// end catch_compiler_capabilities.h +#define INTERNAL_CATCH_UNIQUE_NAME_LINE2( name, line ) name##line +#define INTERNAL_CATCH_UNIQUE_NAME_LINE( name, line ) INTERNAL_CATCH_UNIQUE_NAME_LINE2( name, line ) +#ifdef CATCH_CONFIG_COUNTER +# define INTERNAL_CATCH_UNIQUE_NAME( name ) INTERNAL_CATCH_UNIQUE_NAME_LINE( name, __COUNTER__ ) +#else +# define INTERNAL_CATCH_UNIQUE_NAME( name ) INTERNAL_CATCH_UNIQUE_NAME_LINE( name, __LINE__ ) +#endif + +#include +#include +#include + +// We need a dummy global operator<< so we can bring it into Catch namespace later +struct Catch_global_namespace_dummy {}; +std::ostream& operator<<(std::ostream&, Catch_global_namespace_dummy); + +namespace Catch { + + struct CaseSensitive { enum Choice { + Yes, + No + }; }; + + class NonCopyable { + NonCopyable( NonCopyable const& ) = delete; + NonCopyable( NonCopyable && ) = delete; + NonCopyable& operator = ( NonCopyable const& ) = delete; + NonCopyable& operator = ( NonCopyable && ) = delete; + + protected: + NonCopyable(); + virtual ~NonCopyable(); + }; + + struct SourceLineInfo { + + SourceLineInfo() = delete; + SourceLineInfo( char const* _file, std::size_t _line ) noexcept + : file( _file ), + line( _line ) + {} + + SourceLineInfo( SourceLineInfo const& other ) = default; + SourceLineInfo& operator = ( SourceLineInfo const& ) = default; + SourceLineInfo( SourceLineInfo&& ) noexcept = default; + SourceLineInfo& operator = ( SourceLineInfo&& ) noexcept = default; + + bool empty() const noexcept; + bool operator == ( SourceLineInfo const& other ) const noexcept; + bool operator < ( SourceLineInfo const& other ) const noexcept; + + char const* file; + std::size_t line; + }; + + std::ostream& operator << ( std::ostream& os, SourceLineInfo const& info ); + + // Bring in operator<< from global namespace into Catch namespace + // This is necessary because the overload of operator<< above makes + // lookup stop at namespace Catch + using ::operator<<; + + // Use this in variadic streaming macros to allow + // >> +StreamEndStop + // as well as + // >> stuff +StreamEndStop + struct StreamEndStop { + std::string operator+() const; + }; + template + T const& operator + ( T const& value, StreamEndStop ) { + return value; + } +} + +#define CATCH_INTERNAL_LINEINFO \ + ::Catch::SourceLineInfo( __FILE__, static_cast( __LINE__ ) ) + +// end catch_common.h +namespace Catch { + + struct RegistrarForTagAliases { + RegistrarForTagAliases( char const* alias, char const* tag, SourceLineInfo const& lineInfo ); + }; + +} // end namespace Catch + +#define CATCH_REGISTER_TAG_ALIAS( alias, spec ) \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ Catch::RegistrarForTagAliases INTERNAL_CATCH_UNIQUE_NAME( AutoRegisterTagAlias )( alias, spec, CATCH_INTERNAL_LINEINFO ); } \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS + +// end catch_tag_alias_autoregistrar.h +// start catch_test_registry.h + +// start catch_interfaces_testcase.h + +#include + +namespace Catch { + + class TestSpec; + + struct ITestInvoker { + virtual void invoke () const = 0; + virtual ~ITestInvoker(); + }; + + class TestCase; + struct IConfig; + + struct ITestCaseRegistry { + virtual ~ITestCaseRegistry(); + virtual std::vector const& getAllTests() const = 0; + virtual std::vector const& getAllTestsSorted( IConfig const& config ) const = 0; + }; + + bool matchTest( TestCase const& testCase, TestSpec const& testSpec, IConfig const& config ); + std::vector filterTests( std::vector const& testCases, TestSpec const& testSpec, IConfig const& config ); + std::vector const& getAllTestCasesSorted( IConfig const& config ); + +} + +// end catch_interfaces_testcase.h +// start catch_stringref.h + +#include +#include +#include + +namespace Catch { + + /// A non-owning string class (similar to the forthcoming std::string_view) + /// Note that, because a StringRef may be a substring of another string, + /// it may not be null terminated. c_str() must return a null terminated + /// string, however, and so the StringRef will internally take ownership + /// (taking a copy), if necessary. In theory this ownership is not externally + /// visible - but it does mean (substring) StringRefs should not be shared between + /// threads. + class StringRef { + public: + using size_type = std::size_t; + + private: + friend struct StringRefTestAccess; + + char const* m_start; + size_type m_size; + + char* m_data = nullptr; + + void takeOwnership(); + + static constexpr char const* const s_empty = ""; + + public: // construction/ assignment + StringRef() noexcept + : StringRef( s_empty, 0 ) + {} + + StringRef( StringRef const& other ) noexcept + : m_start( other.m_start ), + m_size( other.m_size ) + {} + + StringRef( StringRef&& other ) noexcept + : m_start( other.m_start ), + m_size( other.m_size ), + m_data( other.m_data ) + { + other.m_data = nullptr; + } + + StringRef( char const* rawChars ) noexcept; + + StringRef( char const* rawChars, size_type size ) noexcept + : m_start( rawChars ), + m_size( size ) + {} + + StringRef( std::string const& stdString ) noexcept + : m_start( stdString.c_str() ), + m_size( stdString.size() ) + {} + + ~StringRef() noexcept { + delete[] m_data; + } + + auto operator = ( StringRef const &other ) noexcept -> StringRef& { + delete[] m_data; + m_data = nullptr; + m_start = other.m_start; + m_size = other.m_size; + return *this; + } + + operator std::string() const; + + void swap( StringRef& other ) noexcept; + + public: // operators + auto operator == ( StringRef const& other ) const noexcept -> bool; + auto operator != ( StringRef const& other ) const noexcept -> bool; + + auto operator[] ( size_type index ) const noexcept -> char; + + public: // named queries + auto empty() const noexcept -> bool { + return m_size == 0; + } + auto size() const noexcept -> size_type { + return m_size; + } + + auto numberOfCharacters() const noexcept -> size_type; + auto c_str() const -> char const*; + + public: // substrings and searches + auto substr( size_type start, size_type size ) const noexcept -> StringRef; + + // Returns the current start pointer. + // Note that the pointer can change when if the StringRef is a substring + auto currentData() const noexcept -> char const*; + + private: // ownership queries - may not be consistent between calls + auto isOwned() const noexcept -> bool; + auto isSubstring() const noexcept -> bool; + }; + + auto operator + ( StringRef const& lhs, StringRef const& rhs ) -> std::string; + auto operator + ( StringRef const& lhs, char const* rhs ) -> std::string; + auto operator + ( char const* lhs, StringRef const& rhs ) -> std::string; + + auto operator += ( std::string& lhs, StringRef const& sr ) -> std::string&; + auto operator << ( std::ostream& os, StringRef const& sr ) -> std::ostream&; + + inline auto operator "" _sr( char const* rawChars, std::size_t size ) noexcept -> StringRef { + return StringRef( rawChars, size ); + } + +} // namespace Catch + +inline auto operator "" _catch_sr( char const* rawChars, std::size_t size ) noexcept -> Catch::StringRef { + return Catch::StringRef( rawChars, size ); +} + +// end catch_stringref.h +// start catch_type_traits.hpp + + +#include + +namespace Catch{ + +#ifdef CATCH_CPP17_OR_GREATER + template + inline constexpr auto is_unique = std::true_type{}; + + template + inline constexpr auto is_unique = std::bool_constant< + (!std::is_same_v && ...) && is_unique + >{}; +#else + +template +struct is_unique : std::true_type{}; + +template +struct is_unique : std::integral_constant +::value + && is_unique::value + && is_unique::value +>{}; + +#endif +} + +// end catch_type_traits.hpp +// start catch_preprocessor.hpp + + +#define CATCH_RECURSION_LEVEL0(...) __VA_ARGS__ +#define CATCH_RECURSION_LEVEL1(...) CATCH_RECURSION_LEVEL0(CATCH_RECURSION_LEVEL0(CATCH_RECURSION_LEVEL0(__VA_ARGS__))) +#define CATCH_RECURSION_LEVEL2(...) CATCH_RECURSION_LEVEL1(CATCH_RECURSION_LEVEL1(CATCH_RECURSION_LEVEL1(__VA_ARGS__))) +#define CATCH_RECURSION_LEVEL3(...) CATCH_RECURSION_LEVEL2(CATCH_RECURSION_LEVEL2(CATCH_RECURSION_LEVEL2(__VA_ARGS__))) +#define CATCH_RECURSION_LEVEL4(...) CATCH_RECURSION_LEVEL3(CATCH_RECURSION_LEVEL3(CATCH_RECURSION_LEVEL3(__VA_ARGS__))) +#define CATCH_RECURSION_LEVEL5(...) CATCH_RECURSION_LEVEL4(CATCH_RECURSION_LEVEL4(CATCH_RECURSION_LEVEL4(__VA_ARGS__))) + +#ifdef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define INTERNAL_CATCH_EXPAND_VARGS(...) __VA_ARGS__ +// MSVC needs more evaluations +#define CATCH_RECURSION_LEVEL6(...) CATCH_RECURSION_LEVEL5(CATCH_RECURSION_LEVEL5(CATCH_RECURSION_LEVEL5(__VA_ARGS__))) +#define CATCH_RECURSE(...) CATCH_RECURSION_LEVEL6(CATCH_RECURSION_LEVEL6(__VA_ARGS__)) +#else +#define CATCH_RECURSE(...) CATCH_RECURSION_LEVEL5(__VA_ARGS__) +#endif + +#define CATCH_REC_END(...) +#define CATCH_REC_OUT + +#define CATCH_EMPTY() +#define CATCH_DEFER(id) id CATCH_EMPTY() + +#define CATCH_REC_GET_END2() 0, CATCH_REC_END +#define CATCH_REC_GET_END1(...) CATCH_REC_GET_END2 +#define CATCH_REC_GET_END(...) CATCH_REC_GET_END1 +#define CATCH_REC_NEXT0(test, next, ...) next CATCH_REC_OUT +#define CATCH_REC_NEXT1(test, next) CATCH_DEFER ( CATCH_REC_NEXT0 ) ( test, next, 0) +#define CATCH_REC_NEXT(test, next) CATCH_REC_NEXT1(CATCH_REC_GET_END test, next) + +#define CATCH_REC_LIST0(f, x, peek, ...) , f(x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST1) ) ( f, peek, __VA_ARGS__ ) +#define CATCH_REC_LIST1(f, x, peek, ...) , f(x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST0) ) ( f, peek, __VA_ARGS__ ) +#define CATCH_REC_LIST2(f, x, peek, ...) f(x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST1) ) ( f, peek, __VA_ARGS__ ) + +#define CATCH_REC_LIST0_UD(f, userdata, x, peek, ...) , f(userdata, x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST1_UD) ) ( f, userdata, peek, __VA_ARGS__ ) +#define CATCH_REC_LIST1_UD(f, userdata, x, peek, ...) , f(userdata, x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST0_UD) ) ( f, userdata, peek, __VA_ARGS__ ) +#define CATCH_REC_LIST2_UD(f, userdata, x, peek, ...) f(userdata, x) CATCH_DEFER ( CATCH_REC_NEXT(peek, CATCH_REC_LIST1_UD) ) ( f, userdata, peek, __VA_ARGS__ ) + +// Applies the function macro `f` to each of the remaining parameters, inserts commas between the results, +// and passes userdata as the first parameter to each invocation, +// e.g. CATCH_REC_LIST_UD(f, x, a, b, c) evaluates to f(x, a), f(x, b), f(x, c) +#define CATCH_REC_LIST_UD(f, userdata, ...) CATCH_RECURSE(CATCH_REC_LIST2_UD(f, userdata, __VA_ARGS__, ()()(), ()()(), ()()(), 0)) + +#define CATCH_REC_LIST(f, ...) CATCH_RECURSE(CATCH_REC_LIST2(f, __VA_ARGS__, ()()(), ()()(), ()()(), 0)) + +#define INTERNAL_CATCH_EXPAND1(param) INTERNAL_CATCH_EXPAND2(param) +#define INTERNAL_CATCH_EXPAND2(...) INTERNAL_CATCH_NO## __VA_ARGS__ +#define INTERNAL_CATCH_DEF(...) INTERNAL_CATCH_DEF __VA_ARGS__ +#define INTERNAL_CATCH_NOINTERNAL_CATCH_DEF +#define INTERNAL_CATCH_STRINGIZE(...) INTERNAL_CATCH_STRINGIZE2(__VA_ARGS__) +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define INTERNAL_CATCH_STRINGIZE2(...) #__VA_ARGS__ +#define INTERNAL_CATCH_STRINGIZE_WITHOUT_PARENS(param) INTERNAL_CATCH_STRINGIZE(INTERNAL_CATCH_REMOVE_PARENS(param)) +#else +// MSVC is adding extra space and needs another indirection to expand INTERNAL_CATCH_NOINTERNAL_CATCH_DEF +#define INTERNAL_CATCH_STRINGIZE2(...) INTERNAL_CATCH_STRINGIZE3(__VA_ARGS__) +#define INTERNAL_CATCH_STRINGIZE3(...) #__VA_ARGS__ +#define INTERNAL_CATCH_STRINGIZE_WITHOUT_PARENS(param) (INTERNAL_CATCH_STRINGIZE(INTERNAL_CATCH_REMOVE_PARENS(param)) + 1) +#endif + +#define INTERNAL_CATCH_REMOVE_PARENS(...) INTERNAL_CATCH_EXPAND1(INTERNAL_CATCH_DEF __VA_ARGS__) + +#define INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME2(Name, ...) INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME3(Name, __VA_ARGS__) +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME3(Name,...) Name " - " #__VA_ARGS__ +#define INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME(Name,...) INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME2(Name, INTERNAL_CATCH_REMOVE_PARENS(__VA_ARGS__)) +#else +// MSVC is adding extra space and needs more calls to properly remove () +#define INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME3(Name,...) Name " -" #__VA_ARGS__ +#define INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME1(Name, ...) INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME2(Name, __VA_ARGS__) +#define INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME(Name, ...) INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME1(Name, INTERNAL_CATCH_EXPAND_VARGS(INTERNAL_CATCH_REMOVE_PARENS(__VA_ARGS__))) +#endif + +#define INTERNAL_CATCH_MAKE_TYPE_LIST(types) Catch::TypeList + +#define INTERNAL_CATCH_MAKE_TYPE_LISTS_FROM_TYPES(types)\ + CATCH_REC_LIST(INTERNAL_CATCH_MAKE_TYPE_LIST,INTERNAL_CATCH_REMOVE_PARENS(types)) + +// end catch_preprocessor.hpp +// start catch_meta.hpp + + +#include + +namespace Catch { +template< typename... > +struct TypeList {}; + +template< typename... > +struct append; + +template< template class L1 + , typename...E1 + , template class L2 + , typename...E2 +> +struct append< L1, L2 > { + using type = L1; +}; + +template< template class L1 + , typename...E1 + , template class L2 + , typename...E2 + , typename...Rest +> +struct append< L1, L2, Rest...> { + using type = typename append< L1, Rest... >::type; +}; + +template< template class + , typename... +> +struct rewrap; + +template< template class Container + , template class List + , typename...elems +> +struct rewrap> { + using type = TypeList< Container< elems... > >; +}; + +template< template class Container + , template class List + , class...Elems + , typename...Elements> + struct rewrap, Elements...> { + using type = typename append>, typename rewrap::type>::type; +}; + +template< template class...Containers > +struct combine { + template< typename...Types > + struct with_types { + template< template class Final > + struct into { + using type = typename append, typename rewrap::type...>::type; + }; + }; +}; + +template +struct always_false : std::false_type {}; + +} // namespace Catch + +// end catch_meta.hpp +namespace Catch { + +template +class TestInvokerAsMethod : public ITestInvoker { + void (C::*m_testAsMethod)(); +public: + TestInvokerAsMethod( void (C::*testAsMethod)() ) noexcept : m_testAsMethod( testAsMethod ) {} + + void invoke() const override { + C obj; + (obj.*m_testAsMethod)(); + } +}; + +auto makeTestInvoker( void(*testAsFunction)() ) noexcept -> ITestInvoker*; + +template +auto makeTestInvoker( void (C::*testAsMethod)() ) noexcept -> ITestInvoker* { + return new(std::nothrow) TestInvokerAsMethod( testAsMethod ); +} + +struct NameAndTags { + NameAndTags( StringRef const& name_ = StringRef(), StringRef const& tags_ = StringRef() ) noexcept; + StringRef name; + StringRef tags; +}; + +struct AutoReg : NonCopyable { + AutoReg( ITestInvoker* invoker, SourceLineInfo const& lineInfo, StringRef const& classOrMethod, NameAndTags const& nameAndTags ) noexcept; + ~AutoReg(); +}; + +} // end namespace Catch + +#if defined(CATCH_CONFIG_DISABLE) + #define INTERNAL_CATCH_TESTCASE_NO_REGISTRATION( TestName, ... ) \ + static void TestName() + #define INTERNAL_CATCH_TESTCASE_METHOD_NO_REGISTRATION( TestName, ClassName, ... ) \ + namespace{ \ + struct TestName : INTERNAL_CATCH_REMOVE_PARENS(ClassName) { \ + void test(); \ + }; \ + } \ + void TestName::test() + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE_NO_REGISTRATION( TestName, ... ) \ + template \ + static void TestName() + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_NO_REGISTRATION( TestName, ClassName, ... ) \ + namespace{ \ + template \ + struct TestName : INTERNAL_CATCH_REMOVE_PARENS(ClassName ) { \ + void test(); \ + }; \ + } \ + template \ + void TestName::test() +#endif + + /////////////////////////////////////////////////////////////////////////////// + #define INTERNAL_CATCH_TESTCASE2( TestName, ... ) \ + static void TestName(); \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ Catch::AutoReg INTERNAL_CATCH_UNIQUE_NAME( autoRegistrar )( Catch::makeTestInvoker( &TestName ), CATCH_INTERNAL_LINEINFO, Catch::StringRef(), Catch::NameAndTags{ __VA_ARGS__ } ); } /* NOLINT */ \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS \ + static void TestName() + #define INTERNAL_CATCH_TESTCASE( ... ) \ + INTERNAL_CATCH_TESTCASE2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ ), __VA_ARGS__ ) + + /////////////////////////////////////////////////////////////////////////////// + #define INTERNAL_CATCH_METHOD_AS_TEST_CASE( QualifiedMethod, ... ) \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ Catch::AutoReg INTERNAL_CATCH_UNIQUE_NAME( autoRegistrar )( Catch::makeTestInvoker( &QualifiedMethod ), CATCH_INTERNAL_LINEINFO, "&" #QualifiedMethod, Catch::NameAndTags{ __VA_ARGS__ } ); } /* NOLINT */ \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS + + /////////////////////////////////////////////////////////////////////////////// + #define INTERNAL_CATCH_TEST_CASE_METHOD2( TestName, ClassName, ... )\ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ \ + struct TestName : INTERNAL_CATCH_REMOVE_PARENS(ClassName) { \ + void test(); \ + }; \ + Catch::AutoReg INTERNAL_CATCH_UNIQUE_NAME( autoRegistrar ) ( Catch::makeTestInvoker( &TestName::test ), CATCH_INTERNAL_LINEINFO, #ClassName, Catch::NameAndTags{ __VA_ARGS__ } ); /* NOLINT */ \ + } \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS \ + void TestName::test() + #define INTERNAL_CATCH_TEST_CASE_METHOD( ClassName, ... ) \ + INTERNAL_CATCH_TEST_CASE_METHOD2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ ), ClassName, __VA_ARGS__ ) + + /////////////////////////////////////////////////////////////////////////////// + #define INTERNAL_CATCH_REGISTER_TESTCASE( Function, ... ) \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + Catch::AutoReg INTERNAL_CATCH_UNIQUE_NAME( autoRegistrar )( Catch::makeTestInvoker( Function ), CATCH_INTERNAL_LINEINFO, Catch::StringRef(), Catch::NameAndTags{ __VA_ARGS__ } ); /* NOLINT */ \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS + + /////////////////////////////////////////////////////////////////////////////// + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE_2(TestName, TestFunc, Name, Tags, ... )\ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + template \ + static void TestFunc();\ + namespace {\ + template \ + struct TestName{\ + template \ + TestName(Ts...names){\ + CATCH_INTERNAL_CHECK_UNIQUE_TYPES(CATCH_REC_LIST(INTERNAL_CATCH_REMOVE_PARENS, __VA_ARGS__)) \ + using expander = int[];\ + (void)expander{(Catch::AutoReg( Catch::makeTestInvoker( &TestFunc ), CATCH_INTERNAL_LINEINFO, Catch::StringRef(), Catch::NameAndTags{ names, Tags } ), 0)... };/* NOLINT */ \ + }\ + };\ + INTERNAL_CATCH_TEMPLATE_REGISTRY_INITIATE(TestName, Name, __VA_ARGS__) \ + }\ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS \ + template \ + static void TestFunc() + +#if defined(CATCH_CPP17_OR_GREATER) +#define CATCH_INTERNAL_CHECK_UNIQUE_TYPES(...) static_assert(Catch::is_unique<__VA_ARGS__>,"Duplicate type detected in declaration of template test case"); +#else +#define CATCH_INTERNAL_CHECK_UNIQUE_TYPES(...) static_assert(Catch::is_unique<__VA_ARGS__>::value,"Duplicate type detected in declaration of template test case"); +#endif + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE(Name, Tags, ...) \ + INTERNAL_CATCH_TEMPLATE_TEST_CASE_2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____F_U_N_C____ ), Name, Tags, __VA_ARGS__ ) +#else + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE(Name, Tags, ...) \ + INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____F_U_N_C____ ), Name, Tags, __VA_ARGS__ ) ) +#endif + + #define INTERNAL_CATCH_TEMPLATE_REGISTRY_INITIATE(TestName, Name, ...)\ + static int INTERNAL_CATCH_UNIQUE_NAME( globalRegistrar ) = [](){\ + TestName(CATCH_REC_LIST_UD(INTERNAL_CATCH_TEMPLATE_UNIQUE_NAME,Name, __VA_ARGS__));\ + return 0;\ + }(); + + #define INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE2(TestName, TestFuncName, Name, Tags, TmplTypes, TypesList) \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + template static void TestFuncName(); \ + namespace { \ + template \ + struct TestName { \ + TestName() { \ + CATCH_INTERNAL_CHECK_UNIQUE_TYPES(Types...) \ + int index = 0; \ + using expander = int[]; \ + constexpr char const* tmpl_types[] = {CATCH_REC_LIST(INTERNAL_CATCH_STRINGIZE_WITHOUT_PARENS, INTERNAL_CATCH_REMOVE_PARENS(TmplTypes))};\ + constexpr char const* types_list[] = {CATCH_REC_LIST(INTERNAL_CATCH_STRINGIZE_WITHOUT_PARENS, INTERNAL_CATCH_REMOVE_PARENS(TypesList))};\ + constexpr auto num_types = sizeof(types_list) / sizeof(types_list[0]);\ + (void)expander{(Catch::AutoReg( Catch::makeTestInvoker( &TestFuncName ), CATCH_INTERNAL_LINEINFO, Catch::StringRef(), Catch::NameAndTags{ Name " - " + std::string(tmpl_types[index / num_types]) + "<" + std::string(types_list[index % num_types]) + ">", Tags } ), index++, 0)... };/* NOLINT */\ + } \ + }; \ + static int INTERNAL_CATCH_UNIQUE_NAME( globalRegistrar ) = [](){ \ + using TestInit = Catch::combine \ + ::with_types::into::type; \ + TestInit(); \ + return 0; \ + }(); \ + } \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS \ + template \ + static void TestFuncName() + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR + #define INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE(Name, Tags, ...)\ + INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE2(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____F_U_N_C____ ),Name,Tags,__VA_ARGS__) +#else + #define INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE(Name, Tags, ...)\ + INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____F_U_N_C____ ), Name, Tags, __VA_ARGS__ ) ) +#endif + + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_2( TestNameClass, TestName, ClassName, Name, Tags, ... ) \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ \ + template \ + struct TestName : INTERNAL_CATCH_REMOVE_PARENS(ClassName ) { \ + void test();\ + };\ + template \ + struct TestNameClass{\ + template \ + TestNameClass(Ts...names){\ + CATCH_INTERNAL_CHECK_UNIQUE_TYPES(CATCH_REC_LIST(INTERNAL_CATCH_REMOVE_PARENS, __VA_ARGS__)) \ + using expander = int[];\ + (void)expander{(Catch::AutoReg( Catch::makeTestInvoker( &TestName::test ), CATCH_INTERNAL_LINEINFO, #ClassName, Catch::NameAndTags{ names, Tags } ), 0)... };/* NOLINT */ \ + }\ + };\ + INTERNAL_CATCH_TEMPLATE_REGISTRY_INITIATE(TestNameClass, Name, __VA_ARGS__)\ + }\ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS\ + template \ + void TestName::test() + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD( ClassName, Name, Tags,... ) \ + INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____C_L_A_S_S____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ) , ClassName, Name, Tags, __VA_ARGS__ ) +#else + #define INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD( ClassName, Name, Tags,... ) \ + INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____C_L_A_S_S____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ) , ClassName, Name, Tags, __VA_ARGS__ ) ) +#endif + + #define INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD_2(TestNameClass, TestName, ClassName, Name, Tags, TmplTypes, TypesList)\ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + template \ + struct TestName : INTERNAL_CATCH_REMOVE_PARENS(ClassName ) { \ + void test();\ + };\ + namespace {\ + template\ + struct TestNameClass{\ + TestNameClass(){\ + CATCH_INTERNAL_CHECK_UNIQUE_TYPES(Types...)\ + int index = 0;\ + using expander = int[];\ + constexpr char const* tmpl_types[] = {CATCH_REC_LIST(INTERNAL_CATCH_STRINGIZE_WITHOUT_PARENS, INTERNAL_CATCH_REMOVE_PARENS(TmplTypes))};\ + constexpr char const* types_list[] = {CATCH_REC_LIST(INTERNAL_CATCH_STRINGIZE_WITHOUT_PARENS, INTERNAL_CATCH_REMOVE_PARENS(TypesList))};\ + constexpr auto num_types = sizeof(types_list) / sizeof(types_list[0]);\ + (void)expander{(Catch::AutoReg( Catch::makeTestInvoker( &TestName::test ), CATCH_INTERNAL_LINEINFO, #ClassName, Catch::NameAndTags{ Name " - " + std::string(tmpl_types[index / num_types]) + "<" + std::string(types_list[index % num_types]) + ">", Tags } ), index++, 0)... };/* NOLINT */ \ + }\ + };\ + static int INTERNAL_CATCH_UNIQUE_NAME( globalRegistrar ) = [](){\ + using TestInit = Catch::combine\ + ::with_types::into::type;\ + TestInit();\ + return 0;\ + }(); \ + }\ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS \ + template \ + void TestName::test() + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR + #define INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( ClassName, Name, Tags, ... )\ + INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD_2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____F_U_N_C____ ), ClassName, Name, Tags, __VA_ARGS__ ) +#else + #define INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( ClassName, Name, Tags, ... )\ + INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD_2( INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____F_U_N_C____ ), ClassName, Name, Tags, __VA_ARGS__ ) ) +#endif + +// end catch_test_registry.h +// start catch_capture.hpp + +// start catch_assertionhandler.h + +// start catch_assertioninfo.h + +// start catch_result_type.h + +namespace Catch { + + // ResultWas::OfType enum + struct ResultWas { enum OfType { + Unknown = -1, + Ok = 0, + Info = 1, + Warning = 2, + + FailureBit = 0x10, + + ExpressionFailed = FailureBit | 1, + ExplicitFailure = FailureBit | 2, + + Exception = 0x100 | FailureBit, + + ThrewException = Exception | 1, + DidntThrowException = Exception | 2, + + FatalErrorCondition = 0x200 | FailureBit + + }; }; + + bool isOk( ResultWas::OfType resultType ); + bool isJustInfo( int flags ); + + // ResultDisposition::Flags enum + struct ResultDisposition { enum Flags { + Normal = 0x01, + + ContinueOnFailure = 0x02, // Failures fail test, but execution continues + FalseTest = 0x04, // Prefix expression with ! + SuppressFail = 0x08 // Failures are reported but do not fail the test + }; }; + + ResultDisposition::Flags operator | ( ResultDisposition::Flags lhs, ResultDisposition::Flags rhs ); + + bool shouldContinueOnFailure( int flags ); + inline bool isFalseTest( int flags ) { return ( flags & ResultDisposition::FalseTest ) != 0; } + bool shouldSuppressFailure( int flags ); + +} // end namespace Catch + +// end catch_result_type.h +namespace Catch { + + struct AssertionInfo + { + StringRef macroName; + SourceLineInfo lineInfo; + StringRef capturedExpression; + ResultDisposition::Flags resultDisposition; + + // We want to delete this constructor but a compiler bug in 4.8 means + // the struct is then treated as non-aggregate + //AssertionInfo() = delete; + }; + +} // end namespace Catch + +// end catch_assertioninfo.h +// start catch_decomposer.h + +// start catch_tostring.h + +#include +#include +#include +#include +// start catch_stream.h + +#include +#include +#include + +namespace Catch { + + std::ostream& cout(); + std::ostream& cerr(); + std::ostream& clog(); + + class StringRef; + + struct IStream { + virtual ~IStream(); + virtual std::ostream& stream() const = 0; + }; + + auto makeStream( StringRef const &filename ) -> IStream const*; + + class ReusableStringStream { + std::size_t m_index; + std::ostream* m_oss; + public: + ReusableStringStream(); + ~ReusableStringStream(); + + auto str() const -> std::string; + + template + auto operator << ( T const& value ) -> ReusableStringStream& { + *m_oss << value; + return *this; + } + auto get() -> std::ostream& { return *m_oss; } + }; +} + +// end catch_stream.h + +#ifdef CATCH_CONFIG_CPP17_STRING_VIEW +#include +#endif + +#ifdef __OBJC__ +// start catch_objc_arc.hpp + +#import + +#ifdef __has_feature +#define CATCH_ARC_ENABLED __has_feature(objc_arc) +#else +#define CATCH_ARC_ENABLED 0 +#endif + +void arcSafeRelease( NSObject* obj ); +id performOptionalSelector( id obj, SEL sel ); + +#if !CATCH_ARC_ENABLED +inline void arcSafeRelease( NSObject* obj ) { + [obj release]; +} +inline id performOptionalSelector( id obj, SEL sel ) { + if( [obj respondsToSelector: sel] ) + return [obj performSelector: sel]; + return nil; +} +#define CATCH_UNSAFE_UNRETAINED +#define CATCH_ARC_STRONG +#else +inline void arcSafeRelease( NSObject* ){} +inline id performOptionalSelector( id obj, SEL sel ) { +#ifdef __clang__ +#pragma clang diagnostic push +#pragma clang diagnostic ignored "-Warc-performSelector-leaks" +#endif + if( [obj respondsToSelector: sel] ) + return [obj performSelector: sel]; +#ifdef __clang__ +#pragma clang diagnostic pop +#endif + return nil; +} +#define CATCH_UNSAFE_UNRETAINED __unsafe_unretained +#define CATCH_ARC_STRONG __strong +#endif + +// end catch_objc_arc.hpp +#endif + +#ifdef _MSC_VER +#pragma warning(push) +#pragma warning(disable:4180) // We attempt to stream a function (address) by const&, which MSVC complains about but is harmless +#endif + +namespace Catch { + namespace Detail { + + extern const std::string unprintableString; + + std::string rawMemoryToString( const void *object, std::size_t size ); + + template + std::string rawMemoryToString( const T& object ) { + return rawMemoryToString( &object, sizeof(object) ); + } + + template + class IsStreamInsertable { + template + static auto test(int) + -> decltype(std::declval() << std::declval(), std::true_type()); + + template + static auto test(...)->std::false_type; + + public: + static const bool value = decltype(test(0))::value; + }; + + template + std::string convertUnknownEnumToString( E e ); + + template + typename std::enable_if< + !std::is_enum::value && !std::is_base_of::value, + std::string>::type convertUnstreamable( T const& ) { + return Detail::unprintableString; + } + template + typename std::enable_if< + !std::is_enum::value && std::is_base_of::value, + std::string>::type convertUnstreamable(T const& ex) { + return ex.what(); + } + + template + typename std::enable_if< + std::is_enum::value + , std::string>::type convertUnstreamable( T const& value ) { + return convertUnknownEnumToString( value ); + } + +#if defined(_MANAGED) + //! Convert a CLR string to a utf8 std::string + template + std::string clrReferenceToString( T^ ref ) { + if (ref == nullptr) + return std::string("null"); + auto bytes = System::Text::Encoding::UTF8->GetBytes(ref->ToString()); + cli::pin_ptr p = &bytes[0]; + return std::string(reinterpret_cast(p), bytes->Length); + } +#endif + + } // namespace Detail + + // If we decide for C++14, change these to enable_if_ts + template + struct StringMaker { + template + static + typename std::enable_if<::Catch::Detail::IsStreamInsertable::value, std::string>::type + convert(const Fake& value) { + ReusableStringStream rss; + // NB: call using the function-like syntax to avoid ambiguity with + // user-defined templated operator<< under clang. + rss.operator<<(value); + return rss.str(); + } + + template + static + typename std::enable_if::value, std::string>::type + convert( const Fake& value ) { +#if !defined(CATCH_CONFIG_FALLBACK_STRINGIFIER) + return Detail::convertUnstreamable(value); +#else + return CATCH_CONFIG_FALLBACK_STRINGIFIER(value); +#endif + } + }; + + namespace Detail { + + // This function dispatches all stringification requests inside of Catch. + // Should be preferably called fully qualified, like ::Catch::Detail::stringify + template + std::string stringify(const T& e) { + return ::Catch::StringMaker::type>::type>::convert(e); + } + + template + std::string convertUnknownEnumToString( E e ) { + return ::Catch::Detail::stringify(static_cast::type>(e)); + } + +#if defined(_MANAGED) + template + std::string stringify( T^ e ) { + return ::Catch::StringMaker::convert(e); + } +#endif + + } // namespace Detail + + // Some predefined specializations + + template<> + struct StringMaker { + static std::string convert(const std::string& str); + }; + +#ifdef CATCH_CONFIG_CPP17_STRING_VIEW + template<> + struct StringMaker { + static std::string convert(std::string_view str); + }; +#endif + + template<> + struct StringMaker { + static std::string convert(char const * str); + }; + template<> + struct StringMaker { + static std::string convert(char * str); + }; + +#ifdef CATCH_CONFIG_WCHAR + template<> + struct StringMaker { + static std::string convert(const std::wstring& wstr); + }; + +# ifdef CATCH_CONFIG_CPP17_STRING_VIEW + template<> + struct StringMaker { + static std::string convert(std::wstring_view str); + }; +# endif + + template<> + struct StringMaker { + static std::string convert(wchar_t const * str); + }; + template<> + struct StringMaker { + static std::string convert(wchar_t * str); + }; +#endif + + // TBD: Should we use `strnlen` to ensure that we don't go out of the buffer, + // while keeping string semantics? + template + struct StringMaker { + static std::string convert(char const* str) { + return ::Catch::Detail::stringify(std::string{ str }); + } + }; + template + struct StringMaker { + static std::string convert(signed char const* str) { + return ::Catch::Detail::stringify(std::string{ reinterpret_cast(str) }); + } + }; + template + struct StringMaker { + static std::string convert(unsigned char const* str) { + return ::Catch::Detail::stringify(std::string{ reinterpret_cast(str) }); + } + }; + + template<> + struct StringMaker { + static std::string convert(int value); + }; + template<> + struct StringMaker { + static std::string convert(long value); + }; + template<> + struct StringMaker { + static std::string convert(long long value); + }; + template<> + struct StringMaker { + static std::string convert(unsigned int value); + }; + template<> + struct StringMaker { + static std::string convert(unsigned long value); + }; + template<> + struct StringMaker { + static std::string convert(unsigned long long value); + }; + + template<> + struct StringMaker { + static std::string convert(bool b); + }; + + template<> + struct StringMaker { + static std::string convert(char c); + }; + template<> + struct StringMaker { + static std::string convert(signed char c); + }; + template<> + struct StringMaker { + static std::string convert(unsigned char c); + }; + + template<> + struct StringMaker { + static std::string convert(std::nullptr_t); + }; + + template<> + struct StringMaker { + static std::string convert(float value); + }; + template<> + struct StringMaker { + static std::string convert(double value); + }; + + template + struct StringMaker { + template + static std::string convert(U* p) { + if (p) { + return ::Catch::Detail::rawMemoryToString(p); + } else { + return "nullptr"; + } + } + }; + + template + struct StringMaker { + static std::string convert(R C::* p) { + if (p) { + return ::Catch::Detail::rawMemoryToString(p); + } else { + return "nullptr"; + } + } + }; + +#if defined(_MANAGED) + template + struct StringMaker { + static std::string convert( T^ ref ) { + return ::Catch::Detail::clrReferenceToString(ref); + } + }; +#endif + + namespace Detail { + template + std::string rangeToString(InputIterator first, InputIterator last) { + ReusableStringStream rss; + rss << "{ "; + if (first != last) { + rss << ::Catch::Detail::stringify(*first); + for (++first; first != last; ++first) + rss << ", " << ::Catch::Detail::stringify(*first); + } + rss << " }"; + return rss.str(); + } + } + +#ifdef __OBJC__ + template<> + struct StringMaker { + static std::string convert(NSString * nsstring) { + if (!nsstring) + return "nil"; + return std::string("@") + [nsstring UTF8String]; + } + }; + template<> + struct StringMaker { + static std::string convert(NSObject* nsObject) { + return ::Catch::Detail::stringify([nsObject description]); + } + + }; + namespace Detail { + inline std::string stringify( NSString* nsstring ) { + return StringMaker::convert( nsstring ); + } + + } // namespace Detail +#endif // __OBJC__ + +} // namespace Catch + +////////////////////////////////////////////////////// +// Separate std-lib types stringification, so it can be selectively enabled +// This means that we do not bring in + +#if defined(CATCH_CONFIG_ENABLE_ALL_STRINGMAKERS) +# define CATCH_CONFIG_ENABLE_PAIR_STRINGMAKER +# define CATCH_CONFIG_ENABLE_TUPLE_STRINGMAKER +# define CATCH_CONFIG_ENABLE_VARIANT_STRINGMAKER +# define CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER +# define CATCH_CONFIG_ENABLE_OPTIONAL_STRINGMAKER +#endif + +// Separate std::pair specialization +#if defined(CATCH_CONFIG_ENABLE_PAIR_STRINGMAKER) +#include +namespace Catch { + template + struct StringMaker > { + static std::string convert(const std::pair& pair) { + ReusableStringStream rss; + rss << "{ " + << ::Catch::Detail::stringify(pair.first) + << ", " + << ::Catch::Detail::stringify(pair.second) + << " }"; + return rss.str(); + } + }; +} +#endif // CATCH_CONFIG_ENABLE_PAIR_STRINGMAKER + +#if defined(CATCH_CONFIG_ENABLE_OPTIONAL_STRINGMAKER) && defined(CATCH_CONFIG_CPP17_OPTIONAL) +#include +namespace Catch { + template + struct StringMaker > { + static std::string convert(const std::optional& optional) { + ReusableStringStream rss; + if (optional.has_value()) { + rss << ::Catch::Detail::stringify(*optional); + } else { + rss << "{ }"; + } + return rss.str(); + } + }; +} +#endif // CATCH_CONFIG_ENABLE_OPTIONAL_STRINGMAKER + +// Separate std::tuple specialization +#if defined(CATCH_CONFIG_ENABLE_TUPLE_STRINGMAKER) +#include +namespace Catch { + namespace Detail { + template< + typename Tuple, + std::size_t N = 0, + bool = (N < std::tuple_size::value) + > + struct TupleElementPrinter { + static void print(const Tuple& tuple, std::ostream& os) { + os << (N ? ", " : " ") + << ::Catch::Detail::stringify(std::get(tuple)); + TupleElementPrinter::print(tuple, os); + } + }; + + template< + typename Tuple, + std::size_t N + > + struct TupleElementPrinter { + static void print(const Tuple&, std::ostream&) {} + }; + + } + + template + struct StringMaker> { + static std::string convert(const std::tuple& tuple) { + ReusableStringStream rss; + rss << '{'; + Detail::TupleElementPrinter>::print(tuple, rss.get()); + rss << " }"; + return rss.str(); + } + }; +} +#endif // CATCH_CONFIG_ENABLE_TUPLE_STRINGMAKER + +#if defined(CATCH_CONFIG_ENABLE_VARIANT_STRINGMAKER) && defined(CATCH_CONFIG_CPP17_VARIANT) +#include +namespace Catch { + template<> + struct StringMaker { + static std::string convert(const std::monostate&) { + return "{ }"; + } + }; + + template + struct StringMaker> { + static std::string convert(const std::variant& variant) { + if (variant.valueless_by_exception()) { + return "{valueless variant}"; + } else { + return std::visit( + [](const auto& value) { + return ::Catch::Detail::stringify(value); + }, + variant + ); + } + } + }; +} +#endif // CATCH_CONFIG_ENABLE_VARIANT_STRINGMAKER + +namespace Catch { + struct not_this_one {}; // Tag type for detecting which begin/ end are being selected + + // Import begin/ end from std here so they are considered alongside the fallback (...) overloads in this namespace + using std::begin; + using std::end; + + not_this_one begin( ... ); + not_this_one end( ... ); + + template + struct is_range { + static const bool value = + !std::is_same())), not_this_one>::value && + !std::is_same())), not_this_one>::value; + }; + +#if defined(_MANAGED) // Managed types are never ranges + template + struct is_range { + static const bool value = false; + }; +#endif + + template + std::string rangeToString( Range const& range ) { + return ::Catch::Detail::rangeToString( begin( range ), end( range ) ); + } + + // Handle vector specially + template + std::string rangeToString( std::vector const& v ) { + ReusableStringStream rss; + rss << "{ "; + bool first = true; + for( bool b : v ) { + if( first ) + first = false; + else + rss << ", "; + rss << ::Catch::Detail::stringify( b ); + } + rss << " }"; + return rss.str(); + } + + template + struct StringMaker::value && !::Catch::Detail::IsStreamInsertable::value>::type> { + static std::string convert( R const& range ) { + return rangeToString( range ); + } + }; + + template + struct StringMaker { + static std::string convert(T const(&arr)[SZ]) { + return rangeToString(arr); + } + }; + +} // namespace Catch + +// Separate std::chrono::duration specialization +#if defined(CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER) +#include +#include +#include + +namespace Catch { + +template +struct ratio_string { + static std::string symbol(); +}; + +template +std::string ratio_string::symbol() { + Catch::ReusableStringStream rss; + rss << '[' << Ratio::num << '/' + << Ratio::den << ']'; + return rss.str(); +} +template <> +struct ratio_string { + static std::string symbol(); +}; +template <> +struct ratio_string { + static std::string symbol(); +}; +template <> +struct ratio_string { + static std::string symbol(); +}; +template <> +struct ratio_string { + static std::string symbol(); +}; +template <> +struct ratio_string { + static std::string symbol(); +}; +template <> +struct ratio_string { + static std::string symbol(); +}; + + //////////// + // std::chrono::duration specializations + template + struct StringMaker> { + static std::string convert(std::chrono::duration const& duration) { + ReusableStringStream rss; + rss << duration.count() << ' ' << ratio_string::symbol() << 's'; + return rss.str(); + } + }; + template + struct StringMaker>> { + static std::string convert(std::chrono::duration> const& duration) { + ReusableStringStream rss; + rss << duration.count() << " s"; + return rss.str(); + } + }; + template + struct StringMaker>> { + static std::string convert(std::chrono::duration> const& duration) { + ReusableStringStream rss; + rss << duration.count() << " m"; + return rss.str(); + } + }; + template + struct StringMaker>> { + static std::string convert(std::chrono::duration> const& duration) { + ReusableStringStream rss; + rss << duration.count() << " h"; + return rss.str(); + } + }; + + //////////// + // std::chrono::time_point specialization + // Generic time_point cannot be specialized, only std::chrono::time_point + template + struct StringMaker> { + static std::string convert(std::chrono::time_point const& time_point) { + return ::Catch::Detail::stringify(time_point.time_since_epoch()) + " since epoch"; + } + }; + // std::chrono::time_point specialization + template + struct StringMaker> { + static std::string convert(std::chrono::time_point const& time_point) { + auto converted = std::chrono::system_clock::to_time_t(time_point); + +#ifdef _MSC_VER + std::tm timeInfo = {}; + gmtime_s(&timeInfo, &converted); +#else + std::tm* timeInfo = std::gmtime(&converted); +#endif + + auto const timeStampSize = sizeof("2017-01-16T17:06:45Z"); + char timeStamp[timeStampSize]; + const char * const fmt = "%Y-%m-%dT%H:%M:%SZ"; + +#ifdef _MSC_VER + std::strftime(timeStamp, timeStampSize, fmt, &timeInfo); +#else + std::strftime(timeStamp, timeStampSize, fmt, timeInfo); +#endif + return std::string(timeStamp); + } + }; +} +#endif // CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER + +#ifdef _MSC_VER +#pragma warning(pop) +#endif + +// end catch_tostring.h +#include + +#ifdef _MSC_VER +#pragma warning(push) +#pragma warning(disable:4389) // '==' : signed/unsigned mismatch +#pragma warning(disable:4018) // more "signed/unsigned mismatch" +#pragma warning(disable:4312) // Converting int to T* using reinterpret_cast (issue on x64 platform) +#pragma warning(disable:4180) // qualifier applied to function type has no meaning +#pragma warning(disable:4800) // Forcing result to true or false +#endif + +namespace Catch { + + struct ITransientExpression { + auto isBinaryExpression() const -> bool { return m_isBinaryExpression; } + auto getResult() const -> bool { return m_result; } + virtual void streamReconstructedExpression( std::ostream &os ) const = 0; + + ITransientExpression( bool isBinaryExpression, bool result ) + : m_isBinaryExpression( isBinaryExpression ), + m_result( result ) + {} + + // We don't actually need a virtual destructor, but many static analysers + // complain if it's not here :-( + virtual ~ITransientExpression(); + + bool m_isBinaryExpression; + bool m_result; + + }; + + void formatReconstructedExpression( std::ostream &os, std::string const& lhs, StringRef op, std::string const& rhs ); + + template + class BinaryExpr : public ITransientExpression { + LhsT m_lhs; + StringRef m_op; + RhsT m_rhs; + + void streamReconstructedExpression( std::ostream &os ) const override { + formatReconstructedExpression + ( os, Catch::Detail::stringify( m_lhs ), m_op, Catch::Detail::stringify( m_rhs ) ); + } + + public: + BinaryExpr( bool comparisonResult, LhsT lhs, StringRef op, RhsT rhs ) + : ITransientExpression{ true, comparisonResult }, + m_lhs( lhs ), + m_op( op ), + m_rhs( rhs ) + {} + + template + auto operator && ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator || ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator == ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator != ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator > ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator < ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator >= ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator <= ( T ) const -> BinaryExpr const { + static_assert(always_false::value, + "chained comparisons are not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + }; + + template + class UnaryExpr : public ITransientExpression { + LhsT m_lhs; + + void streamReconstructedExpression( std::ostream &os ) const override { + os << Catch::Detail::stringify( m_lhs ); + } + + public: + explicit UnaryExpr( LhsT lhs ) + : ITransientExpression{ false, static_cast(lhs) }, + m_lhs( lhs ) + {} + }; + + // Specialised comparison functions to handle equality comparisons between ints and pointers (NULL deduces as an int) + template + auto compareEqual( LhsT const& lhs, RhsT const& rhs ) -> bool { return static_cast(lhs == rhs); } + template + auto compareEqual( T* const& lhs, int rhs ) -> bool { return lhs == reinterpret_cast( rhs ); } + template + auto compareEqual( T* const& lhs, long rhs ) -> bool { return lhs == reinterpret_cast( rhs ); } + template + auto compareEqual( int lhs, T* const& rhs ) -> bool { return reinterpret_cast( lhs ) == rhs; } + template + auto compareEqual( long lhs, T* const& rhs ) -> bool { return reinterpret_cast( lhs ) == rhs; } + + template + auto compareNotEqual( LhsT const& lhs, RhsT&& rhs ) -> bool { return static_cast(lhs != rhs); } + template + auto compareNotEqual( T* const& lhs, int rhs ) -> bool { return lhs != reinterpret_cast( rhs ); } + template + auto compareNotEqual( T* const& lhs, long rhs ) -> bool { return lhs != reinterpret_cast( rhs ); } + template + auto compareNotEqual( int lhs, T* const& rhs ) -> bool { return reinterpret_cast( lhs ) != rhs; } + template + auto compareNotEqual( long lhs, T* const& rhs ) -> bool { return reinterpret_cast( lhs ) != rhs; } + + template + class ExprLhs { + LhsT m_lhs; + public: + explicit ExprLhs( LhsT lhs ) : m_lhs( lhs ) {} + + template + auto operator == ( RhsT const& rhs ) -> BinaryExpr const { + return { compareEqual( m_lhs, rhs ), m_lhs, "==", rhs }; + } + auto operator == ( bool rhs ) -> BinaryExpr const { + return { m_lhs == rhs, m_lhs, "==", rhs }; + } + + template + auto operator != ( RhsT const& rhs ) -> BinaryExpr const { + return { compareNotEqual( m_lhs, rhs ), m_lhs, "!=", rhs }; + } + auto operator != ( bool rhs ) -> BinaryExpr const { + return { m_lhs != rhs, m_lhs, "!=", rhs }; + } + + template + auto operator > ( RhsT const& rhs ) -> BinaryExpr const { + return { static_cast(m_lhs > rhs), m_lhs, ">", rhs }; + } + template + auto operator < ( RhsT const& rhs ) -> BinaryExpr const { + return { static_cast(m_lhs < rhs), m_lhs, "<", rhs }; + } + template + auto operator >= ( RhsT const& rhs ) -> BinaryExpr const { + return { static_cast(m_lhs >= rhs), m_lhs, ">=", rhs }; + } + template + auto operator <= ( RhsT const& rhs ) -> BinaryExpr const { + return { static_cast(m_lhs <= rhs), m_lhs, "<=", rhs }; + } + + template + auto operator && ( RhsT const& ) -> BinaryExpr const { + static_assert(always_false::value, + "operator&& is not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + template + auto operator || ( RhsT const& ) -> BinaryExpr const { + static_assert(always_false::value, + "operator|| is not supported inside assertions, " + "wrap the expression inside parentheses, or decompose it"); + } + + auto makeUnaryExpr() const -> UnaryExpr { + return UnaryExpr{ m_lhs }; + } + }; + + void handleExpression( ITransientExpression const& expr ); + + template + void handleExpression( ExprLhs const& expr ) { + handleExpression( expr.makeUnaryExpr() ); + } + + struct Decomposer { + template + auto operator <= ( T const& lhs ) -> ExprLhs { + return ExprLhs{ lhs }; + } + + auto operator <=( bool value ) -> ExprLhs { + return ExprLhs{ value }; + } + }; + +} // end namespace Catch + +#ifdef _MSC_VER +#pragma warning(pop) +#endif + +// end catch_decomposer.h +// start catch_interfaces_capture.h + +#include + +namespace Catch { + + class AssertionResult; + struct AssertionInfo; + struct SectionInfo; + struct SectionEndInfo; + struct MessageInfo; + struct MessageBuilder; + struct Counts; + struct BenchmarkInfo; + struct BenchmarkStats; + struct AssertionReaction; + struct SourceLineInfo; + + struct ITransientExpression; + struct IGeneratorTracker; + + struct IResultCapture { + + virtual ~IResultCapture(); + + virtual bool sectionStarted( SectionInfo const& sectionInfo, + Counts& assertions ) = 0; + virtual void sectionEnded( SectionEndInfo const& endInfo ) = 0; + virtual void sectionEndedEarly( SectionEndInfo const& endInfo ) = 0; + + virtual auto acquireGeneratorTracker( SourceLineInfo const& lineInfo ) -> IGeneratorTracker& = 0; + + virtual void benchmarkStarting( BenchmarkInfo const& info ) = 0; + virtual void benchmarkEnded( BenchmarkStats const& stats ) = 0; + + virtual void pushScopedMessage( MessageInfo const& message ) = 0; + virtual void popScopedMessage( MessageInfo const& message ) = 0; + + virtual void emplaceUnscopedMessage( MessageBuilder const& builder ) = 0; + + virtual void handleFatalErrorCondition( StringRef message ) = 0; + + virtual void handleExpr + ( AssertionInfo const& info, + ITransientExpression const& expr, + AssertionReaction& reaction ) = 0; + virtual void handleMessage + ( AssertionInfo const& info, + ResultWas::OfType resultType, + StringRef const& message, + AssertionReaction& reaction ) = 0; + virtual void handleUnexpectedExceptionNotThrown + ( AssertionInfo const& info, + AssertionReaction& reaction ) = 0; + virtual void handleUnexpectedInflightException + ( AssertionInfo const& info, + std::string const& message, + AssertionReaction& reaction ) = 0; + virtual void handleIncomplete + ( AssertionInfo const& info ) = 0; + virtual void handleNonExpr + ( AssertionInfo const &info, + ResultWas::OfType resultType, + AssertionReaction &reaction ) = 0; + + virtual bool lastAssertionPassed() = 0; + virtual void assertionPassed() = 0; + + // Deprecated, do not use: + virtual std::string getCurrentTestName() const = 0; + virtual const AssertionResult* getLastResult() const = 0; + virtual void exceptionEarlyReported() = 0; + }; + + IResultCapture& getResultCapture(); +} + +// end catch_interfaces_capture.h +namespace Catch { + + struct TestFailureException{}; + struct AssertionResultData; + struct IResultCapture; + class RunContext; + + class LazyExpression { + friend class AssertionHandler; + friend struct AssertionStats; + friend class RunContext; + + ITransientExpression const* m_transientExpression = nullptr; + bool m_isNegated; + public: + LazyExpression( bool isNegated ); + LazyExpression( LazyExpression const& other ); + LazyExpression& operator = ( LazyExpression const& ) = delete; + + explicit operator bool() const; + + friend auto operator << ( std::ostream& os, LazyExpression const& lazyExpr ) -> std::ostream&; + }; + + struct AssertionReaction { + bool shouldDebugBreak = false; + bool shouldThrow = false; + }; + + class AssertionHandler { + AssertionInfo m_assertionInfo; + AssertionReaction m_reaction; + bool m_completed = false; + IResultCapture& m_resultCapture; + + public: + AssertionHandler + ( StringRef const& macroName, + SourceLineInfo const& lineInfo, + StringRef capturedExpression, + ResultDisposition::Flags resultDisposition ); + ~AssertionHandler() { + if ( !m_completed ) { + m_resultCapture.handleIncomplete( m_assertionInfo ); + } + } + + template + void handleExpr( ExprLhs const& expr ) { + handleExpr( expr.makeUnaryExpr() ); + } + void handleExpr( ITransientExpression const& expr ); + + void handleMessage(ResultWas::OfType resultType, StringRef const& message); + + void handleExceptionThrownAsExpected(); + void handleUnexpectedExceptionNotThrown(); + void handleExceptionNotThrownAsExpected(); + void handleThrowingCallSkipped(); + void handleUnexpectedInflightException(); + + void complete(); + void setCompleted(); + + // query + auto allowThrows() const -> bool; + }; + + void handleExceptionMatchExpr( AssertionHandler& handler, std::string const& str, StringRef const& matcherString ); + +} // namespace Catch + +// end catch_assertionhandler.h +// start catch_message.h + +#include +#include + +namespace Catch { + + struct MessageInfo { + MessageInfo( StringRef const& _macroName, + SourceLineInfo const& _lineInfo, + ResultWas::OfType _type ); + + StringRef macroName; + std::string message; + SourceLineInfo lineInfo; + ResultWas::OfType type; + unsigned int sequence; + + bool operator == ( MessageInfo const& other ) const; + bool operator < ( MessageInfo const& other ) const; + private: + static unsigned int globalCount; + }; + + struct MessageStream { + + template + MessageStream& operator << ( T const& value ) { + m_stream << value; + return *this; + } + + ReusableStringStream m_stream; + }; + + struct MessageBuilder : MessageStream { + MessageBuilder( StringRef const& macroName, + SourceLineInfo const& lineInfo, + ResultWas::OfType type ); + + template + MessageBuilder& operator << ( T const& value ) { + m_stream << value; + return *this; + } + + MessageInfo m_info; + }; + + class ScopedMessage { + public: + explicit ScopedMessage( MessageBuilder const& builder ); + ScopedMessage( ScopedMessage& duplicate ) = delete; + ScopedMessage( ScopedMessage&& old ); + ~ScopedMessage(); + + MessageInfo m_info; + bool m_moved; + }; + + class Capturer { + std::vector m_messages; + IResultCapture& m_resultCapture = getResultCapture(); + size_t m_captured = 0; + public: + Capturer( StringRef macroName, SourceLineInfo const& lineInfo, ResultWas::OfType resultType, StringRef names ); + ~Capturer(); + + void captureValue( size_t index, std::string const& value ); + + template + void captureValues( size_t index, T const& value ) { + captureValue( index, Catch::Detail::stringify( value ) ); + } + + template + void captureValues( size_t index, T const& value, Ts const&... values ) { + captureValue( index, Catch::Detail::stringify(value) ); + captureValues( index+1, values... ); + } + }; + +} // end namespace Catch + +// end catch_message.h +#if !defined(CATCH_CONFIG_DISABLE) + +#if !defined(CATCH_CONFIG_DISABLE_STRINGIFICATION) + #define CATCH_INTERNAL_STRINGIFY(...) #__VA_ARGS__ +#else + #define CATCH_INTERNAL_STRINGIFY(...) "Disabled by CATCH_CONFIG_DISABLE_STRINGIFICATION" +#endif + +#if defined(CATCH_CONFIG_FAST_COMPILE) || defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) + +/////////////////////////////////////////////////////////////////////////////// +// Another way to speed-up compilation is to omit local try-catch for REQUIRE* +// macros. +#define INTERNAL_CATCH_TRY +#define INTERNAL_CATCH_CATCH( capturer ) + +#else // CATCH_CONFIG_FAST_COMPILE + +#define INTERNAL_CATCH_TRY try +#define INTERNAL_CATCH_CATCH( handler ) catch(...) { handler.handleUnexpectedInflightException(); } + +#endif + +#define INTERNAL_CATCH_REACT( handler ) handler.complete(); + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_TEST( macroName, resultDisposition, ... ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, CATCH_INTERNAL_STRINGIFY(__VA_ARGS__), resultDisposition ); \ + INTERNAL_CATCH_TRY { \ + CATCH_INTERNAL_SUPPRESS_PARENTHESES_WARNINGS \ + catchAssertionHandler.handleExpr( Catch::Decomposer() <= __VA_ARGS__ ); \ + CATCH_INTERNAL_UNSUPPRESS_PARENTHESES_WARNINGS \ + } INTERNAL_CATCH_CATCH( catchAssertionHandler ) \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( (void)0, (false) && static_cast( !!(__VA_ARGS__) ) ) // the expression here is never evaluated at runtime but it forces the compiler to give it a look + // The double negation silences MSVC's C4800 warning, the static_cast forces short-circuit evaluation if the type has overloaded &&. + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_IF( macroName, resultDisposition, ... ) \ + INTERNAL_CATCH_TEST( macroName, resultDisposition, __VA_ARGS__ ); \ + if( Catch::getResultCapture().lastAssertionPassed() ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_ELSE( macroName, resultDisposition, ... ) \ + INTERNAL_CATCH_TEST( macroName, resultDisposition, __VA_ARGS__ ); \ + if( !Catch::getResultCapture().lastAssertionPassed() ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_NO_THROW( macroName, resultDisposition, ... ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, CATCH_INTERNAL_STRINGIFY(__VA_ARGS__), resultDisposition ); \ + try { \ + static_cast(__VA_ARGS__); \ + catchAssertionHandler.handleExceptionNotThrownAsExpected(); \ + } \ + catch( ... ) { \ + catchAssertionHandler.handleUnexpectedInflightException(); \ + } \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( false ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_THROWS( macroName, resultDisposition, ... ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, CATCH_INTERNAL_STRINGIFY(__VA_ARGS__), resultDisposition); \ + if( catchAssertionHandler.allowThrows() ) \ + try { \ + static_cast(__VA_ARGS__); \ + catchAssertionHandler.handleUnexpectedExceptionNotThrown(); \ + } \ + catch( ... ) { \ + catchAssertionHandler.handleExceptionThrownAsExpected(); \ + } \ + else \ + catchAssertionHandler.handleThrowingCallSkipped(); \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( false ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_THROWS_AS( macroName, exceptionType, resultDisposition, expr ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, CATCH_INTERNAL_STRINGIFY(expr) ", " CATCH_INTERNAL_STRINGIFY(exceptionType), resultDisposition ); \ + if( catchAssertionHandler.allowThrows() ) \ + try { \ + static_cast(expr); \ + catchAssertionHandler.handleUnexpectedExceptionNotThrown(); \ + } \ + catch( exceptionType const& ) { \ + catchAssertionHandler.handleExceptionThrownAsExpected(); \ + } \ + catch( ... ) { \ + catchAssertionHandler.handleUnexpectedInflightException(); \ + } \ + else \ + catchAssertionHandler.handleThrowingCallSkipped(); \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( false ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_MSG( macroName, messageType, resultDisposition, ... ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, Catch::StringRef(), resultDisposition ); \ + catchAssertionHandler.handleMessage( messageType, ( Catch::MessageStream() << __VA_ARGS__ + ::Catch::StreamEndStop() ).m_stream.str() ); \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( false ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_CAPTURE( varName, macroName, ... ) \ + auto varName = Catch::Capturer( macroName, CATCH_INTERNAL_LINEINFO, Catch::ResultWas::Info, #__VA_ARGS__ ); \ + varName.captureValues( 0, __VA_ARGS__ ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_INFO( macroName, log ) \ + Catch::ScopedMessage INTERNAL_CATCH_UNIQUE_NAME( scopedMessage )( Catch::MessageBuilder( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, Catch::ResultWas::Info ) << log ); + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_UNSCOPED_INFO( macroName, log ) \ + Catch::getResultCapture().emplaceUnscopedMessage( Catch::MessageBuilder( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, Catch::ResultWas::Info ) << log ) + +/////////////////////////////////////////////////////////////////////////////// +// Although this is matcher-based, it can be used with just a string +#define INTERNAL_CATCH_THROWS_STR_MATCHES( macroName, resultDisposition, matcher, ... ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, CATCH_INTERNAL_STRINGIFY(__VA_ARGS__) ", " CATCH_INTERNAL_STRINGIFY(matcher), resultDisposition ); \ + if( catchAssertionHandler.allowThrows() ) \ + try { \ + static_cast(__VA_ARGS__); \ + catchAssertionHandler.handleUnexpectedExceptionNotThrown(); \ + } \ + catch( ... ) { \ + Catch::handleExceptionMatchExpr( catchAssertionHandler, matcher, #matcher##_catch_sr ); \ + } \ + else \ + catchAssertionHandler.handleThrowingCallSkipped(); \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( false ) + +#endif // CATCH_CONFIG_DISABLE + +// end catch_capture.hpp +// start catch_section.h + +// start catch_section_info.h + +// start catch_totals.h + +#include + +namespace Catch { + + struct Counts { + Counts operator - ( Counts const& other ) const; + Counts& operator += ( Counts const& other ); + + std::size_t total() const; + bool allPassed() const; + bool allOk() const; + + std::size_t passed = 0; + std::size_t failed = 0; + std::size_t failedButOk = 0; + }; + + struct Totals { + + Totals operator - ( Totals const& other ) const; + Totals& operator += ( Totals const& other ); + + Totals delta( Totals const& prevTotals ) const; + + int error = 0; + Counts assertions; + Counts testCases; + }; +} + +// end catch_totals.h +#include + +namespace Catch { + + struct SectionInfo { + SectionInfo + ( SourceLineInfo const& _lineInfo, + std::string const& _name ); + + // Deprecated + SectionInfo + ( SourceLineInfo const& _lineInfo, + std::string const& _name, + std::string const& ) : SectionInfo( _lineInfo, _name ) {} + + std::string name; + std::string description; // !Deprecated: this will always be empty + SourceLineInfo lineInfo; + }; + + struct SectionEndInfo { + SectionInfo sectionInfo; + Counts prevAssertions; + double durationInSeconds; + }; + +} // end namespace Catch + +// end catch_section_info.h +// start catch_timer.h + +#include + +namespace Catch { + + auto getCurrentNanosecondsSinceEpoch() -> uint64_t; + auto getEstimatedClockResolution() -> uint64_t; + + class Timer { + uint64_t m_nanoseconds = 0; + public: + void start(); + auto getElapsedNanoseconds() const -> uint64_t; + auto getElapsedMicroseconds() const -> uint64_t; + auto getElapsedMilliseconds() const -> unsigned int; + auto getElapsedSeconds() const -> double; + }; + +} // namespace Catch + +// end catch_timer.h +#include + +namespace Catch { + + class Section : NonCopyable { + public: + Section( SectionInfo const& info ); + ~Section(); + + // This indicates whether the section should be executed or not + explicit operator bool() const; + + private: + SectionInfo m_info; + + std::string m_name; + Counts m_assertions; + bool m_sectionIncluded; + Timer m_timer; + }; + +} // end namespace Catch + +#define INTERNAL_CATCH_SECTION( ... ) \ + CATCH_INTERNAL_SUPPRESS_UNUSED_WARNINGS \ + if( Catch::Section const& INTERNAL_CATCH_UNIQUE_NAME( catch_internal_Section ) = Catch::SectionInfo( CATCH_INTERNAL_LINEINFO, __VA_ARGS__ ) ) \ + CATCH_INTERNAL_UNSUPPRESS_UNUSED_WARNINGS + +#define INTERNAL_CATCH_DYNAMIC_SECTION( ... ) \ + CATCH_INTERNAL_SUPPRESS_UNUSED_WARNINGS \ + if( Catch::Section const& INTERNAL_CATCH_UNIQUE_NAME( catch_internal_Section ) = Catch::SectionInfo( CATCH_INTERNAL_LINEINFO, (Catch::ReusableStringStream() << __VA_ARGS__).str() ) ) \ + CATCH_INTERNAL_UNSUPPRESS_UNUSED_WARNINGS + +// end catch_section.h +// start catch_benchmark.h + +#include +#include + +namespace Catch { + + class BenchmarkLooper { + + std::string m_name; + std::size_t m_count = 0; + std::size_t m_iterationsToRun = 1; + uint64_t m_resolution; + Timer m_timer; + + static auto getResolution() -> uint64_t; + public: + // Keep most of this inline as it's on the code path that is being timed + BenchmarkLooper( StringRef name ) + : m_name( name ), + m_resolution( getResolution() ) + { + reportStart(); + m_timer.start(); + } + + explicit operator bool() { + if( m_count < m_iterationsToRun ) + return true; + return needsMoreIterations(); + } + + void increment() { + ++m_count; + } + + void reportStart(); + auto needsMoreIterations() -> bool; + }; + +} // end namespace Catch + +#define BENCHMARK( name ) \ + for( Catch::BenchmarkLooper looper( name ); looper; looper.increment() ) + +// end catch_benchmark.h +// start catch_interfaces_exception.h + +// start catch_interfaces_registry_hub.h + +#include +#include + +namespace Catch { + + class TestCase; + struct ITestCaseRegistry; + struct IExceptionTranslatorRegistry; + struct IExceptionTranslator; + struct IReporterRegistry; + struct IReporterFactory; + struct ITagAliasRegistry; + class StartupExceptionRegistry; + + using IReporterFactoryPtr = std::shared_ptr; + + struct IRegistryHub { + virtual ~IRegistryHub(); + + virtual IReporterRegistry const& getReporterRegistry() const = 0; + virtual ITestCaseRegistry const& getTestCaseRegistry() const = 0; + virtual ITagAliasRegistry const& getTagAliasRegistry() const = 0; + + virtual IExceptionTranslatorRegistry const& getExceptionTranslatorRegistry() const = 0; + + virtual StartupExceptionRegistry const& getStartupExceptionRegistry() const = 0; + }; + + struct IMutableRegistryHub { + virtual ~IMutableRegistryHub(); + virtual void registerReporter( std::string const& name, IReporterFactoryPtr const& factory ) = 0; + virtual void registerListener( IReporterFactoryPtr const& factory ) = 0; + virtual void registerTest( TestCase const& testInfo ) = 0; + virtual void registerTranslator( const IExceptionTranslator* translator ) = 0; + virtual void registerTagAlias( std::string const& alias, std::string const& tag, SourceLineInfo const& lineInfo ) = 0; + virtual void registerStartupException() noexcept = 0; + }; + + IRegistryHub const& getRegistryHub(); + IMutableRegistryHub& getMutableRegistryHub(); + void cleanUp(); + std::string translateActiveException(); + +} + +// end catch_interfaces_registry_hub.h +#if defined(CATCH_CONFIG_DISABLE) + #define INTERNAL_CATCH_TRANSLATE_EXCEPTION_NO_REG( translatorName, signature) \ + static std::string translatorName( signature ) +#endif + +#include +#include +#include + +namespace Catch { + using exceptionTranslateFunction = std::string(*)(); + + struct IExceptionTranslator; + using ExceptionTranslators = std::vector>; + + struct IExceptionTranslator { + virtual ~IExceptionTranslator(); + virtual std::string translate( ExceptionTranslators::const_iterator it, ExceptionTranslators::const_iterator itEnd ) const = 0; + }; + + struct IExceptionTranslatorRegistry { + virtual ~IExceptionTranslatorRegistry(); + + virtual std::string translateActiveException() const = 0; + }; + + class ExceptionTranslatorRegistrar { + template + class ExceptionTranslator : public IExceptionTranslator { + public: + + ExceptionTranslator( std::string(*translateFunction)( T& ) ) + : m_translateFunction( translateFunction ) + {} + + std::string translate( ExceptionTranslators::const_iterator it, ExceptionTranslators::const_iterator itEnd ) const override { + try { + if( it == itEnd ) + std::rethrow_exception(std::current_exception()); + else + return (*it)->translate( it+1, itEnd ); + } + catch( T& ex ) { + return m_translateFunction( ex ); + } + } + + protected: + std::string(*m_translateFunction)( T& ); + }; + + public: + template + ExceptionTranslatorRegistrar( std::string(*translateFunction)( T& ) ) { + getMutableRegistryHub().registerTranslator + ( new ExceptionTranslator( translateFunction ) ); + } + }; +} + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_TRANSLATE_EXCEPTION2( translatorName, signature ) \ + static std::string translatorName( signature ); \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ Catch::ExceptionTranslatorRegistrar INTERNAL_CATCH_UNIQUE_NAME( catch_internal_ExceptionRegistrar )( &translatorName ); } \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS \ + static std::string translatorName( signature ) + +#define INTERNAL_CATCH_TRANSLATE_EXCEPTION( signature ) INTERNAL_CATCH_TRANSLATE_EXCEPTION2( INTERNAL_CATCH_UNIQUE_NAME( catch_internal_ExceptionTranslator ), signature ) + +// end catch_interfaces_exception.h +// start catch_approx.h + +#include + +namespace Catch { +namespace Detail { + + class Approx { + private: + bool equalityComparisonImpl(double other) const; + // Validates the new margin (margin >= 0) + // out-of-line to avoid including stdexcept in the header + void setMargin(double margin); + // Validates the new epsilon (0 < epsilon < 1) + // out-of-line to avoid including stdexcept in the header + void setEpsilon(double epsilon); + + public: + explicit Approx ( double value ); + + static Approx custom(); + + Approx operator-() const; + + template ::value>::type> + Approx operator()( T const& value ) { + Approx approx( static_cast(value) ); + approx.m_epsilon = m_epsilon; + approx.m_margin = m_margin; + approx.m_scale = m_scale; + return approx; + } + + template ::value>::type> + explicit Approx( T const& value ): Approx(static_cast(value)) + {} + + template ::value>::type> + friend bool operator == ( const T& lhs, Approx const& rhs ) { + auto lhs_v = static_cast(lhs); + return rhs.equalityComparisonImpl(lhs_v); + } + + template ::value>::type> + friend bool operator == ( Approx const& lhs, const T& rhs ) { + return operator==( rhs, lhs ); + } + + template ::value>::type> + friend bool operator != ( T const& lhs, Approx const& rhs ) { + return !operator==( lhs, rhs ); + } + + template ::value>::type> + friend bool operator != ( Approx const& lhs, T const& rhs ) { + return !operator==( rhs, lhs ); + } + + template ::value>::type> + friend bool operator <= ( T const& lhs, Approx const& rhs ) { + return static_cast(lhs) < rhs.m_value || lhs == rhs; + } + + template ::value>::type> + friend bool operator <= ( Approx const& lhs, T const& rhs ) { + return lhs.m_value < static_cast(rhs) || lhs == rhs; + } + + template ::value>::type> + friend bool operator >= ( T const& lhs, Approx const& rhs ) { + return static_cast(lhs) > rhs.m_value || lhs == rhs; + } + + template ::value>::type> + friend bool operator >= ( Approx const& lhs, T const& rhs ) { + return lhs.m_value > static_cast(rhs) || lhs == rhs; + } + + template ::value>::type> + Approx& epsilon( T const& newEpsilon ) { + double epsilonAsDouble = static_cast(newEpsilon); + setEpsilon(epsilonAsDouble); + return *this; + } + + template ::value>::type> + Approx& margin( T const& newMargin ) { + double marginAsDouble = static_cast(newMargin); + setMargin(marginAsDouble); + return *this; + } + + template ::value>::type> + Approx& scale( T const& newScale ) { + m_scale = static_cast(newScale); + return *this; + } + + std::string toString() const; + + private: + double m_epsilon; + double m_margin; + double m_scale; + double m_value; + }; +} // end namespace Detail + +namespace literals { + Detail::Approx operator "" _a(long double val); + Detail::Approx operator "" _a(unsigned long long val); +} // end namespace literals + +template<> +struct StringMaker { + static std::string convert(Catch::Detail::Approx const& value); +}; + +} // end namespace Catch + +// end catch_approx.h +// start catch_string_manip.h + +#include +#include + +namespace Catch { + + bool startsWith( std::string const& s, std::string const& prefix ); + bool startsWith( std::string const& s, char prefix ); + bool endsWith( std::string const& s, std::string const& suffix ); + bool endsWith( std::string const& s, char suffix ); + bool contains( std::string const& s, std::string const& infix ); + void toLowerInPlace( std::string& s ); + std::string toLower( std::string const& s ); + std::string trim( std::string const& str ); + bool replaceInPlace( std::string& str, std::string const& replaceThis, std::string const& withThis ); + + struct pluralise { + pluralise( std::size_t count, std::string const& label ); + + friend std::ostream& operator << ( std::ostream& os, pluralise const& pluraliser ); + + std::size_t m_count; + std::string m_label; + }; +} + +// end catch_string_manip.h +#ifndef CATCH_CONFIG_DISABLE_MATCHERS +// start catch_capture_matchers.h + +// start catch_matchers.h + +#include +#include + +namespace Catch { +namespace Matchers { + namespace Impl { + + template struct MatchAllOf; + template struct MatchAnyOf; + template struct MatchNotOf; + + class MatcherUntypedBase { + public: + MatcherUntypedBase() = default; + MatcherUntypedBase ( MatcherUntypedBase const& ) = default; + MatcherUntypedBase& operator = ( MatcherUntypedBase const& ) = delete; + std::string toString() const; + + protected: + virtual ~MatcherUntypedBase(); + virtual std::string describe() const = 0; + mutable std::string m_cachedToString; + }; + +#ifdef __clang__ +# pragma clang diagnostic push +# pragma clang diagnostic ignored "-Wnon-virtual-dtor" +#endif + + template + struct MatcherMethod { + virtual bool match( ObjectT const& arg ) const = 0; + }; + +#ifdef __clang__ +# pragma clang diagnostic pop +#endif + + template + struct MatcherBase : MatcherUntypedBase, MatcherMethod { + + MatchAllOf operator && ( MatcherBase const& other ) const; + MatchAnyOf operator || ( MatcherBase const& other ) const; + MatchNotOf operator ! () const; + }; + + template + struct MatchAllOf : MatcherBase { + bool match( ArgT const& arg ) const override { + for( auto matcher : m_matchers ) { + if (!matcher->match(arg)) + return false; + } + return true; + } + std::string describe() const override { + std::string description; + description.reserve( 4 + m_matchers.size()*32 ); + description += "( "; + bool first = true; + for( auto matcher : m_matchers ) { + if( first ) + first = false; + else + description += " and "; + description += matcher->toString(); + } + description += " )"; + return description; + } + + MatchAllOf& operator && ( MatcherBase const& other ) { + m_matchers.push_back( &other ); + return *this; + } + + std::vector const*> m_matchers; + }; + template + struct MatchAnyOf : MatcherBase { + + bool match( ArgT const& arg ) const override { + for( auto matcher : m_matchers ) { + if (matcher->match(arg)) + return true; + } + return false; + } + std::string describe() const override { + std::string description; + description.reserve( 4 + m_matchers.size()*32 ); + description += "( "; + bool first = true; + for( auto matcher : m_matchers ) { + if( first ) + first = false; + else + description += " or "; + description += matcher->toString(); + } + description += " )"; + return description; + } + + MatchAnyOf& operator || ( MatcherBase const& other ) { + m_matchers.push_back( &other ); + return *this; + } + + std::vector const*> m_matchers; + }; + + template + struct MatchNotOf : MatcherBase { + + MatchNotOf( MatcherBase const& underlyingMatcher ) : m_underlyingMatcher( underlyingMatcher ) {} + + bool match( ArgT const& arg ) const override { + return !m_underlyingMatcher.match( arg ); + } + + std::string describe() const override { + return "not " + m_underlyingMatcher.toString(); + } + MatcherBase const& m_underlyingMatcher; + }; + + template + MatchAllOf MatcherBase::operator && ( MatcherBase const& other ) const { + return MatchAllOf() && *this && other; + } + template + MatchAnyOf MatcherBase::operator || ( MatcherBase const& other ) const { + return MatchAnyOf() || *this || other; + } + template + MatchNotOf MatcherBase::operator ! () const { + return MatchNotOf( *this ); + } + + } // namespace Impl + +} // namespace Matchers + +using namespace Matchers; +using Matchers::Impl::MatcherBase; + +} // namespace Catch + +// end catch_matchers.h +// start catch_matchers_floating.h + +#include +#include + +namespace Catch { +namespace Matchers { + + namespace Floating { + + enum class FloatingPointKind : uint8_t; + + struct WithinAbsMatcher : MatcherBase { + WithinAbsMatcher(double target, double margin); + bool match(double const& matchee) const override; + std::string describe() const override; + private: + double m_target; + double m_margin; + }; + + struct WithinUlpsMatcher : MatcherBase { + WithinUlpsMatcher(double target, int ulps, FloatingPointKind baseType); + bool match(double const& matchee) const override; + std::string describe() const override; + private: + double m_target; + int m_ulps; + FloatingPointKind m_type; + }; + + } // namespace Floating + + // The following functions create the actual matcher objects. + // This allows the types to be inferred + Floating::WithinUlpsMatcher WithinULP(double target, int maxUlpDiff); + Floating::WithinUlpsMatcher WithinULP(float target, int maxUlpDiff); + Floating::WithinAbsMatcher WithinAbs(double target, double margin); + +} // namespace Matchers +} // namespace Catch + +// end catch_matchers_floating.h +// start catch_matchers_generic.hpp + +#include +#include + +namespace Catch { +namespace Matchers { +namespace Generic { + +namespace Detail { + std::string finalizeDescription(const std::string& desc); +} + +template +class PredicateMatcher : public MatcherBase { + std::function m_predicate; + std::string m_description; +public: + + PredicateMatcher(std::function const& elem, std::string const& descr) + :m_predicate(std::move(elem)), + m_description(Detail::finalizeDescription(descr)) + {} + + bool match( T const& item ) const override { + return m_predicate(item); + } + + std::string describe() const override { + return m_description; + } +}; + +} // namespace Generic + + // The following functions create the actual matcher objects. + // The user has to explicitly specify type to the function, because + // infering std::function is hard (but possible) and + // requires a lot of TMP. + template + Generic::PredicateMatcher Predicate(std::function const& predicate, std::string const& description = "") { + return Generic::PredicateMatcher(predicate, description); + } + +} // namespace Matchers +} // namespace Catch + +// end catch_matchers_generic.hpp +// start catch_matchers_string.h + +#include + +namespace Catch { +namespace Matchers { + + namespace StdString { + + struct CasedString + { + CasedString( std::string const& str, CaseSensitive::Choice caseSensitivity ); + std::string adjustString( std::string const& str ) const; + std::string caseSensitivitySuffix() const; + + CaseSensitive::Choice m_caseSensitivity; + std::string m_str; + }; + + struct StringMatcherBase : MatcherBase { + StringMatcherBase( std::string const& operation, CasedString const& comparator ); + std::string describe() const override; + + CasedString m_comparator; + std::string m_operation; + }; + + struct EqualsMatcher : StringMatcherBase { + EqualsMatcher( CasedString const& comparator ); + bool match( std::string const& source ) const override; + }; + struct ContainsMatcher : StringMatcherBase { + ContainsMatcher( CasedString const& comparator ); + bool match( std::string const& source ) const override; + }; + struct StartsWithMatcher : StringMatcherBase { + StartsWithMatcher( CasedString const& comparator ); + bool match( std::string const& source ) const override; + }; + struct EndsWithMatcher : StringMatcherBase { + EndsWithMatcher( CasedString const& comparator ); + bool match( std::string const& source ) const override; + }; + + struct RegexMatcher : MatcherBase { + RegexMatcher( std::string regex, CaseSensitive::Choice caseSensitivity ); + bool match( std::string const& matchee ) const override; + std::string describe() const override; + + private: + std::string m_regex; + CaseSensitive::Choice m_caseSensitivity; + }; + + } // namespace StdString + + // The following functions create the actual matcher objects. + // This allows the types to be inferred + + StdString::EqualsMatcher Equals( std::string const& str, CaseSensitive::Choice caseSensitivity = CaseSensitive::Yes ); + StdString::ContainsMatcher Contains( std::string const& str, CaseSensitive::Choice caseSensitivity = CaseSensitive::Yes ); + StdString::EndsWithMatcher EndsWith( std::string const& str, CaseSensitive::Choice caseSensitivity = CaseSensitive::Yes ); + StdString::StartsWithMatcher StartsWith( std::string const& str, CaseSensitive::Choice caseSensitivity = CaseSensitive::Yes ); + StdString::RegexMatcher Matches( std::string const& regex, CaseSensitive::Choice caseSensitivity = CaseSensitive::Yes ); + +} // namespace Matchers +} // namespace Catch + +// end catch_matchers_string.h +// start catch_matchers_vector.h + +#include + +namespace Catch { +namespace Matchers { + + namespace Vector { + namespace Detail { + template + size_t count(InputIterator first, InputIterator last, T const& item) { + size_t cnt = 0; + for (; first != last; ++first) { + if (*first == item) { + ++cnt; + } + } + return cnt; + } + template + bool contains(InputIterator first, InputIterator last, T const& item) { + for (; first != last; ++first) { + if (*first == item) { + return true; + } + } + return false; + } + } + + template + struct ContainsElementMatcher : MatcherBase> { + + ContainsElementMatcher(T const &comparator) : m_comparator( comparator) {} + + bool match(std::vector const &v) const override { + for (auto const& el : v) { + if (el == m_comparator) { + return true; + } + } + return false; + } + + std::string describe() const override { + return "Contains: " + ::Catch::Detail::stringify( m_comparator ); + } + + T const& m_comparator; + }; + + template + struct ContainsMatcher : MatcherBase> { + + ContainsMatcher(std::vector const &comparator) : m_comparator( comparator ) {} + + bool match(std::vector const &v) const override { + // !TBD: see note in EqualsMatcher + if (m_comparator.size() > v.size()) + return false; + for (auto const& comparator : m_comparator) { + auto present = false; + for (const auto& el : v) { + if (el == comparator) { + present = true; + break; + } + } + if (!present) { + return false; + } + } + return true; + } + std::string describe() const override { + return "Contains: " + ::Catch::Detail::stringify( m_comparator ); + } + + std::vector const& m_comparator; + }; + + template + struct EqualsMatcher : MatcherBase> { + + EqualsMatcher(std::vector const &comparator) : m_comparator( comparator ) {} + + bool match(std::vector const &v) const override { + // !TBD: This currently works if all elements can be compared using != + // - a more general approach would be via a compare template that defaults + // to using !=. but could be specialised for, e.g. std::vector etc + // - then just call that directly + if (m_comparator.size() != v.size()) + return false; + for (std::size_t i = 0; i < v.size(); ++i) + if (m_comparator[i] != v[i]) + return false; + return true; + } + std::string describe() const override { + return "Equals: " + ::Catch::Detail::stringify( m_comparator ); + } + std::vector const& m_comparator; + }; + + template + struct UnorderedEqualsMatcher : MatcherBase> { + UnorderedEqualsMatcher(std::vector const& target) : m_target(target) {} + bool match(std::vector const& vec) const override { + // Note: This is a reimplementation of std::is_permutation, + // because I don't want to include inside the common path + if (m_target.size() != vec.size()) { + return false; + } + auto lfirst = m_target.begin(), llast = m_target.end(); + auto rfirst = vec.begin(), rlast = vec.end(); + // Cut common prefix to optimize checking of permuted parts + while (lfirst != llast && *lfirst == *rfirst) { + ++lfirst; ++rfirst; + } + if (lfirst == llast) { + return true; + } + + for (auto mid = lfirst; mid != llast; ++mid) { + // Skip already counted items + if (Detail::contains(lfirst, mid, *mid)) { + continue; + } + size_t num_vec = Detail::count(rfirst, rlast, *mid); + if (num_vec == 0 || Detail::count(lfirst, llast, *mid) != num_vec) { + return false; + } + } + + return true; + } + + std::string describe() const override { + return "UnorderedEquals: " + ::Catch::Detail::stringify(m_target); + } + private: + std::vector const& m_target; + }; + + } // namespace Vector + + // The following functions create the actual matcher objects. + // This allows the types to be inferred + + template + Vector::ContainsMatcher Contains( std::vector const& comparator ) { + return Vector::ContainsMatcher( comparator ); + } + + template + Vector::ContainsElementMatcher VectorContains( T const& comparator ) { + return Vector::ContainsElementMatcher( comparator ); + } + + template + Vector::EqualsMatcher Equals( std::vector const& comparator ) { + return Vector::EqualsMatcher( comparator ); + } + + template + Vector::UnorderedEqualsMatcher UnorderedEquals(std::vector const& target) { + return Vector::UnorderedEqualsMatcher(target); + } + +} // namespace Matchers +} // namespace Catch + +// end catch_matchers_vector.h +namespace Catch { + + template + class MatchExpr : public ITransientExpression { + ArgT const& m_arg; + MatcherT m_matcher; + StringRef m_matcherString; + public: + MatchExpr( ArgT const& arg, MatcherT const& matcher, StringRef const& matcherString ) + : ITransientExpression{ true, matcher.match( arg ) }, + m_arg( arg ), + m_matcher( matcher ), + m_matcherString( matcherString ) + {} + + void streamReconstructedExpression( std::ostream &os ) const override { + auto matcherAsString = m_matcher.toString(); + os << Catch::Detail::stringify( m_arg ) << ' '; + if( matcherAsString == Detail::unprintableString ) + os << m_matcherString; + else + os << matcherAsString; + } + }; + + using StringMatcher = Matchers::Impl::MatcherBase; + + void handleExceptionMatchExpr( AssertionHandler& handler, StringMatcher const& matcher, StringRef const& matcherString ); + + template + auto makeMatchExpr( ArgT const& arg, MatcherT const& matcher, StringRef const& matcherString ) -> MatchExpr { + return MatchExpr( arg, matcher, matcherString ); + } + +} // namespace Catch + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CHECK_THAT( macroName, matcher, resultDisposition, arg ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, CATCH_INTERNAL_STRINGIFY(arg) ", " CATCH_INTERNAL_STRINGIFY(matcher), resultDisposition ); \ + INTERNAL_CATCH_TRY { \ + catchAssertionHandler.handleExpr( Catch::makeMatchExpr( arg, matcher, #matcher##_catch_sr ) ); \ + } INTERNAL_CATCH_CATCH( catchAssertionHandler ) \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( false ) + +/////////////////////////////////////////////////////////////////////////////// +#define INTERNAL_CATCH_THROWS_MATCHES( macroName, exceptionType, resultDisposition, matcher, ... ) \ + do { \ + Catch::AssertionHandler catchAssertionHandler( macroName##_catch_sr, CATCH_INTERNAL_LINEINFO, CATCH_INTERNAL_STRINGIFY(__VA_ARGS__) ", " CATCH_INTERNAL_STRINGIFY(exceptionType) ", " CATCH_INTERNAL_STRINGIFY(matcher), resultDisposition ); \ + if( catchAssertionHandler.allowThrows() ) \ + try { \ + static_cast(__VA_ARGS__ ); \ + catchAssertionHandler.handleUnexpectedExceptionNotThrown(); \ + } \ + catch( exceptionType const& ex ) { \ + catchAssertionHandler.handleExpr( Catch::makeMatchExpr( ex, matcher, #matcher##_catch_sr ) ); \ + } \ + catch( ... ) { \ + catchAssertionHandler.handleUnexpectedInflightException(); \ + } \ + else \ + catchAssertionHandler.handleThrowingCallSkipped(); \ + INTERNAL_CATCH_REACT( catchAssertionHandler ) \ + } while( false ) + +// end catch_capture_matchers.h +#endif +// start catch_generators.hpp + +// start catch_interfaces_generatortracker.h + + +#include + +namespace Catch { + + namespace Generators { + class GeneratorUntypedBase { + public: + GeneratorUntypedBase() = default; + virtual ~GeneratorUntypedBase(); + // Attempts to move the generator to the next element + // + // Returns true iff the move succeeded (and a valid element + // can be retrieved). + virtual bool next() = 0; + }; + using GeneratorBasePtr = std::unique_ptr; + + } // namespace Generators + + struct IGeneratorTracker { + virtual ~IGeneratorTracker(); + virtual auto hasGenerator() const -> bool = 0; + virtual auto getGenerator() const -> Generators::GeneratorBasePtr const& = 0; + virtual void setGenerator( Generators::GeneratorBasePtr&& generator ) = 0; + }; + +} // namespace Catch + +// end catch_interfaces_generatortracker.h +// start catch_enforce.h + +#include + +namespace Catch { +#if !defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) + template + [[noreturn]] + void throw_exception(Ex const& e) { + throw e; + } +#else // ^^ Exceptions are enabled // Exceptions are disabled vv + [[noreturn]] + void throw_exception(std::exception const& e); +#endif +} // namespace Catch; + +#define CATCH_PREPARE_EXCEPTION( type, msg ) \ + type( ( Catch::ReusableStringStream() << msg ).str() ) +#define CATCH_INTERNAL_ERROR( msg ) \ + Catch::throw_exception(CATCH_PREPARE_EXCEPTION( std::logic_error, CATCH_INTERNAL_LINEINFO << ": Internal Catch error: " << msg)) +#define CATCH_ERROR( msg ) \ + Catch::throw_exception(CATCH_PREPARE_EXCEPTION( std::domain_error, msg )) +#define CATCH_RUNTIME_ERROR( msg ) \ + Catch::throw_exception(CATCH_PREPARE_EXCEPTION( std::runtime_error, msg )) +#define CATCH_ENFORCE( condition, msg ) \ + do{ if( !(condition) ) CATCH_ERROR( msg ); } while(false) + +// end catch_enforce.h +#include +#include +#include + +#include +#include + +namespace Catch { + +class GeneratorException : public std::exception { + const char* const m_msg = ""; + +public: + GeneratorException(const char* msg): + m_msg(msg) + {} + + const char* what() const noexcept override final; +}; + +namespace Generators { + + // !TBD move this into its own location? + namespace pf{ + template + std::unique_ptr make_unique( Args&&... args ) { + return std::unique_ptr(new T(std::forward(args)...)); + } + } + + template + struct IGenerator : GeneratorUntypedBase { + virtual ~IGenerator() = default; + + // Returns the current element of the generator + // + // \Precondition The generator is either freshly constructed, + // or the last call to `next()` returned true + virtual T const& get() const = 0; + using type = T; + }; + + template + class SingleValueGenerator final : public IGenerator { + T m_value; + public: + SingleValueGenerator(T const& value) : m_value( value ) {} + SingleValueGenerator(T&& value) : m_value(std::move(value)) {} + + T const& get() const override { + return m_value; + } + bool next() override { + return false; + } + }; + + template + class FixedValuesGenerator final : public IGenerator { + std::vector m_values; + size_t m_idx = 0; + public: + FixedValuesGenerator( std::initializer_list values ) : m_values( values ) {} + + T const& get() const override { + return m_values[m_idx]; + } + bool next() override { + ++m_idx; + return m_idx < m_values.size(); + } + }; + + template + class GeneratorWrapper final { + std::unique_ptr> m_generator; + public: + GeneratorWrapper(std::unique_ptr> generator): + m_generator(std::move(generator)) + {} + T const& get() const { + return m_generator->get(); + } + bool next() { + return m_generator->next(); + } + }; + + template + GeneratorWrapper value(T&& value) { + return GeneratorWrapper(pf::make_unique>(std::forward(value))); + } + template + GeneratorWrapper values(std::initializer_list values) { + return GeneratorWrapper(pf::make_unique>(values)); + } + + template + class Generators : public IGenerator { + std::vector> m_generators; + size_t m_current = 0; + + void populate(GeneratorWrapper&& generator) { + m_generators.emplace_back(std::move(generator)); + } + void populate(T&& val) { + m_generators.emplace_back(value(std::move(val))); + } + template + void populate(U&& val) { + populate(T(std::move(val))); + } + template + void populate(U&& valueOrGenerator, Gs... moreGenerators) { + populate(std::forward(valueOrGenerator)); + populate(std::forward(moreGenerators)...); + } + + public: + template + Generators(Gs... moreGenerators) { + m_generators.reserve(sizeof...(Gs)); + populate(std::forward(moreGenerators)...); + } + + T const& get() const override { + return m_generators[m_current].get(); + } + + bool next() override { + if (m_current >= m_generators.size()) { + return false; + } + const bool current_status = m_generators[m_current].next(); + if (!current_status) { + ++m_current; + } + return m_current < m_generators.size(); + } + }; + + template + GeneratorWrapper> table( std::initializer_list::type...>> tuples ) { + return values>( tuples ); + } + + // Tag type to signal that a generator sequence should convert arguments to a specific type + template + struct as {}; + + template + auto makeGenerators( GeneratorWrapper&& generator, Gs... moreGenerators ) -> Generators { + return Generators(std::move(generator), std::forward(moreGenerators)...); + } + template + auto makeGenerators( GeneratorWrapper&& generator ) -> Generators { + return Generators(std::move(generator)); + } + template + auto makeGenerators( T&& val, Gs... moreGenerators ) -> Generators { + return makeGenerators( value( std::forward( val ) ), std::forward( moreGenerators )... ); + } + template + auto makeGenerators( as, U&& val, Gs... moreGenerators ) -> Generators { + return makeGenerators( value( T( std::forward( val ) ) ), std::forward( moreGenerators )... ); + } + + auto acquireGeneratorTracker( SourceLineInfo const& lineInfo ) -> IGeneratorTracker&; + + template + // Note: The type after -> is weird, because VS2015 cannot parse + // the expression used in the typedef inside, when it is in + // return type. Yeah. + auto generate( SourceLineInfo const& lineInfo, L const& generatorExpression ) -> decltype(std::declval().get()) { + using UnderlyingType = typename decltype(generatorExpression())::type; + + IGeneratorTracker& tracker = acquireGeneratorTracker( lineInfo ); + if (!tracker.hasGenerator()) { + tracker.setGenerator(pf::make_unique>(generatorExpression())); + } + + auto const& generator = static_cast const&>( *tracker.getGenerator() ); + return generator.get(); + } + +} // namespace Generators +} // namespace Catch + +#define GENERATE( ... ) \ + Catch::Generators::generate( CATCH_INTERNAL_LINEINFO, []{ using namespace Catch::Generators; return makeGenerators( __VA_ARGS__ ); } ) + +// end catch_generators.hpp +// start catch_generators_generic.hpp + +namespace Catch { +namespace Generators { + + template + class TakeGenerator : public IGenerator { + GeneratorWrapper m_generator; + size_t m_returned = 0; + size_t m_target; + public: + TakeGenerator(size_t target, GeneratorWrapper&& generator): + m_generator(std::move(generator)), + m_target(target) + { + assert(target != 0 && "Empty generators are not allowed"); + } + T const& get() const override { + return m_generator.get(); + } + bool next() override { + ++m_returned; + if (m_returned >= m_target) { + return false; + } + + const auto success = m_generator.next(); + // If the underlying generator does not contain enough values + // then we cut short as well + if (!success) { + m_returned = m_target; + } + return success; + } + }; + + template + GeneratorWrapper take(size_t target, GeneratorWrapper&& generator) { + return GeneratorWrapper(pf::make_unique>(target, std::move(generator))); + } + + template + class FilterGenerator : public IGenerator { + GeneratorWrapper m_generator; + Predicate m_predicate; + public: + template + FilterGenerator(P&& pred, GeneratorWrapper&& generator): + m_generator(std::move(generator)), + m_predicate(std::forward

(pred)) + { + if (!m_predicate(m_generator.get())) { + // It might happen that there are no values that pass the + // filter. In that case we throw an exception. + auto has_initial_value = next(); + if (!has_initial_value) { + Catch::throw_exception(GeneratorException("No valid value found in filtered generator")); + } + } + } + + T const& get() const override { + return m_generator.get(); + } + + bool next() override { + bool success = m_generator.next(); + if (!success) { + return false; + } + while (!m_predicate(m_generator.get()) && (success = m_generator.next()) == true); + return success; + } + }; + + template + GeneratorWrapper filter(Predicate&& pred, GeneratorWrapper&& generator) { + return GeneratorWrapper(std::unique_ptr>(pf::make_unique>(std::forward(pred), std::move(generator)))); + } + + template + class RepeatGenerator : public IGenerator { + GeneratorWrapper m_generator; + mutable std::vector m_returned; + size_t m_target_repeats; + size_t m_current_repeat = 0; + size_t m_repeat_index = 0; + public: + RepeatGenerator(size_t repeats, GeneratorWrapper&& generator): + m_generator(std::move(generator)), + m_target_repeats(repeats) + { + assert(m_target_repeats > 0 && "Repeat generator must repeat at least once"); + } + + T const& get() const override { + if (m_current_repeat == 0) { + m_returned.push_back(m_generator.get()); + return m_returned.back(); + } + return m_returned[m_repeat_index]; + } + + bool next() override { + // There are 2 basic cases: + // 1) We are still reading the generator + // 2) We are reading our own cache + + // In the first case, we need to poke the underlying generator. + // If it happily moves, we are left in that state, otherwise it is time to start reading from our cache + if (m_current_repeat == 0) { + const auto success = m_generator.next(); + if (!success) { + ++m_current_repeat; + } + return m_current_repeat < m_target_repeats; + } + + // In the second case, we need to move indices forward and check that we haven't run up against the end + ++m_repeat_index; + if (m_repeat_index == m_returned.size()) { + m_repeat_index = 0; + ++m_current_repeat; + } + return m_current_repeat < m_target_repeats; + } + }; + + template + GeneratorWrapper repeat(size_t repeats, GeneratorWrapper&& generator) { + return GeneratorWrapper(pf::make_unique>(repeats, std::move(generator))); + } + + template + class MapGenerator : public IGenerator { + // TBD: provide static assert for mapping function, for friendly error message + GeneratorWrapper m_generator; + Func m_function; + // To avoid returning dangling reference, we have to save the values + T m_cache; + public: + template + MapGenerator(F2&& function, GeneratorWrapper&& generator) : + m_generator(std::move(generator)), + m_function(std::forward(function)), + m_cache(m_function(m_generator.get())) + {} + + T const& get() const override { + return m_cache; + } + bool next() override { + const auto success = m_generator.next(); + if (success) { + m_cache = m_function(m_generator.get()); + } + return success; + } + }; + + template + GeneratorWrapper map(Func&& function, GeneratorWrapper&& generator) { + return GeneratorWrapper( + pf::make_unique>(std::forward(function), std::move(generator)) + ); + } + template + GeneratorWrapper map(Func&& function, GeneratorWrapper&& generator) { + return GeneratorWrapper( + pf::make_unique>(std::forward(function), std::move(generator)) + ); + } + + template + class ChunkGenerator final : public IGenerator> { + std::vector m_chunk; + size_t m_chunk_size; + GeneratorWrapper m_generator; + bool m_used_up = false; + public: + ChunkGenerator(size_t size, GeneratorWrapper generator) : + m_chunk_size(size), m_generator(std::move(generator)) + { + m_chunk.reserve(m_chunk_size); + m_chunk.push_back(m_generator.get()); + for (size_t i = 1; i < m_chunk_size; ++i) { + if (!m_generator.next()) { + Catch::throw_exception(GeneratorException("Not enough values to initialize the first chunk")); + } + m_chunk.push_back(m_generator.get()); + } + } + std::vector const& get() const override { + return m_chunk; + } + bool next() override { + m_chunk.clear(); + for (size_t idx = 0; idx < m_chunk_size; ++idx) { + if (!m_generator.next()) { + return false; + } + m_chunk.push_back(m_generator.get()); + } + return true; + } + }; + + template + GeneratorWrapper> chunk(size_t size, GeneratorWrapper&& generator) { + return GeneratorWrapper>( + pf::make_unique>(size, std::move(generator)) + ); + } + +} // namespace Generators +} // namespace Catch + +// end catch_generators_generic.hpp +// start catch_generators_specific.hpp + +// start catch_context.h + +#include + +namespace Catch { + + struct IResultCapture; + struct IRunner; + struct IConfig; + struct IMutableContext; + + using IConfigPtr = std::shared_ptr; + + struct IContext + { + virtual ~IContext(); + + virtual IResultCapture* getResultCapture() = 0; + virtual IRunner* getRunner() = 0; + virtual IConfigPtr const& getConfig() const = 0; + }; + + struct IMutableContext : IContext + { + virtual ~IMutableContext(); + virtual void setResultCapture( IResultCapture* resultCapture ) = 0; + virtual void setRunner( IRunner* runner ) = 0; + virtual void setConfig( IConfigPtr const& config ) = 0; + + private: + static IMutableContext *currentContext; + friend IMutableContext& getCurrentMutableContext(); + friend void cleanUpContext(); + static void createContext(); + }; + + inline IMutableContext& getCurrentMutableContext() + { + if( !IMutableContext::currentContext ) + IMutableContext::createContext(); + return *IMutableContext::currentContext; + } + + inline IContext& getCurrentContext() + { + return getCurrentMutableContext(); + } + + void cleanUpContext(); +} + +// end catch_context.h +// start catch_interfaces_config.h + +#include +#include +#include +#include + +namespace Catch { + + enum class Verbosity { + Quiet = 0, + Normal, + High + }; + + struct WarnAbout { enum What { + Nothing = 0x00, + NoAssertions = 0x01, + NoTests = 0x02 + }; }; + + struct ShowDurations { enum OrNot { + DefaultForReporter, + Always, + Never + }; }; + struct RunTests { enum InWhatOrder { + InDeclarationOrder, + InLexicographicalOrder, + InRandomOrder + }; }; + struct UseColour { enum YesOrNo { + Auto, + Yes, + No + }; }; + struct WaitForKeypress { enum When { + Never, + BeforeStart = 1, + BeforeExit = 2, + BeforeStartAndExit = BeforeStart | BeforeExit + }; }; + + class TestSpec; + + struct IConfig : NonCopyable { + + virtual ~IConfig(); + + virtual bool allowThrows() const = 0; + virtual std::ostream& stream() const = 0; + virtual std::string name() const = 0; + virtual bool includeSuccessfulResults() const = 0; + virtual bool shouldDebugBreak() const = 0; + virtual bool warnAboutMissingAssertions() const = 0; + virtual bool warnAboutNoTests() const = 0; + virtual int abortAfter() const = 0; + virtual bool showInvisibles() const = 0; + virtual ShowDurations::OrNot showDurations() const = 0; + virtual TestSpec const& testSpec() const = 0; + virtual bool hasTestFilters() const = 0; + virtual RunTests::InWhatOrder runOrder() const = 0; + virtual unsigned int rngSeed() const = 0; + virtual int benchmarkResolutionMultiple() const = 0; + virtual UseColour::YesOrNo useColour() const = 0; + virtual std::vector const& getSectionsToRun() const = 0; + virtual Verbosity verbosity() const = 0; + }; + + using IConfigPtr = std::shared_ptr; +} + +// end catch_interfaces_config.h +#include + +namespace Catch { +namespace Generators { + +template +class RandomFloatingGenerator final : public IGenerator { + // FIXME: What is the right seed? + std::minstd_rand m_rand; + std::uniform_real_distribution m_dist; + Float m_current_number; +public: + + RandomFloatingGenerator(Float a, Float b): + m_rand(getCurrentContext().getConfig()->rngSeed()), + m_dist(a, b) { + static_cast(next()); + } + + Float const& get() const override { + return m_current_number; + } + bool next() override { + m_current_number = m_dist(m_rand); + return true; + } +}; + +template +class RandomIntegerGenerator final : public IGenerator { + std::minstd_rand m_rand; + std::uniform_int_distribution m_dist; + Integer m_current_number; +public: + + RandomIntegerGenerator(Integer a, Integer b): + m_rand(getCurrentContext().getConfig()->rngSeed()), + m_dist(a, b) { + static_cast(next()); + } + + Integer const& get() const override { + return m_current_number; + } + bool next() override { + m_current_number = m_dist(m_rand); + return true; + } +}; + +// TODO: Ideally this would be also constrained against the various char types, +// but I don't expect users to run into that in practice. +template +typename std::enable_if::value && !std::is_same::value, +GeneratorWrapper>::type +random(T a, T b) { + return GeneratorWrapper( + pf::make_unique>(a, b) + ); +} + +template +typename std::enable_if::value, +GeneratorWrapper>::type +random(T a, T b) { + return GeneratorWrapper( + pf::make_unique>(a, b) + ); +} + +template +class RangeGenerator final : public IGenerator { + T m_current; + T m_end; + T m_step; + bool m_positive; + +public: + RangeGenerator(T const& start, T const& end, T const& step): + m_current(start), + m_end(end), + m_step(step), + m_positive(m_step > T(0)) + { + assert(m_current != m_end && "Range start and end cannot be equal"); + assert(m_step != T(0) && "Step size cannot be zero"); + assert(((m_positive && m_current <= m_end) || (!m_positive && m_current >= m_end)) && "Step moves away from end"); + } + + RangeGenerator(T const& start, T const& end): + RangeGenerator(start, end, (start < end) ? T(1) : T(-1)) + {} + + T const& get() const override { + return m_current; + } + + bool next() override { + m_current += m_step; + return (m_positive) ? (m_current < m_end) : (m_current > m_end); + } +}; + +template +GeneratorWrapper range(T const& start, T const& end, T const& step) { + static_assert(std::is_integral::value && !std::is_same::value, "Type must be an integer"); + return GeneratorWrapper(pf::make_unique>(start, end, step)); +} + +template +GeneratorWrapper range(T const& start, T const& end) { + static_assert(std::is_integral::value && !std::is_same::value, "Type must be an integer"); + return GeneratorWrapper(pf::make_unique>(start, end)); +} + +} // namespace Generators +} // namespace Catch + +// end catch_generators_specific.hpp + +// These files are included here so the single_include script doesn't put them +// in the conditionally compiled sections +// start catch_test_case_info.h + +#include +#include +#include + +#ifdef __clang__ +#pragma clang diagnostic push +#pragma clang diagnostic ignored "-Wpadded" +#endif + +namespace Catch { + + struct ITestInvoker; + + struct TestCaseInfo { + enum SpecialProperties{ + None = 0, + IsHidden = 1 << 1, + ShouldFail = 1 << 2, + MayFail = 1 << 3, + Throws = 1 << 4, + NonPortable = 1 << 5, + Benchmark = 1 << 6 + }; + + TestCaseInfo( std::string const& _name, + std::string const& _className, + std::string const& _description, + std::vector const& _tags, + SourceLineInfo const& _lineInfo ); + + friend void setTags( TestCaseInfo& testCaseInfo, std::vector tags ); + + bool isHidden() const; + bool throws() const; + bool okToFail() const; + bool expectedToFail() const; + + std::string tagsAsString() const; + + std::string name; + std::string className; + std::string description; + std::vector tags; + std::vector lcaseTags; + SourceLineInfo lineInfo; + SpecialProperties properties; + }; + + class TestCase : public TestCaseInfo { + public: + + TestCase( ITestInvoker* testCase, TestCaseInfo&& info ); + + TestCase withName( std::string const& _newName ) const; + + void invoke() const; + + TestCaseInfo const& getTestCaseInfo() const; + + bool operator == ( TestCase const& other ) const; + bool operator < ( TestCase const& other ) const; + + private: + std::shared_ptr test; + }; + + TestCase makeTestCase( ITestInvoker* testCase, + std::string const& className, + NameAndTags const& nameAndTags, + SourceLineInfo const& lineInfo ); +} + +#ifdef __clang__ +#pragma clang diagnostic pop +#endif + +// end catch_test_case_info.h +// start catch_interfaces_runner.h + +namespace Catch { + + struct IRunner { + virtual ~IRunner(); + virtual bool aborting() const = 0; + }; +} + +// end catch_interfaces_runner.h + +#ifdef __OBJC__ +// start catch_objc.hpp + +#import + +#include + +// NB. Any general catch headers included here must be included +// in catch.hpp first to make sure they are included by the single +// header for non obj-usage + +/////////////////////////////////////////////////////////////////////////////// +// This protocol is really only here for (self) documenting purposes, since +// all its methods are optional. +@protocol OcFixture + +@optional + +-(void) setUp; +-(void) tearDown; + +@end + +namespace Catch { + + class OcMethod : public ITestInvoker { + + public: + OcMethod( Class cls, SEL sel ) : m_cls( cls ), m_sel( sel ) {} + + virtual void invoke() const { + id obj = [[m_cls alloc] init]; + + performOptionalSelector( obj, @selector(setUp) ); + performOptionalSelector( obj, m_sel ); + performOptionalSelector( obj, @selector(tearDown) ); + + arcSafeRelease( obj ); + } + private: + virtual ~OcMethod() {} + + Class m_cls; + SEL m_sel; + }; + + namespace Detail{ + + inline std::string getAnnotation( Class cls, + std::string const& annotationName, + std::string const& testCaseName ) { + NSString* selStr = [[NSString alloc] initWithFormat:@"Catch_%s_%s", annotationName.c_str(), testCaseName.c_str()]; + SEL sel = NSSelectorFromString( selStr ); + arcSafeRelease( selStr ); + id value = performOptionalSelector( cls, sel ); + if( value ) + return [(NSString*)value UTF8String]; + return ""; + } + } + + inline std::size_t registerTestMethods() { + std::size_t noTestMethods = 0; + int noClasses = objc_getClassList( nullptr, 0 ); + + Class* classes = (CATCH_UNSAFE_UNRETAINED Class *)malloc( sizeof(Class) * noClasses); + objc_getClassList( classes, noClasses ); + + for( int c = 0; c < noClasses; c++ ) { + Class cls = classes[c]; + { + u_int count; + Method* methods = class_copyMethodList( cls, &count ); + for( u_int m = 0; m < count ; m++ ) { + SEL selector = method_getName(methods[m]); + std::string methodName = sel_getName(selector); + if( startsWith( methodName, "Catch_TestCase_" ) ) { + std::string testCaseName = methodName.substr( 15 ); + std::string name = Detail::getAnnotation( cls, "Name", testCaseName ); + std::string desc = Detail::getAnnotation( cls, "Description", testCaseName ); + const char* className = class_getName( cls ); + + getMutableRegistryHub().registerTest( makeTestCase( new OcMethod( cls, selector ), className, NameAndTags( name.c_str(), desc.c_str() ), SourceLineInfo("",0) ) ); + noTestMethods++; + } + } + free(methods); + } + } + return noTestMethods; + } + +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) + + namespace Matchers { + namespace Impl { + namespace NSStringMatchers { + + struct StringHolder : MatcherBase{ + StringHolder( NSString* substr ) : m_substr( [substr copy] ){} + StringHolder( StringHolder const& other ) : m_substr( [other.m_substr copy] ){} + StringHolder() { + arcSafeRelease( m_substr ); + } + + bool match( NSString* arg ) const override { + return false; + } + + NSString* CATCH_ARC_STRONG m_substr; + }; + + struct Equals : StringHolder { + Equals( NSString* substr ) : StringHolder( substr ){} + + bool match( NSString* str ) const override { + return (str != nil || m_substr == nil ) && + [str isEqualToString:m_substr]; + } + + std::string describe() const override { + return "equals string: " + Catch::Detail::stringify( m_substr ); + } + }; + + struct Contains : StringHolder { + Contains( NSString* substr ) : StringHolder( substr ){} + + bool match( NSString* str ) const { + return (str != nil || m_substr == nil ) && + [str rangeOfString:m_substr].location != NSNotFound; + } + + std::string describe() const override { + return "contains string: " + Catch::Detail::stringify( m_substr ); + } + }; + + struct StartsWith : StringHolder { + StartsWith( NSString* substr ) : StringHolder( substr ){} + + bool match( NSString* str ) const override { + return (str != nil || m_substr == nil ) && + [str rangeOfString:m_substr].location == 0; + } + + std::string describe() const override { + return "starts with: " + Catch::Detail::stringify( m_substr ); + } + }; + struct EndsWith : StringHolder { + EndsWith( NSString* substr ) : StringHolder( substr ){} + + bool match( NSString* str ) const override { + return (str != nil || m_substr == nil ) && + [str rangeOfString:m_substr].location == [str length] - [m_substr length]; + } + + std::string describe() const override { + return "ends with: " + Catch::Detail::stringify( m_substr ); + } + }; + + } // namespace NSStringMatchers + } // namespace Impl + + inline Impl::NSStringMatchers::Equals + Equals( NSString* substr ){ return Impl::NSStringMatchers::Equals( substr ); } + + inline Impl::NSStringMatchers::Contains + Contains( NSString* substr ){ return Impl::NSStringMatchers::Contains( substr ); } + + inline Impl::NSStringMatchers::StartsWith + StartsWith( NSString* substr ){ return Impl::NSStringMatchers::StartsWith( substr ); } + + inline Impl::NSStringMatchers::EndsWith + EndsWith( NSString* substr ){ return Impl::NSStringMatchers::EndsWith( substr ); } + + } // namespace Matchers + + using namespace Matchers; + +#endif // CATCH_CONFIG_DISABLE_MATCHERS + +} // namespace Catch + +/////////////////////////////////////////////////////////////////////////////// +#define OC_MAKE_UNIQUE_NAME( root, uniqueSuffix ) root##uniqueSuffix +#define OC_TEST_CASE2( name, desc, uniqueSuffix ) \ ++(NSString*) OC_MAKE_UNIQUE_NAME( Catch_Name_test_, uniqueSuffix ) \ +{ \ +return @ name; \ +} \ ++(NSString*) OC_MAKE_UNIQUE_NAME( Catch_Description_test_, uniqueSuffix ) \ +{ \ +return @ desc; \ +} \ +-(void) OC_MAKE_UNIQUE_NAME( Catch_TestCase_test_, uniqueSuffix ) + +#define OC_TEST_CASE( name, desc ) OC_TEST_CASE2( name, desc, __LINE__ ) + +// end catch_objc.hpp +#endif + +#ifdef CATCH_CONFIG_EXTERNAL_INTERFACES +// start catch_external_interfaces.h + +// start catch_reporter_bases.hpp + +// start catch_interfaces_reporter.h + +// start catch_config.hpp + +// start catch_test_spec_parser.h + +#ifdef __clang__ +#pragma clang diagnostic push +#pragma clang diagnostic ignored "-Wpadded" +#endif + +// start catch_test_spec.h + +#ifdef __clang__ +#pragma clang diagnostic push +#pragma clang diagnostic ignored "-Wpadded" +#endif + +// start catch_wildcard_pattern.h + +namespace Catch +{ + class WildcardPattern { + enum WildcardPosition { + NoWildcard = 0, + WildcardAtStart = 1, + WildcardAtEnd = 2, + WildcardAtBothEnds = WildcardAtStart | WildcardAtEnd + }; + + public: + + WildcardPattern( std::string const& pattern, CaseSensitive::Choice caseSensitivity ); + virtual ~WildcardPattern() = default; + virtual bool matches( std::string const& str ) const; + + private: + std::string adjustCase( std::string const& str ) const; + CaseSensitive::Choice m_caseSensitivity; + WildcardPosition m_wildcard = NoWildcard; + std::string m_pattern; + }; +} + +// end catch_wildcard_pattern.h +#include +#include +#include + +namespace Catch { + + class TestSpec { + struct Pattern { + virtual ~Pattern(); + virtual bool matches( TestCaseInfo const& testCase ) const = 0; + }; + using PatternPtr = std::shared_ptr; + + class NamePattern : public Pattern { + public: + NamePattern( std::string const& name ); + virtual ~NamePattern(); + virtual bool matches( TestCaseInfo const& testCase ) const override; + private: + WildcardPattern m_wildcardPattern; + }; + + class TagPattern : public Pattern { + public: + TagPattern( std::string const& tag ); + virtual ~TagPattern(); + virtual bool matches( TestCaseInfo const& testCase ) const override; + private: + std::string m_tag; + }; + + class ExcludedPattern : public Pattern { + public: + ExcludedPattern( PatternPtr const& underlyingPattern ); + virtual ~ExcludedPattern(); + virtual bool matches( TestCaseInfo const& testCase ) const override; + private: + PatternPtr m_underlyingPattern; + }; + + struct Filter { + std::vector m_patterns; + + bool matches( TestCaseInfo const& testCase ) const; + }; + + public: + bool hasFilters() const; + bool matches( TestCaseInfo const& testCase ) const; + + private: + std::vector m_filters; + + friend class TestSpecParser; + }; +} + +#ifdef __clang__ +#pragma clang diagnostic pop +#endif + +// end catch_test_spec.h +// start catch_interfaces_tag_alias_registry.h + +#include + +namespace Catch { + + struct TagAlias; + + struct ITagAliasRegistry { + virtual ~ITagAliasRegistry(); + // Nullptr if not present + virtual TagAlias const* find( std::string const& alias ) const = 0; + virtual std::string expandAliases( std::string const& unexpandedTestSpec ) const = 0; + + static ITagAliasRegistry const& get(); + }; + +} // end namespace Catch + +// end catch_interfaces_tag_alias_registry.h +namespace Catch { + + class TestSpecParser { + enum Mode{ None, Name, QuotedName, Tag, EscapedName }; + Mode m_mode = None; + bool m_exclusion = false; + std::size_t m_start = std::string::npos, m_pos = 0; + std::string m_arg; + std::vector m_escapeChars; + TestSpec::Filter m_currentFilter; + TestSpec m_testSpec; + ITagAliasRegistry const* m_tagAliases = nullptr; + + public: + TestSpecParser( ITagAliasRegistry const& tagAliases ); + + TestSpecParser& parse( std::string const& arg ); + TestSpec testSpec(); + + private: + void visitChar( char c ); + void startNewMode( Mode mode, std::size_t start ); + void escape(); + std::string subString() const; + + template + void addPattern() { + std::string token = subString(); + for( std::size_t i = 0; i < m_escapeChars.size(); ++i ) + token = token.substr( 0, m_escapeChars[i]-m_start-i ) + token.substr( m_escapeChars[i]-m_start-i+1 ); + m_escapeChars.clear(); + if( startsWith( token, "exclude:" ) ) { + m_exclusion = true; + token = token.substr( 8 ); + } + if( !token.empty() ) { + TestSpec::PatternPtr pattern = std::make_shared( token ); + if( m_exclusion ) + pattern = std::make_shared( pattern ); + m_currentFilter.m_patterns.push_back( pattern ); + } + m_exclusion = false; + m_mode = None; + } + + void addFilter(); + }; + TestSpec parseTestSpec( std::string const& arg ); + +} // namespace Catch + +#ifdef __clang__ +#pragma clang diagnostic pop +#endif + +// end catch_test_spec_parser.h +// Libstdc++ doesn't like incomplete classes for unique_ptr + +#include +#include +#include + +#ifndef CATCH_CONFIG_CONSOLE_WIDTH +#define CATCH_CONFIG_CONSOLE_WIDTH 80 +#endif + +namespace Catch { + + struct IStream; + + struct ConfigData { + bool listTests = false; + bool listTags = false; + bool listReporters = false; + bool listTestNamesOnly = false; + + bool showSuccessfulTests = false; + bool shouldDebugBreak = false; + bool noThrow = false; + bool showHelp = false; + bool showInvisibles = false; + bool filenamesAsTags = false; + bool libIdentify = false; + + int abortAfter = -1; + unsigned int rngSeed = 0; + int benchmarkResolutionMultiple = 100; + + Verbosity verbosity = Verbosity::Normal; + WarnAbout::What warnings = WarnAbout::Nothing; + ShowDurations::OrNot showDurations = ShowDurations::DefaultForReporter; + RunTests::InWhatOrder runOrder = RunTests::InDeclarationOrder; + UseColour::YesOrNo useColour = UseColour::Auto; + WaitForKeypress::When waitForKeypress = WaitForKeypress::Never; + + std::string outputFilename; + std::string name; + std::string processName; +#ifndef CATCH_CONFIG_DEFAULT_REPORTER +#define CATCH_CONFIG_DEFAULT_REPORTER "console" +#endif + std::string reporterName = CATCH_CONFIG_DEFAULT_REPORTER; +#undef CATCH_CONFIG_DEFAULT_REPORTER + + std::vector testsOrTags; + std::vector sectionsToRun; + }; + + class Config : public IConfig { + public: + + Config() = default; + Config( ConfigData const& data ); + virtual ~Config() = default; + + std::string const& getFilename() const; + + bool listTests() const; + bool listTestNamesOnly() const; + bool listTags() const; + bool listReporters() const; + + std::string getProcessName() const; + std::string const& getReporterName() const; + + std::vector const& getTestsOrTags() const; + std::vector const& getSectionsToRun() const override; + + virtual TestSpec const& testSpec() const override; + bool hasTestFilters() const override; + + bool showHelp() const; + + // IConfig interface + bool allowThrows() const override; + std::ostream& stream() const override; + std::string name() const override; + bool includeSuccessfulResults() const override; + bool warnAboutMissingAssertions() const override; + bool warnAboutNoTests() const override; + ShowDurations::OrNot showDurations() const override; + RunTests::InWhatOrder runOrder() const override; + unsigned int rngSeed() const override; + int benchmarkResolutionMultiple() const override; + UseColour::YesOrNo useColour() const override; + bool shouldDebugBreak() const override; + int abortAfter() const override; + bool showInvisibles() const override; + Verbosity verbosity() const override; + + private: + + IStream const* openStream(); + ConfigData m_data; + + std::unique_ptr m_stream; + TestSpec m_testSpec; + bool m_hasTestFilters = false; + }; + +} // end namespace Catch + +// end catch_config.hpp +// start catch_assertionresult.h + +#include + +namespace Catch { + + struct AssertionResultData + { + AssertionResultData() = delete; + + AssertionResultData( ResultWas::OfType _resultType, LazyExpression const& _lazyExpression ); + + std::string message; + mutable std::string reconstructedExpression; + LazyExpression lazyExpression; + ResultWas::OfType resultType; + + std::string reconstructExpression() const; + }; + + class AssertionResult { + public: + AssertionResult() = delete; + AssertionResult( AssertionInfo const& info, AssertionResultData const& data ); + + bool isOk() const; + bool succeeded() const; + ResultWas::OfType getResultType() const; + bool hasExpression() const; + bool hasMessage() const; + std::string getExpression() const; + std::string getExpressionInMacro() const; + bool hasExpandedExpression() const; + std::string getExpandedExpression() const; + std::string getMessage() const; + SourceLineInfo getSourceInfo() const; + StringRef getTestMacroName() const; + + //protected: + AssertionInfo m_info; + AssertionResultData m_resultData; + }; + +} // end namespace Catch + +// end catch_assertionresult.h +// start catch_option.hpp + +namespace Catch { + + // An optional type + template + class Option { + public: + Option() : nullableValue( nullptr ) {} + Option( T const& _value ) + : nullableValue( new( storage ) T( _value ) ) + {} + Option( Option const& _other ) + : nullableValue( _other ? new( storage ) T( *_other ) : nullptr ) + {} + + ~Option() { + reset(); + } + + Option& operator= ( Option const& _other ) { + if( &_other != this ) { + reset(); + if( _other ) + nullableValue = new( storage ) T( *_other ); + } + return *this; + } + Option& operator = ( T const& _value ) { + reset(); + nullableValue = new( storage ) T( _value ); + return *this; + } + + void reset() { + if( nullableValue ) + nullableValue->~T(); + nullableValue = nullptr; + } + + T& operator*() { return *nullableValue; } + T const& operator*() const { return *nullableValue; } + T* operator->() { return nullableValue; } + const T* operator->() const { return nullableValue; } + + T valueOr( T const& defaultValue ) const { + return nullableValue ? *nullableValue : defaultValue; + } + + bool some() const { return nullableValue != nullptr; } + bool none() const { return nullableValue == nullptr; } + + bool operator !() const { return nullableValue == nullptr; } + explicit operator bool() const { + return some(); + } + + private: + T *nullableValue; + alignas(alignof(T)) char storage[sizeof(T)]; + }; + +} // end namespace Catch + +// end catch_option.hpp +#include +#include +#include +#include +#include + +namespace Catch { + + struct ReporterConfig { + explicit ReporterConfig( IConfigPtr const& _fullConfig ); + + ReporterConfig( IConfigPtr const& _fullConfig, std::ostream& _stream ); + + std::ostream& stream() const; + IConfigPtr fullConfig() const; + + private: + std::ostream* m_stream; + IConfigPtr m_fullConfig; + }; + + struct ReporterPreferences { + bool shouldRedirectStdOut = false; + bool shouldReportAllAssertions = false; + }; + + template + struct LazyStat : Option { + LazyStat& operator=( T const& _value ) { + Option::operator=( _value ); + used = false; + return *this; + } + void reset() { + Option::reset(); + used = false; + } + bool used = false; + }; + + struct TestRunInfo { + TestRunInfo( std::string const& _name ); + std::string name; + }; + struct GroupInfo { + GroupInfo( std::string const& _name, + std::size_t _groupIndex, + std::size_t _groupsCount ); + + std::string name; + std::size_t groupIndex; + std::size_t groupsCounts; + }; + + struct AssertionStats { + AssertionStats( AssertionResult const& _assertionResult, + std::vector const& _infoMessages, + Totals const& _totals ); + + AssertionStats( AssertionStats const& ) = default; + AssertionStats( AssertionStats && ) = default; + AssertionStats& operator = ( AssertionStats const& ) = delete; + AssertionStats& operator = ( AssertionStats && ) = delete; + virtual ~AssertionStats(); + + AssertionResult assertionResult; + std::vector infoMessages; + Totals totals; + }; + + struct SectionStats { + SectionStats( SectionInfo const& _sectionInfo, + Counts const& _assertions, + double _durationInSeconds, + bool _missingAssertions ); + SectionStats( SectionStats const& ) = default; + SectionStats( SectionStats && ) = default; + SectionStats& operator = ( SectionStats const& ) = default; + SectionStats& operator = ( SectionStats && ) = default; + virtual ~SectionStats(); + + SectionInfo sectionInfo; + Counts assertions; + double durationInSeconds; + bool missingAssertions; + }; + + struct TestCaseStats { + TestCaseStats( TestCaseInfo const& _testInfo, + Totals const& _totals, + std::string const& _stdOut, + std::string const& _stdErr, + bool _aborting ); + + TestCaseStats( TestCaseStats const& ) = default; + TestCaseStats( TestCaseStats && ) = default; + TestCaseStats& operator = ( TestCaseStats const& ) = default; + TestCaseStats& operator = ( TestCaseStats && ) = default; + virtual ~TestCaseStats(); + + TestCaseInfo testInfo; + Totals totals; + std::string stdOut; + std::string stdErr; + bool aborting; + }; + + struct TestGroupStats { + TestGroupStats( GroupInfo const& _groupInfo, + Totals const& _totals, + bool _aborting ); + TestGroupStats( GroupInfo const& _groupInfo ); + + TestGroupStats( TestGroupStats const& ) = default; + TestGroupStats( TestGroupStats && ) = default; + TestGroupStats& operator = ( TestGroupStats const& ) = default; + TestGroupStats& operator = ( TestGroupStats && ) = default; + virtual ~TestGroupStats(); + + GroupInfo groupInfo; + Totals totals; + bool aborting; + }; + + struct TestRunStats { + TestRunStats( TestRunInfo const& _runInfo, + Totals const& _totals, + bool _aborting ); + + TestRunStats( TestRunStats const& ) = default; + TestRunStats( TestRunStats && ) = default; + TestRunStats& operator = ( TestRunStats const& ) = default; + TestRunStats& operator = ( TestRunStats && ) = default; + virtual ~TestRunStats(); + + TestRunInfo runInfo; + Totals totals; + bool aborting; + }; + + struct BenchmarkInfo { + std::string name; + }; + struct BenchmarkStats { + BenchmarkInfo info; + std::size_t iterations; + uint64_t elapsedTimeInNanoseconds; + }; + + struct IStreamingReporter { + virtual ~IStreamingReporter() = default; + + // Implementing class must also provide the following static methods: + // static std::string getDescription(); + // static std::set getSupportedVerbosities() + + virtual ReporterPreferences getPreferences() const = 0; + + virtual void noMatchingTestCases( std::string const& spec ) = 0; + + virtual void testRunStarting( TestRunInfo const& testRunInfo ) = 0; + virtual void testGroupStarting( GroupInfo const& groupInfo ) = 0; + + virtual void testCaseStarting( TestCaseInfo const& testInfo ) = 0; + virtual void sectionStarting( SectionInfo const& sectionInfo ) = 0; + + // *** experimental *** + virtual void benchmarkStarting( BenchmarkInfo const& ) {} + + virtual void assertionStarting( AssertionInfo const& assertionInfo ) = 0; + + // The return value indicates if the messages buffer should be cleared: + virtual bool assertionEnded( AssertionStats const& assertionStats ) = 0; + + // *** experimental *** + virtual void benchmarkEnded( BenchmarkStats const& ) {} + + virtual void sectionEnded( SectionStats const& sectionStats ) = 0; + virtual void testCaseEnded( TestCaseStats const& testCaseStats ) = 0; + virtual void testGroupEnded( TestGroupStats const& testGroupStats ) = 0; + virtual void testRunEnded( TestRunStats const& testRunStats ) = 0; + + virtual void skipTest( TestCaseInfo const& testInfo ) = 0; + + // Default empty implementation provided + virtual void fatalErrorEncountered( StringRef name ); + + virtual bool isMulti() const; + }; + using IStreamingReporterPtr = std::unique_ptr; + + struct IReporterFactory { + virtual ~IReporterFactory(); + virtual IStreamingReporterPtr create( ReporterConfig const& config ) const = 0; + virtual std::string getDescription() const = 0; + }; + using IReporterFactoryPtr = std::shared_ptr; + + struct IReporterRegistry { + using FactoryMap = std::map; + using Listeners = std::vector; + + virtual ~IReporterRegistry(); + virtual IStreamingReporterPtr create( std::string const& name, IConfigPtr const& config ) const = 0; + virtual FactoryMap const& getFactories() const = 0; + virtual Listeners const& getListeners() const = 0; + }; + +} // end namespace Catch + +// end catch_interfaces_reporter.h +#include +#include +#include +#include +#include +#include +#include + +namespace Catch { + void prepareExpandedExpression(AssertionResult& result); + + // Returns double formatted as %.3f (format expected on output) + std::string getFormattedDuration( double duration ); + + template + struct StreamingReporterBase : IStreamingReporter { + + StreamingReporterBase( ReporterConfig const& _config ) + : m_config( _config.fullConfig() ), + stream( _config.stream() ) + { + m_reporterPrefs.shouldRedirectStdOut = false; + if( !DerivedT::getSupportedVerbosities().count( m_config->verbosity() ) ) + CATCH_ERROR( "Verbosity level not supported by this reporter" ); + } + + ReporterPreferences getPreferences() const override { + return m_reporterPrefs; + } + + static std::set getSupportedVerbosities() { + return { Verbosity::Normal }; + } + + ~StreamingReporterBase() override = default; + + void noMatchingTestCases(std::string const&) override {} + + void testRunStarting(TestRunInfo const& _testRunInfo) override { + currentTestRunInfo = _testRunInfo; + } + void testGroupStarting(GroupInfo const& _groupInfo) override { + currentGroupInfo = _groupInfo; + } + + void testCaseStarting(TestCaseInfo const& _testInfo) override { + currentTestCaseInfo = _testInfo; + } + void sectionStarting(SectionInfo const& _sectionInfo) override { + m_sectionStack.push_back(_sectionInfo); + } + + void sectionEnded(SectionStats const& /* _sectionStats */) override { + m_sectionStack.pop_back(); + } + void testCaseEnded(TestCaseStats const& /* _testCaseStats */) override { + currentTestCaseInfo.reset(); + } + void testGroupEnded(TestGroupStats const& /* _testGroupStats */) override { + currentGroupInfo.reset(); + } + void testRunEnded(TestRunStats const& /* _testRunStats */) override { + currentTestCaseInfo.reset(); + currentGroupInfo.reset(); + currentTestRunInfo.reset(); + } + + void skipTest(TestCaseInfo const&) override { + // Don't do anything with this by default. + // It can optionally be overridden in the derived class. + } + + IConfigPtr m_config; + std::ostream& stream; + + LazyStat currentTestRunInfo; + LazyStat currentGroupInfo; + LazyStat currentTestCaseInfo; + + std::vector m_sectionStack; + ReporterPreferences m_reporterPrefs; + }; + + template + struct CumulativeReporterBase : IStreamingReporter { + template + struct Node { + explicit Node( T const& _value ) : value( _value ) {} + virtual ~Node() {} + + using ChildNodes = std::vector>; + T value; + ChildNodes children; + }; + struct SectionNode { + explicit SectionNode(SectionStats const& _stats) : stats(_stats) {} + virtual ~SectionNode() = default; + + bool operator == (SectionNode const& other) const { + return stats.sectionInfo.lineInfo == other.stats.sectionInfo.lineInfo; + } + bool operator == (std::shared_ptr const& other) const { + return operator==(*other); + } + + SectionStats stats; + using ChildSections = std::vector>; + using Assertions = std::vector; + ChildSections childSections; + Assertions assertions; + std::string stdOut; + std::string stdErr; + }; + + struct BySectionInfo { + BySectionInfo( SectionInfo const& other ) : m_other( other ) {} + BySectionInfo( BySectionInfo const& other ) : m_other( other.m_other ) {} + bool operator() (std::shared_ptr const& node) const { + return ((node->stats.sectionInfo.name == m_other.name) && + (node->stats.sectionInfo.lineInfo == m_other.lineInfo)); + } + void operator=(BySectionInfo const&) = delete; + + private: + SectionInfo const& m_other; + }; + + using TestCaseNode = Node; + using TestGroupNode = Node; + using TestRunNode = Node; + + CumulativeReporterBase( ReporterConfig const& _config ) + : m_config( _config.fullConfig() ), + stream( _config.stream() ) + { + m_reporterPrefs.shouldRedirectStdOut = false; + if( !DerivedT::getSupportedVerbosities().count( m_config->verbosity() ) ) + CATCH_ERROR( "Verbosity level not supported by this reporter" ); + } + ~CumulativeReporterBase() override = default; + + ReporterPreferences getPreferences() const override { + return m_reporterPrefs; + } + + static std::set getSupportedVerbosities() { + return { Verbosity::Normal }; + } + + void testRunStarting( TestRunInfo const& ) override {} + void testGroupStarting( GroupInfo const& ) override {} + + void testCaseStarting( TestCaseInfo const& ) override {} + + void sectionStarting( SectionInfo const& sectionInfo ) override { + SectionStats incompleteStats( sectionInfo, Counts(), 0, false ); + std::shared_ptr node; + if( m_sectionStack.empty() ) { + if( !m_rootSection ) + m_rootSection = std::make_shared( incompleteStats ); + node = m_rootSection; + } + else { + SectionNode& parentNode = *m_sectionStack.back(); + auto it = + std::find_if( parentNode.childSections.begin(), + parentNode.childSections.end(), + BySectionInfo( sectionInfo ) ); + if( it == parentNode.childSections.end() ) { + node = std::make_shared( incompleteStats ); + parentNode.childSections.push_back( node ); + } + else + node = *it; + } + m_sectionStack.push_back( node ); + m_deepestSection = std::move(node); + } + + void assertionStarting(AssertionInfo const&) override {} + + bool assertionEnded(AssertionStats const& assertionStats) override { + assert(!m_sectionStack.empty()); + // AssertionResult holds a pointer to a temporary DecomposedExpression, + // which getExpandedExpression() calls to build the expression string. + // Our section stack copy of the assertionResult will likely outlive the + // temporary, so it must be expanded or discarded now to avoid calling + // a destroyed object later. + prepareExpandedExpression(const_cast( assertionStats.assertionResult ) ); + SectionNode& sectionNode = *m_sectionStack.back(); + sectionNode.assertions.push_back(assertionStats); + return true; + } + void sectionEnded(SectionStats const& sectionStats) override { + assert(!m_sectionStack.empty()); + SectionNode& node = *m_sectionStack.back(); + node.stats = sectionStats; + m_sectionStack.pop_back(); + } + void testCaseEnded(TestCaseStats const& testCaseStats) override { + auto node = std::make_shared(testCaseStats); + assert(m_sectionStack.size() == 0); + node->children.push_back(m_rootSection); + m_testCases.push_back(node); + m_rootSection.reset(); + + assert(m_deepestSection); + m_deepestSection->stdOut = testCaseStats.stdOut; + m_deepestSection->stdErr = testCaseStats.stdErr; + } + void testGroupEnded(TestGroupStats const& testGroupStats) override { + auto node = std::make_shared(testGroupStats); + node->children.swap(m_testCases); + m_testGroups.push_back(node); + } + void testRunEnded(TestRunStats const& testRunStats) override { + auto node = std::make_shared(testRunStats); + node->children.swap(m_testGroups); + m_testRuns.push_back(node); + testRunEndedCumulative(); + } + virtual void testRunEndedCumulative() = 0; + + void skipTest(TestCaseInfo const&) override {} + + IConfigPtr m_config; + std::ostream& stream; + std::vector m_assertions; + std::vector>> m_sections; + std::vector> m_testCases; + std::vector> m_testGroups; + + std::vector> m_testRuns; + + std::shared_ptr m_rootSection; + std::shared_ptr m_deepestSection; + std::vector> m_sectionStack; + ReporterPreferences m_reporterPrefs; + }; + + template + char const* getLineOfChars() { + static char line[CATCH_CONFIG_CONSOLE_WIDTH] = {0}; + if( !*line ) { + std::memset( line, C, CATCH_CONFIG_CONSOLE_WIDTH-1 ); + line[CATCH_CONFIG_CONSOLE_WIDTH-1] = 0; + } + return line; + } + + struct TestEventListenerBase : StreamingReporterBase { + TestEventListenerBase( ReporterConfig const& _config ); + + static std::set getSupportedVerbosities(); + + void assertionStarting(AssertionInfo const&) override; + bool assertionEnded(AssertionStats const&) override; + }; + +} // end namespace Catch + +// end catch_reporter_bases.hpp +// start catch_console_colour.h + +namespace Catch { + + struct Colour { + enum Code { + None = 0, + + White, + Red, + Green, + Blue, + Cyan, + Yellow, + Grey, + + Bright = 0x10, + + BrightRed = Bright | Red, + BrightGreen = Bright | Green, + LightGrey = Bright | Grey, + BrightWhite = Bright | White, + BrightYellow = Bright | Yellow, + + // By intention + FileName = LightGrey, + Warning = BrightYellow, + ResultError = BrightRed, + ResultSuccess = BrightGreen, + ResultExpectedFailure = Warning, + + Error = BrightRed, + Success = Green, + + OriginalExpression = Cyan, + ReconstructedExpression = BrightYellow, + + SecondaryText = LightGrey, + Headers = White + }; + + // Use constructed object for RAII guard + Colour( Code _colourCode ); + Colour( Colour&& other ) noexcept; + Colour& operator=( Colour&& other ) noexcept; + ~Colour(); + + // Use static method for one-shot changes + static void use( Code _colourCode ); + + private: + bool m_moved = false; + }; + + std::ostream& operator << ( std::ostream& os, Colour const& ); + +} // end namespace Catch + +// end catch_console_colour.h +// start catch_reporter_registrars.hpp + + +namespace Catch { + + template + class ReporterRegistrar { + + class ReporterFactory : public IReporterFactory { + + virtual IStreamingReporterPtr create( ReporterConfig const& config ) const override { + return std::unique_ptr( new T( config ) ); + } + + virtual std::string getDescription() const override { + return T::getDescription(); + } + }; + + public: + + explicit ReporterRegistrar( std::string const& name ) { + getMutableRegistryHub().registerReporter( name, std::make_shared() ); + } + }; + + template + class ListenerRegistrar { + + class ListenerFactory : public IReporterFactory { + + virtual IStreamingReporterPtr create( ReporterConfig const& config ) const override { + return std::unique_ptr( new T( config ) ); + } + virtual std::string getDescription() const override { + return std::string(); + } + }; + + public: + + ListenerRegistrar() { + getMutableRegistryHub().registerListener( std::make_shared() ); + } + }; +} + +#if !defined(CATCH_CONFIG_DISABLE) + +#define CATCH_REGISTER_REPORTER( name, reporterType ) \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ Catch::ReporterRegistrar catch_internal_RegistrarFor##reporterType( name ); } \ + CATCH_INTERNAL_UNSUPPRESS_GLOBALS_WARNINGS + +#define CATCH_REGISTER_LISTENER( listenerType ) \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS \ + namespace{ Catch::ListenerRegistrar catch_internal_RegistrarFor##listenerType; } \ + CATCH_INTERNAL_SUPPRESS_GLOBALS_WARNINGS +#else // CATCH_CONFIG_DISABLE + +#define CATCH_REGISTER_REPORTER(name, reporterType) +#define CATCH_REGISTER_LISTENER(listenerType) + +#endif // CATCH_CONFIG_DISABLE + +// end catch_reporter_registrars.hpp +// Allow users to base their work off existing reporters +// start catch_reporter_compact.h + +namespace Catch { + + struct CompactReporter : StreamingReporterBase { + + using StreamingReporterBase::StreamingReporterBase; + + ~CompactReporter() override; + + static std::string getDescription(); + + ReporterPreferences getPreferences() const override; + + void noMatchingTestCases(std::string const& spec) override; + + void assertionStarting(AssertionInfo const&) override; + + bool assertionEnded(AssertionStats const& _assertionStats) override; + + void sectionEnded(SectionStats const& _sectionStats) override; + + void testRunEnded(TestRunStats const& _testRunStats) override; + + }; + +} // end namespace Catch + +// end catch_reporter_compact.h +// start catch_reporter_console.h + +#if defined(_MSC_VER) +#pragma warning(push) +#pragma warning(disable:4061) // Not all labels are EXPLICITLY handled in switch + // Note that 4062 (not all labels are handled + // and default is missing) is enabled +#endif + +namespace Catch { + // Fwd decls + struct SummaryColumn; + class TablePrinter; + + struct ConsoleReporter : StreamingReporterBase { + std::unique_ptr m_tablePrinter; + + ConsoleReporter(ReporterConfig const& config); + ~ConsoleReporter() override; + static std::string getDescription(); + + void noMatchingTestCases(std::string const& spec) override; + + void assertionStarting(AssertionInfo const&) override; + + bool assertionEnded(AssertionStats const& _assertionStats) override; + + void sectionStarting(SectionInfo const& _sectionInfo) override; + void sectionEnded(SectionStats const& _sectionStats) override; + + void benchmarkStarting(BenchmarkInfo const& info) override; + void benchmarkEnded(BenchmarkStats const& stats) override; + + void testCaseEnded(TestCaseStats const& _testCaseStats) override; + void testGroupEnded(TestGroupStats const& _testGroupStats) override; + void testRunEnded(TestRunStats const& _testRunStats) override; + + private: + + void lazyPrint(); + + void lazyPrintWithoutClosingBenchmarkTable(); + void lazyPrintRunInfo(); + void lazyPrintGroupInfo(); + void printTestCaseAndSectionHeader(); + + void printClosedHeader(std::string const& _name); + void printOpenHeader(std::string const& _name); + + // if string has a : in first line will set indent to follow it on + // subsequent lines + void printHeaderString(std::string const& _string, std::size_t indent = 0); + + void printTotals(Totals const& totals); + void printSummaryRow(std::string const& label, std::vector const& cols, std::size_t row); + + void printTotalsDivider(Totals const& totals); + void printSummaryDivider(); + + private: + bool m_headerPrinted = false; + }; + +} // end namespace Catch + +#if defined(_MSC_VER) +#pragma warning(pop) +#endif + +// end catch_reporter_console.h +// start catch_reporter_junit.h + +// start catch_xmlwriter.h + +#include + +namespace Catch { + + class XmlEncode { + public: + enum ForWhat { ForTextNodes, ForAttributes }; + + XmlEncode( std::string const& str, ForWhat forWhat = ForTextNodes ); + + void encodeTo( std::ostream& os ) const; + + friend std::ostream& operator << ( std::ostream& os, XmlEncode const& xmlEncode ); + + private: + std::string m_str; + ForWhat m_forWhat; + }; + + class XmlWriter { + public: + + class ScopedElement { + public: + ScopedElement( XmlWriter* writer ); + + ScopedElement( ScopedElement&& other ) noexcept; + ScopedElement& operator=( ScopedElement&& other ) noexcept; + + ~ScopedElement(); + + ScopedElement& writeText( std::string const& text, bool indent = true ); + + template + ScopedElement& writeAttribute( std::string const& name, T const& attribute ) { + m_writer->writeAttribute( name, attribute ); + return *this; + } + + private: + mutable XmlWriter* m_writer = nullptr; + }; + + XmlWriter( std::ostream& os = Catch::cout() ); + ~XmlWriter(); + + XmlWriter( XmlWriter const& ) = delete; + XmlWriter& operator=( XmlWriter const& ) = delete; + + XmlWriter& startElement( std::string const& name ); + + ScopedElement scopedElement( std::string const& name ); + + XmlWriter& endElement(); + + XmlWriter& writeAttribute( std::string const& name, std::string const& attribute ); + + XmlWriter& writeAttribute( std::string const& name, bool attribute ); + + template + XmlWriter& writeAttribute( std::string const& name, T const& attribute ) { + ReusableStringStream rss; + rss << attribute; + return writeAttribute( name, rss.str() ); + } + + XmlWriter& writeText( std::string const& text, bool indent = true ); + + XmlWriter& writeComment( std::string const& text ); + + void writeStylesheetRef( std::string const& url ); + + XmlWriter& writeBlankLine(); + + void ensureTagClosed(); + + private: + + void writeDeclaration(); + + void newlineIfNecessary(); + + bool m_tagIsOpen = false; + bool m_needsNewline = false; + std::vector m_tags; + std::string m_indent; + std::ostream& m_os; + }; + +} + +// end catch_xmlwriter.h +namespace Catch { + + class JunitReporter : public CumulativeReporterBase { + public: + JunitReporter(ReporterConfig const& _config); + + ~JunitReporter() override; + + static std::string getDescription(); + + void noMatchingTestCases(std::string const& /*spec*/) override; + + void testRunStarting(TestRunInfo const& runInfo) override; + + void testGroupStarting(GroupInfo const& groupInfo) override; + + void testCaseStarting(TestCaseInfo const& testCaseInfo) override; + bool assertionEnded(AssertionStats const& assertionStats) override; + + void testCaseEnded(TestCaseStats const& testCaseStats) override; + + void testGroupEnded(TestGroupStats const& testGroupStats) override; + + void testRunEndedCumulative() override; + + void writeGroup(TestGroupNode const& groupNode, double suiteTime); + + void writeTestCase(TestCaseNode const& testCaseNode); + + void writeSection(std::string const& className, + std::string const& rootName, + SectionNode const& sectionNode); + + void writeAssertions(SectionNode const& sectionNode); + void writeAssertion(AssertionStats const& stats); + + XmlWriter xml; + Timer suiteTimer; + std::string stdOutForSuite; + std::string stdErrForSuite; + unsigned int unexpectedExceptions = 0; + bool m_okToFail = false; + }; + +} // end namespace Catch + +// end catch_reporter_junit.h +// start catch_reporter_xml.h + +namespace Catch { + class XmlReporter : public StreamingReporterBase { + public: + XmlReporter(ReporterConfig const& _config); + + ~XmlReporter() override; + + static std::string getDescription(); + + virtual std::string getStylesheetRef() const; + + void writeSourceInfo(SourceLineInfo const& sourceInfo); + + public: // StreamingReporterBase + + void noMatchingTestCases(std::string const& s) override; + + void testRunStarting(TestRunInfo const& testInfo) override; + + void testGroupStarting(GroupInfo const& groupInfo) override; + + void testCaseStarting(TestCaseInfo const& testInfo) override; + + void sectionStarting(SectionInfo const& sectionInfo) override; + + void assertionStarting(AssertionInfo const&) override; + + bool assertionEnded(AssertionStats const& assertionStats) override; + + void sectionEnded(SectionStats const& sectionStats) override; + + void testCaseEnded(TestCaseStats const& testCaseStats) override; + + void testGroupEnded(TestGroupStats const& testGroupStats) override; + + void testRunEnded(TestRunStats const& testRunStats) override; + + private: + Timer m_testCaseTimer; + XmlWriter m_xml; + int m_sectionDepth = 0; + }; + +} // end namespace Catch + +// end catch_reporter_xml.h + +// end catch_external_interfaces.h +#endif + +#endif // ! CATCH_CONFIG_IMPL_ONLY + +#ifdef CATCH_IMPL +// start catch_impl.hpp + +#ifdef __clang__ +#pragma clang diagnostic push +#pragma clang diagnostic ignored "-Wweak-vtables" +#endif + +// Keep these here for external reporters +// start catch_test_case_tracker.h + +#include +#include +#include + +namespace Catch { +namespace TestCaseTracking { + + struct NameAndLocation { + std::string name; + SourceLineInfo location; + + NameAndLocation( std::string const& _name, SourceLineInfo const& _location ); + }; + + struct ITracker; + + using ITrackerPtr = std::shared_ptr; + + struct ITracker { + virtual ~ITracker(); + + // static queries + virtual NameAndLocation const& nameAndLocation() const = 0; + + // dynamic queries + virtual bool isComplete() const = 0; // Successfully completed or failed + virtual bool isSuccessfullyCompleted() const = 0; + virtual bool isOpen() const = 0; // Started but not complete + virtual bool hasChildren() const = 0; + + virtual ITracker& parent() = 0; + + // actions + virtual void close() = 0; // Successfully complete + virtual void fail() = 0; + virtual void markAsNeedingAnotherRun() = 0; + + virtual void addChild( ITrackerPtr const& child ) = 0; + virtual ITrackerPtr findChild( NameAndLocation const& nameAndLocation ) = 0; + virtual void openChild() = 0; + + // Debug/ checking + virtual bool isSectionTracker() const = 0; + virtual bool isGeneratorTracker() const = 0; + }; + + class TrackerContext { + + enum RunState { + NotStarted, + Executing, + CompletedCycle + }; + + ITrackerPtr m_rootTracker; + ITracker* m_currentTracker = nullptr; + RunState m_runState = NotStarted; + + public: + + static TrackerContext& instance(); + + ITracker& startRun(); + void endRun(); + + void startCycle(); + void completeCycle(); + + bool completedCycle() const; + ITracker& currentTracker(); + void setCurrentTracker( ITracker* tracker ); + }; + + class TrackerBase : public ITracker { + protected: + enum CycleState { + NotStarted, + Executing, + ExecutingChildren, + NeedsAnotherRun, + CompletedSuccessfully, + Failed + }; + + using Children = std::vector; + NameAndLocation m_nameAndLocation; + TrackerContext& m_ctx; + ITracker* m_parent; + Children m_children; + CycleState m_runState = NotStarted; + + public: + TrackerBase( NameAndLocation const& nameAndLocation, TrackerContext& ctx, ITracker* parent ); + + NameAndLocation const& nameAndLocation() const override; + bool isComplete() const override; + bool isSuccessfullyCompleted() const override; + bool isOpen() const override; + bool hasChildren() const override; + + void addChild( ITrackerPtr const& child ) override; + + ITrackerPtr findChild( NameAndLocation const& nameAndLocation ) override; + ITracker& parent() override; + + void openChild() override; + + bool isSectionTracker() const override; + bool isGeneratorTracker() const override; + + void open(); + + void close() override; + void fail() override; + void markAsNeedingAnotherRun() override; + + private: + void moveToParent(); + void moveToThis(); + }; + + class SectionTracker : public TrackerBase { + std::vector m_filters; + public: + SectionTracker( NameAndLocation const& nameAndLocation, TrackerContext& ctx, ITracker* parent ); + + bool isSectionTracker() const override; + + bool isComplete() const override; + + static SectionTracker& acquire( TrackerContext& ctx, NameAndLocation const& nameAndLocation ); + + void tryOpen(); + + void addInitialFilters( std::vector const& filters ); + void addNextFilters( std::vector const& filters ); + }; + +} // namespace TestCaseTracking + +using TestCaseTracking::ITracker; +using TestCaseTracking::TrackerContext; +using TestCaseTracking::SectionTracker; + +} // namespace Catch + +// end catch_test_case_tracker.h + +// start catch_leak_detector.h + +namespace Catch { + + struct LeakDetector { + LeakDetector(); + ~LeakDetector(); + }; + +} +// end catch_leak_detector.h +// Cpp files will be included in the single-header file here +// start catch_approx.cpp + +#include +#include + +namespace { + +// Performs equivalent check of std::fabs(lhs - rhs) <= margin +// But without the subtraction to allow for INFINITY in comparison +bool marginComparison(double lhs, double rhs, double margin) { + return (lhs + margin >= rhs) && (rhs + margin >= lhs); +} + +} + +namespace Catch { +namespace Detail { + + Approx::Approx ( double value ) + : m_epsilon( std::numeric_limits::epsilon()*100 ), + m_margin( 0.0 ), + m_scale( 0.0 ), + m_value( value ) + {} + + Approx Approx::custom() { + return Approx( 0 ); + } + + Approx Approx::operator-() const { + auto temp(*this); + temp.m_value = -temp.m_value; + return temp; + } + + std::string Approx::toString() const { + ReusableStringStream rss; + rss << "Approx( " << ::Catch::Detail::stringify( m_value ) << " )"; + return rss.str(); + } + + bool Approx::equalityComparisonImpl(const double other) const { + // First try with fixed margin, then compute margin based on epsilon, scale and Approx's value + // Thanks to Richard Harris for his help refining the scaled margin value + return marginComparison(m_value, other, m_margin) || marginComparison(m_value, other, m_epsilon * (m_scale + std::fabs(m_value))); + } + + void Approx::setMargin(double margin) { + CATCH_ENFORCE(margin >= 0, + "Invalid Approx::margin: " << margin << '.' + << " Approx::Margin has to be non-negative."); + m_margin = margin; + } + + void Approx::setEpsilon(double epsilon) { + CATCH_ENFORCE(epsilon >= 0 && epsilon <= 1.0, + "Invalid Approx::epsilon: " << epsilon << '.' + << " Approx::epsilon has to be in [0, 1]"); + m_epsilon = epsilon; + } + +} // end namespace Detail + +namespace literals { + Detail::Approx operator "" _a(long double val) { + return Detail::Approx(val); + } + Detail::Approx operator "" _a(unsigned long long val) { + return Detail::Approx(val); + } +} // end namespace literals + +std::string StringMaker::convert(Catch::Detail::Approx const& value) { + return value.toString(); +} + +} // end namespace Catch +// end catch_approx.cpp +// start catch_assertionhandler.cpp + +// start catch_debugger.h + +namespace Catch { + bool isDebuggerActive(); +} + +#ifdef CATCH_PLATFORM_MAC + + #define CATCH_TRAP() __asm__("int $3\n" : : ) /* NOLINT */ + +#elif defined(CATCH_PLATFORM_LINUX) + // If we can use inline assembler, do it because this allows us to break + // directly at the location of the failing check instead of breaking inside + // raise() called from it, i.e. one stack frame below. + #if defined(__GNUC__) && (defined(__i386) || defined(__x86_64)) + #define CATCH_TRAP() asm volatile ("int $3") /* NOLINT */ + #else // Fall back to the generic way. + #include + + #define CATCH_TRAP() raise(SIGTRAP) + #endif +#elif defined(_MSC_VER) + #define CATCH_TRAP() __debugbreak() +#elif defined(__MINGW32__) + extern "C" __declspec(dllimport) void __stdcall DebugBreak(); + #define CATCH_TRAP() DebugBreak() +#endif + +#ifdef CATCH_TRAP + #define CATCH_BREAK_INTO_DEBUGGER() []{ if( Catch::isDebuggerActive() ) { CATCH_TRAP(); } }() +#else + #define CATCH_BREAK_INTO_DEBUGGER() []{}() +#endif + +// end catch_debugger.h +// start catch_run_context.h + +// start catch_fatal_condition.h + +// start catch_windows_h_proxy.h + + +#if defined(CATCH_PLATFORM_WINDOWS) + +#if !defined(NOMINMAX) && !defined(CATCH_CONFIG_NO_NOMINMAX) +# define CATCH_DEFINED_NOMINMAX +# define NOMINMAX +#endif +#if !defined(WIN32_LEAN_AND_MEAN) && !defined(CATCH_CONFIG_NO_WIN32_LEAN_AND_MEAN) +# define CATCH_DEFINED_WIN32_LEAN_AND_MEAN +# define WIN32_LEAN_AND_MEAN +#endif + +#ifdef __AFXDLL +#include +#else +#include +#endif + +#ifdef CATCH_DEFINED_NOMINMAX +# undef NOMINMAX +#endif +#ifdef CATCH_DEFINED_WIN32_LEAN_AND_MEAN +# undef WIN32_LEAN_AND_MEAN +#endif + +#endif // defined(CATCH_PLATFORM_WINDOWS) + +// end catch_windows_h_proxy.h +#if defined( CATCH_CONFIG_WINDOWS_SEH ) + +namespace Catch { + + struct FatalConditionHandler { + + static LONG CALLBACK handleVectoredException(PEXCEPTION_POINTERS ExceptionInfo); + FatalConditionHandler(); + static void reset(); + ~FatalConditionHandler(); + + private: + static bool isSet; + static ULONG guaranteeSize; + static PVOID exceptionHandlerHandle; + }; + +} // namespace Catch + +#elif defined ( CATCH_CONFIG_POSIX_SIGNALS ) + +#include + +namespace Catch { + + struct FatalConditionHandler { + + static bool isSet; + static struct sigaction oldSigActions[]; + static stack_t oldSigStack; + static char altStackMem[]; + + static void handleSignal( int sig ); + + FatalConditionHandler(); + ~FatalConditionHandler(); + static void reset(); + }; + +} // namespace Catch + +#else + +namespace Catch { + struct FatalConditionHandler { + void reset(); + }; +} + +#endif + +// end catch_fatal_condition.h +#include + +namespace Catch { + + struct IMutableContext; + + /////////////////////////////////////////////////////////////////////////// + + class RunContext : public IResultCapture, public IRunner { + + public: + RunContext( RunContext const& ) = delete; + RunContext& operator =( RunContext const& ) = delete; + + explicit RunContext( IConfigPtr const& _config, IStreamingReporterPtr&& reporter ); + + ~RunContext() override; + + void testGroupStarting( std::string const& testSpec, std::size_t groupIndex, std::size_t groupsCount ); + void testGroupEnded( std::string const& testSpec, Totals const& totals, std::size_t groupIndex, std::size_t groupsCount ); + + Totals runTest(TestCase const& testCase); + + IConfigPtr config() const; + IStreamingReporter& reporter() const; + + public: // IResultCapture + + // Assertion handlers + void handleExpr + ( AssertionInfo const& info, + ITransientExpression const& expr, + AssertionReaction& reaction ) override; + void handleMessage + ( AssertionInfo const& info, + ResultWas::OfType resultType, + StringRef const& message, + AssertionReaction& reaction ) override; + void handleUnexpectedExceptionNotThrown + ( AssertionInfo const& info, + AssertionReaction& reaction ) override; + void handleUnexpectedInflightException + ( AssertionInfo const& info, + std::string const& message, + AssertionReaction& reaction ) override; + void handleIncomplete + ( AssertionInfo const& info ) override; + void handleNonExpr + ( AssertionInfo const &info, + ResultWas::OfType resultType, + AssertionReaction &reaction ) override; + + bool sectionStarted( SectionInfo const& sectionInfo, Counts& assertions ) override; + + void sectionEnded( SectionEndInfo const& endInfo ) override; + void sectionEndedEarly( SectionEndInfo const& endInfo ) override; + + auto acquireGeneratorTracker( SourceLineInfo const& lineInfo ) -> IGeneratorTracker& override; + + void benchmarkStarting( BenchmarkInfo const& info ) override; + void benchmarkEnded( BenchmarkStats const& stats ) override; + + void pushScopedMessage( MessageInfo const& message ) override; + void popScopedMessage( MessageInfo const& message ) override; + + void emplaceUnscopedMessage( MessageBuilder const& builder ) override; + + std::string getCurrentTestName() const override; + + const AssertionResult* getLastResult() const override; + + void exceptionEarlyReported() override; + + void handleFatalErrorCondition( StringRef message ) override; + + bool lastAssertionPassed() override; + + void assertionPassed() override; + + public: + // !TBD We need to do this another way! + bool aborting() const final; + + private: + + void runCurrentTest( std::string& redirectedCout, std::string& redirectedCerr ); + void invokeActiveTestCase(); + + void resetAssertionInfo(); + bool testForMissingAssertions( Counts& assertions ); + + void assertionEnded( AssertionResult const& result ); + void reportExpr + ( AssertionInfo const &info, + ResultWas::OfType resultType, + ITransientExpression const *expr, + bool negated ); + + void populateReaction( AssertionReaction& reaction ); + + private: + + void handleUnfinishedSections(); + + TestRunInfo m_runInfo; + IMutableContext& m_context; + TestCase const* m_activeTestCase = nullptr; + ITracker* m_testCaseTracker = nullptr; + Option m_lastResult; + + IConfigPtr m_config; + Totals m_totals; + IStreamingReporterPtr m_reporter; + std::vector m_messages; + std::vector m_messageScopes; /* Keeps owners of so-called unscoped messages. */ + AssertionInfo m_lastAssertionInfo; + std::vector m_unfinishedSections; + std::vector m_activeSections; + TrackerContext m_trackerContext; + bool m_lastAssertionPassed = false; + bool m_shouldReportUnexpected = true; + bool m_includeSuccessfulResults; + }; + +} // end namespace Catch + +// end catch_run_context.h +namespace Catch { + + namespace { + auto operator <<( std::ostream& os, ITransientExpression const& expr ) -> std::ostream& { + expr.streamReconstructedExpression( os ); + return os; + } + } + + LazyExpression::LazyExpression( bool isNegated ) + : m_isNegated( isNegated ) + {} + + LazyExpression::LazyExpression( LazyExpression const& other ) : m_isNegated( other.m_isNegated ) {} + + LazyExpression::operator bool() const { + return m_transientExpression != nullptr; + } + + auto operator << ( std::ostream& os, LazyExpression const& lazyExpr ) -> std::ostream& { + if( lazyExpr.m_isNegated ) + os << "!"; + + if( lazyExpr ) { + if( lazyExpr.m_isNegated && lazyExpr.m_transientExpression->isBinaryExpression() ) + os << "(" << *lazyExpr.m_transientExpression << ")"; + else + os << *lazyExpr.m_transientExpression; + } + else { + os << "{** error - unchecked empty expression requested **}"; + } + return os; + } + + AssertionHandler::AssertionHandler + ( StringRef const& macroName, + SourceLineInfo const& lineInfo, + StringRef capturedExpression, + ResultDisposition::Flags resultDisposition ) + : m_assertionInfo{ macroName, lineInfo, capturedExpression, resultDisposition }, + m_resultCapture( getResultCapture() ) + {} + + void AssertionHandler::handleExpr( ITransientExpression const& expr ) { + m_resultCapture.handleExpr( m_assertionInfo, expr, m_reaction ); + } + void AssertionHandler::handleMessage(ResultWas::OfType resultType, StringRef const& message) { + m_resultCapture.handleMessage( m_assertionInfo, resultType, message, m_reaction ); + } + + auto AssertionHandler::allowThrows() const -> bool { + return getCurrentContext().getConfig()->allowThrows(); + } + + void AssertionHandler::complete() { + setCompleted(); + if( m_reaction.shouldDebugBreak ) { + + // If you find your debugger stopping you here then go one level up on the + // call-stack for the code that caused it (typically a failed assertion) + + // (To go back to the test and change execution, jump over the throw, next) + CATCH_BREAK_INTO_DEBUGGER(); + } + if (m_reaction.shouldThrow) { +#if !defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) + throw Catch::TestFailureException(); +#else + CATCH_ERROR( "Test failure requires aborting test!" ); +#endif + } + } + void AssertionHandler::setCompleted() { + m_completed = true; + } + + void AssertionHandler::handleUnexpectedInflightException() { + m_resultCapture.handleUnexpectedInflightException( m_assertionInfo, Catch::translateActiveException(), m_reaction ); + } + + void AssertionHandler::handleExceptionThrownAsExpected() { + m_resultCapture.handleNonExpr(m_assertionInfo, ResultWas::Ok, m_reaction); + } + void AssertionHandler::handleExceptionNotThrownAsExpected() { + m_resultCapture.handleNonExpr(m_assertionInfo, ResultWas::Ok, m_reaction); + } + + void AssertionHandler::handleUnexpectedExceptionNotThrown() { + m_resultCapture.handleUnexpectedExceptionNotThrown( m_assertionInfo, m_reaction ); + } + + void AssertionHandler::handleThrowingCallSkipped() { + m_resultCapture.handleNonExpr(m_assertionInfo, ResultWas::Ok, m_reaction); + } + + // This is the overload that takes a string and infers the Equals matcher from it + // The more general overload, that takes any string matcher, is in catch_capture_matchers.cpp + void handleExceptionMatchExpr( AssertionHandler& handler, std::string const& str, StringRef const& matcherString ) { + handleExceptionMatchExpr( handler, Matchers::Equals( str ), matcherString ); + } + +} // namespace Catch +// end catch_assertionhandler.cpp +// start catch_assertionresult.cpp + +namespace Catch { + AssertionResultData::AssertionResultData(ResultWas::OfType _resultType, LazyExpression const & _lazyExpression): + lazyExpression(_lazyExpression), + resultType(_resultType) {} + + std::string AssertionResultData::reconstructExpression() const { + + if( reconstructedExpression.empty() ) { + if( lazyExpression ) { + ReusableStringStream rss; + rss << lazyExpression; + reconstructedExpression = rss.str(); + } + } + return reconstructedExpression; + } + + AssertionResult::AssertionResult( AssertionInfo const& info, AssertionResultData const& data ) + : m_info( info ), + m_resultData( data ) + {} + + // Result was a success + bool AssertionResult::succeeded() const { + return Catch::isOk( m_resultData.resultType ); + } + + // Result was a success, or failure is suppressed + bool AssertionResult::isOk() const { + return Catch::isOk( m_resultData.resultType ) || shouldSuppressFailure( m_info.resultDisposition ); + } + + ResultWas::OfType AssertionResult::getResultType() const { + return m_resultData.resultType; + } + + bool AssertionResult::hasExpression() const { + return m_info.capturedExpression[0] != 0; + } + + bool AssertionResult::hasMessage() const { + return !m_resultData.message.empty(); + } + + std::string AssertionResult::getExpression() const { + if( isFalseTest( m_info.resultDisposition ) ) + return "!(" + m_info.capturedExpression + ")"; + else + return m_info.capturedExpression; + } + + std::string AssertionResult::getExpressionInMacro() const { + std::string expr; + if( m_info.macroName[0] == 0 ) + expr = m_info.capturedExpression; + else { + expr.reserve( m_info.macroName.size() + m_info.capturedExpression.size() + 4 ); + expr += m_info.macroName; + expr += "( "; + expr += m_info.capturedExpression; + expr += " )"; + } + return expr; + } + + bool AssertionResult::hasExpandedExpression() const { + return hasExpression() && getExpandedExpression() != getExpression(); + } + + std::string AssertionResult::getExpandedExpression() const { + std::string expr = m_resultData.reconstructExpression(); + return expr.empty() + ? getExpression() + : expr; + } + + std::string AssertionResult::getMessage() const { + return m_resultData.message; + } + SourceLineInfo AssertionResult::getSourceInfo() const { + return m_info.lineInfo; + } + + StringRef AssertionResult::getTestMacroName() const { + return m_info.macroName; + } + +} // end namespace Catch +// end catch_assertionresult.cpp +// start catch_benchmark.cpp + +namespace Catch { + + auto BenchmarkLooper::getResolution() -> uint64_t { + return getEstimatedClockResolution() * getCurrentContext().getConfig()->benchmarkResolutionMultiple(); + } + + void BenchmarkLooper::reportStart() { + getResultCapture().benchmarkStarting( { m_name } ); + } + auto BenchmarkLooper::needsMoreIterations() -> bool { + auto elapsed = m_timer.getElapsedNanoseconds(); + + // Exponentially increasing iterations until we're confident in our timer resolution + if( elapsed < m_resolution ) { + m_iterationsToRun *= 10; + return true; + } + + getResultCapture().benchmarkEnded( { { m_name }, m_count, elapsed } ); + return false; + } + +} // end namespace Catch +// end catch_benchmark.cpp +// start catch_capture_matchers.cpp + +namespace Catch { + + using StringMatcher = Matchers::Impl::MatcherBase; + + // This is the general overload that takes a any string matcher + // There is another overload, in catch_assertionhandler.h/.cpp, that only takes a string and infers + // the Equals matcher (so the header does not mention matchers) + void handleExceptionMatchExpr( AssertionHandler& handler, StringMatcher const& matcher, StringRef const& matcherString ) { + std::string exceptionMessage = Catch::translateActiveException(); + MatchExpr expr( exceptionMessage, matcher, matcherString ); + handler.handleExpr( expr ); + } + +} // namespace Catch +// end catch_capture_matchers.cpp +// start catch_commandline.cpp + +// start catch_commandline.h + +// start catch_clara.h + +// Use Catch's value for console width (store Clara's off to the side, if present) +#ifdef CLARA_CONFIG_CONSOLE_WIDTH +#define CATCH_TEMP_CLARA_CONFIG_CONSOLE_WIDTH CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH +#undef CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH +#endif +#define CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH CATCH_CONFIG_CONSOLE_WIDTH-1 + +#ifdef __clang__ +#pragma clang diagnostic push +#pragma clang diagnostic ignored "-Wweak-vtables" +#pragma clang diagnostic ignored "-Wexit-time-destructors" +#pragma clang diagnostic ignored "-Wshadow" +#endif + +// start clara.hpp +// Copyright 2017 Two Blue Cubes Ltd. All rights reserved. +// +// Distributed under the Boost Software License, Version 1.0. (See accompanying +// file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt) +// +// See https://github.com/philsquared/Clara for more details + +// Clara v1.1.5 + + +#ifndef CATCH_CLARA_CONFIG_CONSOLE_WIDTH +#define CATCH_CLARA_CONFIG_CONSOLE_WIDTH 80 +#endif + +#ifndef CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH +#define CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH CATCH_CLARA_CONFIG_CONSOLE_WIDTH +#endif + +#ifndef CLARA_CONFIG_OPTIONAL_TYPE +#ifdef __has_include +#if __has_include() && __cplusplus >= 201703L +#include +#define CLARA_CONFIG_OPTIONAL_TYPE std::optional +#endif +#endif +#endif + +// ----------- #included from clara_textflow.hpp ----------- + +// TextFlowCpp +// +// A single-header library for wrapping and laying out basic text, by Phil Nash +// +// Distributed under the Boost Software License, Version 1.0. (See accompanying +// file LICENSE.txt or copy at http://www.boost.org/LICENSE_1_0.txt) +// +// This project is hosted at https://github.com/philsquared/textflowcpp + + +#include +#include +#include +#include + +#ifndef CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH +#define CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH 80 +#endif + +namespace Catch { +namespace clara { +namespace TextFlow { + +inline auto isWhitespace(char c) -> bool { + static std::string chars = " \t\n\r"; + return chars.find(c) != std::string::npos; +} +inline auto isBreakableBefore(char c) -> bool { + static std::string chars = "[({<|"; + return chars.find(c) != std::string::npos; +} +inline auto isBreakableAfter(char c) -> bool { + static std::string chars = "])}>.,:;*+-=&/\\"; + return chars.find(c) != std::string::npos; +} + +class Columns; + +class Column { + std::vector m_strings; + size_t m_width = CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH; + size_t m_indent = 0; + size_t m_initialIndent = std::string::npos; + +public: + class iterator { + friend Column; + + Column const& m_column; + size_t m_stringIndex = 0; + size_t m_pos = 0; + + size_t m_len = 0; + size_t m_end = 0; + bool m_suffix = false; + + iterator(Column const& column, size_t stringIndex) + : m_column(column), + m_stringIndex(stringIndex) {} + + auto line() const -> std::string const& { return m_column.m_strings[m_stringIndex]; } + + auto isBoundary(size_t at) const -> bool { + assert(at > 0); + assert(at <= line().size()); + + return at == line().size() || + (isWhitespace(line()[at]) && !isWhitespace(line()[at - 1])) || + isBreakableBefore(line()[at]) || + isBreakableAfter(line()[at - 1]); + } + + void calcLength() { + assert(m_stringIndex < m_column.m_strings.size()); + + m_suffix = false; + auto width = m_column.m_width - indent(); + m_end = m_pos; + while (m_end < line().size() && line()[m_end] != '\n') + ++m_end; + + if (m_end < m_pos + width) { + m_len = m_end - m_pos; + } else { + size_t len = width; + while (len > 0 && !isBoundary(m_pos + len)) + --len; + while (len > 0 && isWhitespace(line()[m_pos + len - 1])) + --len; + + if (len > 0) { + m_len = len; + } else { + m_suffix = true; + m_len = width - 1; + } + } + } + + auto indent() const -> size_t { + auto initial = m_pos == 0 && m_stringIndex == 0 ? m_column.m_initialIndent : std::string::npos; + return initial == std::string::npos ? m_column.m_indent : initial; + } + + auto addIndentAndSuffix(std::string const &plain) const -> std::string { + return std::string(indent(), ' ') + (m_suffix ? plain + "-" : plain); + } + + public: + using difference_type = std::ptrdiff_t; + using value_type = std::string; + using pointer = value_type * ; + using reference = value_type & ; + using iterator_category = std::forward_iterator_tag; + + explicit iterator(Column const& column) : m_column(column) { + assert(m_column.m_width > m_column.m_indent); + assert(m_column.m_initialIndent == std::string::npos || m_column.m_width > m_column.m_initialIndent); + calcLength(); + if (m_len == 0) + m_stringIndex++; // Empty string + } + + auto operator *() const -> std::string { + assert(m_stringIndex < m_column.m_strings.size()); + assert(m_pos <= m_end); + return addIndentAndSuffix(line().substr(m_pos, m_len)); + } + + auto operator ++() -> iterator& { + m_pos += m_len; + if (m_pos < line().size() && line()[m_pos] == '\n') + m_pos += 1; + else + while (m_pos < line().size() && isWhitespace(line()[m_pos])) + ++m_pos; + + if (m_pos == line().size()) { + m_pos = 0; + ++m_stringIndex; + } + if (m_stringIndex < m_column.m_strings.size()) + calcLength(); + return *this; + } + auto operator ++(int) -> iterator { + iterator prev(*this); + operator++(); + return prev; + } + + auto operator ==(iterator const& other) const -> bool { + return + m_pos == other.m_pos && + m_stringIndex == other.m_stringIndex && + &m_column == &other.m_column; + } + auto operator !=(iterator const& other) const -> bool { + return !operator==(other); + } + }; + using const_iterator = iterator; + + explicit Column(std::string const& text) { m_strings.push_back(text); } + + auto width(size_t newWidth) -> Column& { + assert(newWidth > 0); + m_width = newWidth; + return *this; + } + auto indent(size_t newIndent) -> Column& { + m_indent = newIndent; + return *this; + } + auto initialIndent(size_t newIndent) -> Column& { + m_initialIndent = newIndent; + return *this; + } + + auto width() const -> size_t { return m_width; } + auto begin() const -> iterator { return iterator(*this); } + auto end() const -> iterator { return { *this, m_strings.size() }; } + + inline friend std::ostream& operator << (std::ostream& os, Column const& col) { + bool first = true; + for (auto line : col) { + if (first) + first = false; + else + os << "\n"; + os << line; + } + return os; + } + + auto operator + (Column const& other)->Columns; + + auto toString() const -> std::string { + std::ostringstream oss; + oss << *this; + return oss.str(); + } +}; + +class Spacer : public Column { + +public: + explicit Spacer(size_t spaceWidth) : Column("") { + width(spaceWidth); + } +}; + +class Columns { + std::vector m_columns; + +public: + + class iterator { + friend Columns; + struct EndTag {}; + + std::vector const& m_columns; + std::vector m_iterators; + size_t m_activeIterators; + + iterator(Columns const& columns, EndTag) + : m_columns(columns.m_columns), + m_activeIterators(0) { + m_iterators.reserve(m_columns.size()); + + for (auto const& col : m_columns) + m_iterators.push_back(col.end()); + } + + public: + using difference_type = std::ptrdiff_t; + using value_type = std::string; + using pointer = value_type * ; + using reference = value_type & ; + using iterator_category = std::forward_iterator_tag; + + explicit iterator(Columns const& columns) + : m_columns(columns.m_columns), + m_activeIterators(m_columns.size()) { + m_iterators.reserve(m_columns.size()); + + for (auto const& col : m_columns) + m_iterators.push_back(col.begin()); + } + + auto operator ==(iterator const& other) const -> bool { + return m_iterators == other.m_iterators; + } + auto operator !=(iterator const& other) const -> bool { + return m_iterators != other.m_iterators; + } + auto operator *() const -> std::string { + std::string row, padding; + + for (size_t i = 0; i < m_columns.size(); ++i) { + auto width = m_columns[i].width(); + if (m_iterators[i] != m_columns[i].end()) { + std::string col = *m_iterators[i]; + row += padding + col; + if (col.size() < width) + padding = std::string(width - col.size(), ' '); + else + padding = ""; + } else { + padding += std::string(width, ' '); + } + } + return row; + } + auto operator ++() -> iterator& { + for (size_t i = 0; i < m_columns.size(); ++i) { + if (m_iterators[i] != m_columns[i].end()) + ++m_iterators[i]; + } + return *this; + } + auto operator ++(int) -> iterator { + iterator prev(*this); + operator++(); + return prev; + } + }; + using const_iterator = iterator; + + auto begin() const -> iterator { return iterator(*this); } + auto end() const -> iterator { return { *this, iterator::EndTag() }; } + + auto operator += (Column const& col) -> Columns& { + m_columns.push_back(col); + return *this; + } + auto operator + (Column const& col) -> Columns { + Columns combined = *this; + combined += col; + return combined; + } + + inline friend std::ostream& operator << (std::ostream& os, Columns const& cols) { + + bool first = true; + for (auto line : cols) { + if (first) + first = false; + else + os << "\n"; + os << line; + } + return os; + } + + auto toString() const -> std::string { + std::ostringstream oss; + oss << *this; + return oss.str(); + } +}; + +inline auto Column::operator + (Column const& other) -> Columns { + Columns cols; + cols += *this; + cols += other; + return cols; +} +} + +} +} + +// ----------- end of #include from clara_textflow.hpp ----------- +// ........... back in clara.hpp + +#include +#include +#include +#include +#include + +#if !defined(CATCH_PLATFORM_WINDOWS) && ( defined(WIN32) || defined(__WIN32__) || defined(_WIN32) || defined(_MSC_VER) ) +#define CATCH_PLATFORM_WINDOWS +#endif + +namespace Catch { namespace clara { +namespace detail { + + // Traits for extracting arg and return type of lambdas (for single argument lambdas) + template + struct UnaryLambdaTraits : UnaryLambdaTraits {}; + + template + struct UnaryLambdaTraits { + static const bool isValid = false; + }; + + template + struct UnaryLambdaTraits { + static const bool isValid = true; + using ArgType = typename std::remove_const::type>::type; + using ReturnType = ReturnT; + }; + + class TokenStream; + + // Transport for raw args (copied from main args, or supplied via init list for testing) + class Args { + friend TokenStream; + std::string m_exeName; + std::vector m_args; + + public: + Args( int argc, char const* const* argv ) + : m_exeName(argv[0]), + m_args(argv + 1, argv + argc) {} + + Args( std::initializer_list args ) + : m_exeName( *args.begin() ), + m_args( args.begin()+1, args.end() ) + {} + + auto exeName() const -> std::string { + return m_exeName; + } + }; + + // Wraps a token coming from a token stream. These may not directly correspond to strings as a single string + // may encode an option + its argument if the : or = form is used + enum class TokenType { + Option, Argument + }; + struct Token { + TokenType type; + std::string token; + }; + + inline auto isOptPrefix( char c ) -> bool { + return c == '-' +#ifdef CATCH_PLATFORM_WINDOWS + || c == '/' +#endif + ; + } + + // Abstracts iterators into args as a stream of tokens, with option arguments uniformly handled + class TokenStream { + using Iterator = std::vector::const_iterator; + Iterator it; + Iterator itEnd; + std::vector m_tokenBuffer; + + void loadBuffer() { + m_tokenBuffer.resize( 0 ); + + // Skip any empty strings + while( it != itEnd && it->empty() ) + ++it; + + if( it != itEnd ) { + auto const &next = *it; + if( isOptPrefix( next[0] ) ) { + auto delimiterPos = next.find_first_of( " :=" ); + if( delimiterPos != std::string::npos ) { + m_tokenBuffer.push_back( { TokenType::Option, next.substr( 0, delimiterPos ) } ); + m_tokenBuffer.push_back( { TokenType::Argument, next.substr( delimiterPos + 1 ) } ); + } else { + if( next[1] != '-' && next.size() > 2 ) { + std::string opt = "- "; + for( size_t i = 1; i < next.size(); ++i ) { + opt[1] = next[i]; + m_tokenBuffer.push_back( { TokenType::Option, opt } ); + } + } else { + m_tokenBuffer.push_back( { TokenType::Option, next } ); + } + } + } else { + m_tokenBuffer.push_back( { TokenType::Argument, next } ); + } + } + } + + public: + explicit TokenStream( Args const &args ) : TokenStream( args.m_args.begin(), args.m_args.end() ) {} + + TokenStream( Iterator it, Iterator itEnd ) : it( it ), itEnd( itEnd ) { + loadBuffer(); + } + + explicit operator bool() const { + return !m_tokenBuffer.empty() || it != itEnd; + } + + auto count() const -> size_t { return m_tokenBuffer.size() + (itEnd - it); } + + auto operator*() const -> Token { + assert( !m_tokenBuffer.empty() ); + return m_tokenBuffer.front(); + } + + auto operator->() const -> Token const * { + assert( !m_tokenBuffer.empty() ); + return &m_tokenBuffer.front(); + } + + auto operator++() -> TokenStream & { + if( m_tokenBuffer.size() >= 2 ) { + m_tokenBuffer.erase( m_tokenBuffer.begin() ); + } else { + if( it != itEnd ) + ++it; + loadBuffer(); + } + return *this; + } + }; + + class ResultBase { + public: + enum Type { + Ok, LogicError, RuntimeError + }; + + protected: + ResultBase( Type type ) : m_type( type ) {} + virtual ~ResultBase() = default; + + virtual void enforceOk() const = 0; + + Type m_type; + }; + + template + class ResultValueBase : public ResultBase { + public: + auto value() const -> T const & { + enforceOk(); + return m_value; + } + + protected: + ResultValueBase( Type type ) : ResultBase( type ) {} + + ResultValueBase( ResultValueBase const &other ) : ResultBase( other ) { + if( m_type == ResultBase::Ok ) + new( &m_value ) T( other.m_value ); + } + + ResultValueBase( Type, T const &value ) : ResultBase( Ok ) { + new( &m_value ) T( value ); + } + + auto operator=( ResultValueBase const &other ) -> ResultValueBase & { + if( m_type == ResultBase::Ok ) + m_value.~T(); + ResultBase::operator=(other); + if( m_type == ResultBase::Ok ) + new( &m_value ) T( other.m_value ); + return *this; + } + + ~ResultValueBase() override { + if( m_type == Ok ) + m_value.~T(); + } + + union { + T m_value; + }; + }; + + template<> + class ResultValueBase : public ResultBase { + protected: + using ResultBase::ResultBase; + }; + + template + class BasicResult : public ResultValueBase { + public: + template + explicit BasicResult( BasicResult const &other ) + : ResultValueBase( other.type() ), + m_errorMessage( other.errorMessage() ) + { + assert( type() != ResultBase::Ok ); + } + + template + static auto ok( U const &value ) -> BasicResult { return { ResultBase::Ok, value }; } + static auto ok() -> BasicResult { return { ResultBase::Ok }; } + static auto logicError( std::string const &message ) -> BasicResult { return { ResultBase::LogicError, message }; } + static auto runtimeError( std::string const &message ) -> BasicResult { return { ResultBase::RuntimeError, message }; } + + explicit operator bool() const { return m_type == ResultBase::Ok; } + auto type() const -> ResultBase::Type { return m_type; } + auto errorMessage() const -> std::string { return m_errorMessage; } + + protected: + void enforceOk() const override { + + // Errors shouldn't reach this point, but if they do + // the actual error message will be in m_errorMessage + assert( m_type != ResultBase::LogicError ); + assert( m_type != ResultBase::RuntimeError ); + if( m_type != ResultBase::Ok ) + std::abort(); + } + + std::string m_errorMessage; // Only populated if resultType is an error + + BasicResult( ResultBase::Type type, std::string const &message ) + : ResultValueBase(type), + m_errorMessage(message) + { + assert( m_type != ResultBase::Ok ); + } + + using ResultValueBase::ResultValueBase; + using ResultBase::m_type; + }; + + enum class ParseResultType { + Matched, NoMatch, ShortCircuitAll, ShortCircuitSame + }; + + class ParseState { + public: + + ParseState( ParseResultType type, TokenStream const &remainingTokens ) + : m_type(type), + m_remainingTokens( remainingTokens ) + {} + + auto type() const -> ParseResultType { return m_type; } + auto remainingTokens() const -> TokenStream { return m_remainingTokens; } + + private: + ParseResultType m_type; + TokenStream m_remainingTokens; + }; + + using Result = BasicResult; + using ParserResult = BasicResult; + using InternalParseResult = BasicResult; + + struct HelpColumns { + std::string left; + std::string right; + }; + + template + inline auto convertInto( std::string const &source, T& target ) -> ParserResult { + std::stringstream ss; + ss << source; + ss >> target; + if( ss.fail() ) + return ParserResult::runtimeError( "Unable to convert '" + source + "' to destination type" ); + else + return ParserResult::ok( ParseResultType::Matched ); + } + inline auto convertInto( std::string const &source, std::string& target ) -> ParserResult { + target = source; + return ParserResult::ok( ParseResultType::Matched ); + } + inline auto convertInto( std::string const &source, bool &target ) -> ParserResult { + std::string srcLC = source; + std::transform( srcLC.begin(), srcLC.end(), srcLC.begin(), []( char c ) { return static_cast( std::tolower(c) ); } ); + if (srcLC == "y" || srcLC == "1" || srcLC == "true" || srcLC == "yes" || srcLC == "on") + target = true; + else if (srcLC == "n" || srcLC == "0" || srcLC == "false" || srcLC == "no" || srcLC == "off") + target = false; + else + return ParserResult::runtimeError( "Expected a boolean value but did not recognise: '" + source + "'" ); + return ParserResult::ok( ParseResultType::Matched ); + } +#ifdef CLARA_CONFIG_OPTIONAL_TYPE + template + inline auto convertInto( std::string const &source, CLARA_CONFIG_OPTIONAL_TYPE& target ) -> ParserResult { + T temp; + auto result = convertInto( source, temp ); + if( result ) + target = std::move(temp); + return result; + } +#endif // CLARA_CONFIG_OPTIONAL_TYPE + + struct NonCopyable { + NonCopyable() = default; + NonCopyable( NonCopyable const & ) = delete; + NonCopyable( NonCopyable && ) = delete; + NonCopyable &operator=( NonCopyable const & ) = delete; + NonCopyable &operator=( NonCopyable && ) = delete; + }; + + struct BoundRef : NonCopyable { + virtual ~BoundRef() = default; + virtual auto isContainer() const -> bool { return false; } + virtual auto isFlag() const -> bool { return false; } + }; + struct BoundValueRefBase : BoundRef { + virtual auto setValue( std::string const &arg ) -> ParserResult = 0; + }; + struct BoundFlagRefBase : BoundRef { + virtual auto setFlag( bool flag ) -> ParserResult = 0; + virtual auto isFlag() const -> bool { return true; } + }; + + template + struct BoundValueRef : BoundValueRefBase { + T &m_ref; + + explicit BoundValueRef( T &ref ) : m_ref( ref ) {} + + auto setValue( std::string const &arg ) -> ParserResult override { + return convertInto( arg, m_ref ); + } + }; + + template + struct BoundValueRef> : BoundValueRefBase { + std::vector &m_ref; + + explicit BoundValueRef( std::vector &ref ) : m_ref( ref ) {} + + auto isContainer() const -> bool override { return true; } + + auto setValue( std::string const &arg ) -> ParserResult override { + T temp; + auto result = convertInto( arg, temp ); + if( result ) + m_ref.push_back( temp ); + return result; + } + }; + + struct BoundFlagRef : BoundFlagRefBase { + bool &m_ref; + + explicit BoundFlagRef( bool &ref ) : m_ref( ref ) {} + + auto setFlag( bool flag ) -> ParserResult override { + m_ref = flag; + return ParserResult::ok( ParseResultType::Matched ); + } + }; + + template + struct LambdaInvoker { + static_assert( std::is_same::value, "Lambda must return void or clara::ParserResult" ); + + template + static auto invoke( L const &lambda, ArgType const &arg ) -> ParserResult { + return lambda( arg ); + } + }; + + template<> + struct LambdaInvoker { + template + static auto invoke( L const &lambda, ArgType const &arg ) -> ParserResult { + lambda( arg ); + return ParserResult::ok( ParseResultType::Matched ); + } + }; + + template + inline auto invokeLambda( L const &lambda, std::string const &arg ) -> ParserResult { + ArgType temp{}; + auto result = convertInto( arg, temp ); + return !result + ? result + : LambdaInvoker::ReturnType>::invoke( lambda, temp ); + } + + template + struct BoundLambda : BoundValueRefBase { + L m_lambda; + + static_assert( UnaryLambdaTraits::isValid, "Supplied lambda must take exactly one argument" ); + explicit BoundLambda( L const &lambda ) : m_lambda( lambda ) {} + + auto setValue( std::string const &arg ) -> ParserResult override { + return invokeLambda::ArgType>( m_lambda, arg ); + } + }; + + template + struct BoundFlagLambda : BoundFlagRefBase { + L m_lambda; + + static_assert( UnaryLambdaTraits::isValid, "Supplied lambda must take exactly one argument" ); + static_assert( std::is_same::ArgType, bool>::value, "flags must be boolean" ); + + explicit BoundFlagLambda( L const &lambda ) : m_lambda( lambda ) {} + + auto setFlag( bool flag ) -> ParserResult override { + return LambdaInvoker::ReturnType>::invoke( m_lambda, flag ); + } + }; + + enum class Optionality { Optional, Required }; + + struct Parser; + + class ParserBase { + public: + virtual ~ParserBase() = default; + virtual auto validate() const -> Result { return Result::ok(); } + virtual auto parse( std::string const& exeName, TokenStream const &tokens) const -> InternalParseResult = 0; + virtual auto cardinality() const -> size_t { return 1; } + + auto parse( Args const &args ) const -> InternalParseResult { + return parse( args.exeName(), TokenStream( args ) ); + } + }; + + template + class ComposableParserImpl : public ParserBase { + public: + template + auto operator|( T const &other ) const -> Parser; + + template + auto operator+( T const &other ) const -> Parser; + }; + + // Common code and state for Args and Opts + template + class ParserRefImpl : public ComposableParserImpl { + protected: + Optionality m_optionality = Optionality::Optional; + std::shared_ptr m_ref; + std::string m_hint; + std::string m_description; + + explicit ParserRefImpl( std::shared_ptr const &ref ) : m_ref( ref ) {} + + public: + template + ParserRefImpl( T &ref, std::string const &hint ) + : m_ref( std::make_shared>( ref ) ), + m_hint( hint ) + {} + + template + ParserRefImpl( LambdaT const &ref, std::string const &hint ) + : m_ref( std::make_shared>( ref ) ), + m_hint(hint) + {} + + auto operator()( std::string const &description ) -> DerivedT & { + m_description = description; + return static_cast( *this ); + } + + auto optional() -> DerivedT & { + m_optionality = Optionality::Optional; + return static_cast( *this ); + }; + + auto required() -> DerivedT & { + m_optionality = Optionality::Required; + return static_cast( *this ); + }; + + auto isOptional() const -> bool { + return m_optionality == Optionality::Optional; + } + + auto cardinality() const -> size_t override { + if( m_ref->isContainer() ) + return 0; + else + return 1; + } + + auto hint() const -> std::string { return m_hint; } + }; + + class ExeName : public ComposableParserImpl { + std::shared_ptr m_name; + std::shared_ptr m_ref; + + template + static auto makeRef(LambdaT const &lambda) -> std::shared_ptr { + return std::make_shared>( lambda) ; + } + + public: + ExeName() : m_name( std::make_shared( "" ) ) {} + + explicit ExeName( std::string &ref ) : ExeName() { + m_ref = std::make_shared>( ref ); + } + + template + explicit ExeName( LambdaT const& lambda ) : ExeName() { + m_ref = std::make_shared>( lambda ); + } + + // The exe name is not parsed out of the normal tokens, but is handled specially + auto parse( std::string const&, TokenStream const &tokens ) const -> InternalParseResult override { + return InternalParseResult::ok( ParseState( ParseResultType::NoMatch, tokens ) ); + } + + auto name() const -> std::string { return *m_name; } + auto set( std::string const& newName ) -> ParserResult { + + auto lastSlash = newName.find_last_of( "\\/" ); + auto filename = ( lastSlash == std::string::npos ) + ? newName + : newName.substr( lastSlash+1 ); + + *m_name = filename; + if( m_ref ) + return m_ref->setValue( filename ); + else + return ParserResult::ok( ParseResultType::Matched ); + } + }; + + class Arg : public ParserRefImpl { + public: + using ParserRefImpl::ParserRefImpl; + + auto parse( std::string const &, TokenStream const &tokens ) const -> InternalParseResult override { + auto validationResult = validate(); + if( !validationResult ) + return InternalParseResult( validationResult ); + + auto remainingTokens = tokens; + auto const &token = *remainingTokens; + if( token.type != TokenType::Argument ) + return InternalParseResult::ok( ParseState( ParseResultType::NoMatch, remainingTokens ) ); + + assert( !m_ref->isFlag() ); + auto valueRef = static_cast( m_ref.get() ); + + auto result = valueRef->setValue( remainingTokens->token ); + if( !result ) + return InternalParseResult( result ); + else + return InternalParseResult::ok( ParseState( ParseResultType::Matched, ++remainingTokens ) ); + } + }; + + inline auto normaliseOpt( std::string const &optName ) -> std::string { +#ifdef CATCH_PLATFORM_WINDOWS + if( optName[0] == '/' ) + return "-" + optName.substr( 1 ); + else +#endif + return optName; + } + + class Opt : public ParserRefImpl { + protected: + std::vector m_optNames; + + public: + template + explicit Opt( LambdaT const &ref ) : ParserRefImpl( std::make_shared>( ref ) ) {} + + explicit Opt( bool &ref ) : ParserRefImpl( std::make_shared( ref ) ) {} + + template + Opt( LambdaT const &ref, std::string const &hint ) : ParserRefImpl( ref, hint ) {} + + template + Opt( T &ref, std::string const &hint ) : ParserRefImpl( ref, hint ) {} + + auto operator[]( std::string const &optName ) -> Opt & { + m_optNames.push_back( optName ); + return *this; + } + + auto getHelpColumns() const -> std::vector { + std::ostringstream oss; + bool first = true; + for( auto const &opt : m_optNames ) { + if (first) + first = false; + else + oss << ", "; + oss << opt; + } + if( !m_hint.empty() ) + oss << " <" << m_hint << ">"; + return { { oss.str(), m_description } }; + } + + auto isMatch( std::string const &optToken ) const -> bool { + auto normalisedToken = normaliseOpt( optToken ); + for( auto const &name : m_optNames ) { + if( normaliseOpt( name ) == normalisedToken ) + return true; + } + return false; + } + + using ParserBase::parse; + + auto parse( std::string const&, TokenStream const &tokens ) const -> InternalParseResult override { + auto validationResult = validate(); + if( !validationResult ) + return InternalParseResult( validationResult ); + + auto remainingTokens = tokens; + if( remainingTokens && remainingTokens->type == TokenType::Option ) { + auto const &token = *remainingTokens; + if( isMatch(token.token ) ) { + if( m_ref->isFlag() ) { + auto flagRef = static_cast( m_ref.get() ); + auto result = flagRef->setFlag( true ); + if( !result ) + return InternalParseResult( result ); + if( result.value() == ParseResultType::ShortCircuitAll ) + return InternalParseResult::ok( ParseState( result.value(), remainingTokens ) ); + } else { + auto valueRef = static_cast( m_ref.get() ); + ++remainingTokens; + if( !remainingTokens ) + return InternalParseResult::runtimeError( "Expected argument following " + token.token ); + auto const &argToken = *remainingTokens; + if( argToken.type != TokenType::Argument ) + return InternalParseResult::runtimeError( "Expected argument following " + token.token ); + auto result = valueRef->setValue( argToken.token ); + if( !result ) + return InternalParseResult( result ); + if( result.value() == ParseResultType::ShortCircuitAll ) + return InternalParseResult::ok( ParseState( result.value(), remainingTokens ) ); + } + return InternalParseResult::ok( ParseState( ParseResultType::Matched, ++remainingTokens ) ); + } + } + return InternalParseResult::ok( ParseState( ParseResultType::NoMatch, remainingTokens ) ); + } + + auto validate() const -> Result override { + if( m_optNames.empty() ) + return Result::logicError( "No options supplied to Opt" ); + for( auto const &name : m_optNames ) { + if( name.empty() ) + return Result::logicError( "Option name cannot be empty" ); +#ifdef CATCH_PLATFORM_WINDOWS + if( name[0] != '-' && name[0] != '/' ) + return Result::logicError( "Option name must begin with '-' or '/'" ); +#else + if( name[0] != '-' ) + return Result::logicError( "Option name must begin with '-'" ); +#endif + } + return ParserRefImpl::validate(); + } + }; + + struct Help : Opt { + Help( bool &showHelpFlag ) + : Opt([&]( bool flag ) { + showHelpFlag = flag; + return ParserResult::ok( ParseResultType::ShortCircuitAll ); + }) + { + static_cast( *this ) + ("display usage information") + ["-?"]["-h"]["--help"] + .optional(); + } + }; + + struct Parser : ParserBase { + + mutable ExeName m_exeName; + std::vector m_options; + std::vector m_args; + + auto operator|=( ExeName const &exeName ) -> Parser & { + m_exeName = exeName; + return *this; + } + + auto operator|=( Arg const &arg ) -> Parser & { + m_args.push_back(arg); + return *this; + } + + auto operator|=( Opt const &opt ) -> Parser & { + m_options.push_back(opt); + return *this; + } + + auto operator|=( Parser const &other ) -> Parser & { + m_options.insert(m_options.end(), other.m_options.begin(), other.m_options.end()); + m_args.insert(m_args.end(), other.m_args.begin(), other.m_args.end()); + return *this; + } + + template + auto operator|( T const &other ) const -> Parser { + return Parser( *this ) |= other; + } + + // Forward deprecated interface with '+' instead of '|' + template + auto operator+=( T const &other ) -> Parser & { return operator|=( other ); } + template + auto operator+( T const &other ) const -> Parser { return operator|( other ); } + + auto getHelpColumns() const -> std::vector { + std::vector cols; + for (auto const &o : m_options) { + auto childCols = o.getHelpColumns(); + cols.insert( cols.end(), childCols.begin(), childCols.end() ); + } + return cols; + } + + void writeToStream( std::ostream &os ) const { + if (!m_exeName.name().empty()) { + os << "usage:\n" << " " << m_exeName.name() << " "; + bool required = true, first = true; + for( auto const &arg : m_args ) { + if (first) + first = false; + else + os << " "; + if( arg.isOptional() && required ) { + os << "["; + required = false; + } + os << "<" << arg.hint() << ">"; + if( arg.cardinality() == 0 ) + os << " ... "; + } + if( !required ) + os << "]"; + if( !m_options.empty() ) + os << " options"; + os << "\n\nwhere options are:" << std::endl; + } + + auto rows = getHelpColumns(); + size_t consoleWidth = CATCH_CLARA_CONFIG_CONSOLE_WIDTH; + size_t optWidth = 0; + for( auto const &cols : rows ) + optWidth = (std::max)(optWidth, cols.left.size() + 2); + + optWidth = (std::min)(optWidth, consoleWidth/2); + + for( auto const &cols : rows ) { + auto row = + TextFlow::Column( cols.left ).width( optWidth ).indent( 2 ) + + TextFlow::Spacer(4) + + TextFlow::Column( cols.right ).width( consoleWidth - 7 - optWidth ); + os << row << std::endl; + } + } + + friend auto operator<<( std::ostream &os, Parser const &parser ) -> std::ostream& { + parser.writeToStream( os ); + return os; + } + + auto validate() const -> Result override { + for( auto const &opt : m_options ) { + auto result = opt.validate(); + if( !result ) + return result; + } + for( auto const &arg : m_args ) { + auto result = arg.validate(); + if( !result ) + return result; + } + return Result::ok(); + } + + using ParserBase::parse; + + auto parse( std::string const& exeName, TokenStream const &tokens ) const -> InternalParseResult override { + + struct ParserInfo { + ParserBase const* parser = nullptr; + size_t count = 0; + }; + const size_t totalParsers = m_options.size() + m_args.size(); + assert( totalParsers < 512 ); + // ParserInfo parseInfos[totalParsers]; // <-- this is what we really want to do + ParserInfo parseInfos[512]; + + { + size_t i = 0; + for (auto const &opt : m_options) parseInfos[i++].parser = &opt; + for (auto const &arg : m_args) parseInfos[i++].parser = &arg; + } + + m_exeName.set( exeName ); + + auto result = InternalParseResult::ok( ParseState( ParseResultType::NoMatch, tokens ) ); + while( result.value().remainingTokens() ) { + bool tokenParsed = false; + + for( size_t i = 0; i < totalParsers; ++i ) { + auto& parseInfo = parseInfos[i]; + if( parseInfo.parser->cardinality() == 0 || parseInfo.count < parseInfo.parser->cardinality() ) { + result = parseInfo.parser->parse(exeName, result.value().remainingTokens()); + if (!result) + return result; + if (result.value().type() != ParseResultType::NoMatch) { + tokenParsed = true; + ++parseInfo.count; + break; + } + } + } + + if( result.value().type() == ParseResultType::ShortCircuitAll ) + return result; + if( !tokenParsed ) + return InternalParseResult::runtimeError( "Unrecognised token: " + result.value().remainingTokens()->token ); + } + // !TBD Check missing required options + return result; + } + }; + + template + template + auto ComposableParserImpl::operator|( T const &other ) const -> Parser { + return Parser() | static_cast( *this ) | other; + } +} // namespace detail + +// A Combined parser +using detail::Parser; + +// A parser for options +using detail::Opt; + +// A parser for arguments +using detail::Arg; + +// Wrapper for argc, argv from main() +using detail::Args; + +// Specifies the name of the executable +using detail::ExeName; + +// Convenience wrapper for option parser that specifies the help option +using detail::Help; + +// enum of result types from a parse +using detail::ParseResultType; + +// Result type for parser operation +using detail::ParserResult; + +}} // namespace Catch::clara + +// end clara.hpp +#ifdef __clang__ +#pragma clang diagnostic pop +#endif + +// Restore Clara's value for console width, if present +#ifdef CATCH_TEMP_CLARA_CONFIG_CONSOLE_WIDTH +#define CATCH_CLARA_TEXTFLOW_CONFIG_CONSOLE_WIDTH CATCH_TEMP_CLARA_CONFIG_CONSOLE_WIDTH +#undef CATCH_TEMP_CLARA_CONFIG_CONSOLE_WIDTH +#endif + +// end catch_clara.h +namespace Catch { + + clara::Parser makeCommandLineParser( ConfigData& config ); + +} // end namespace Catch + +// end catch_commandline.h +#include +#include + +namespace Catch { + + clara::Parser makeCommandLineParser( ConfigData& config ) { + + using namespace clara; + + auto const setWarning = [&]( std::string const& warning ) { + auto warningSet = [&]() { + if( warning == "NoAssertions" ) + return WarnAbout::NoAssertions; + + if ( warning == "NoTests" ) + return WarnAbout::NoTests; + + return WarnAbout::Nothing; + }(); + + if (warningSet == WarnAbout::Nothing) + return ParserResult::runtimeError( "Unrecognised warning: '" + warning + "'" ); + config.warnings = static_cast( config.warnings | warningSet ); + return ParserResult::ok( ParseResultType::Matched ); + }; + auto const loadTestNamesFromFile = [&]( std::string const& filename ) { + std::ifstream f( filename.c_str() ); + if( !f.is_open() ) + return ParserResult::runtimeError( "Unable to load input file: '" + filename + "'" ); + + std::string line; + while( std::getline( f, line ) ) { + line = trim(line); + if( !line.empty() && !startsWith( line, '#' ) ) { + if( !startsWith( line, '"' ) ) + line = '"' + line + '"'; + config.testsOrTags.push_back( line + ',' ); + } + } + return ParserResult::ok( ParseResultType::Matched ); + }; + auto const setTestOrder = [&]( std::string const& order ) { + if( startsWith( "declared", order ) ) + config.runOrder = RunTests::InDeclarationOrder; + else if( startsWith( "lexical", order ) ) + config.runOrder = RunTests::InLexicographicalOrder; + else if( startsWith( "random", order ) ) + config.runOrder = RunTests::InRandomOrder; + else + return clara::ParserResult::runtimeError( "Unrecognised ordering: '" + order + "'" ); + return ParserResult::ok( ParseResultType::Matched ); + }; + auto const setRngSeed = [&]( std::string const& seed ) { + if( seed != "time" ) + return clara::detail::convertInto( seed, config.rngSeed ); + config.rngSeed = static_cast( std::time(nullptr) ); + return ParserResult::ok( ParseResultType::Matched ); + }; + auto const setColourUsage = [&]( std::string const& useColour ) { + auto mode = toLower( useColour ); + + if( mode == "yes" ) + config.useColour = UseColour::Yes; + else if( mode == "no" ) + config.useColour = UseColour::No; + else if( mode == "auto" ) + config.useColour = UseColour::Auto; + else + return ParserResult::runtimeError( "colour mode must be one of: auto, yes or no. '" + useColour + "' not recognised" ); + return ParserResult::ok( ParseResultType::Matched ); + }; + auto const setWaitForKeypress = [&]( std::string const& keypress ) { + auto keypressLc = toLower( keypress ); + if( keypressLc == "start" ) + config.waitForKeypress = WaitForKeypress::BeforeStart; + else if( keypressLc == "exit" ) + config.waitForKeypress = WaitForKeypress::BeforeExit; + else if( keypressLc == "both" ) + config.waitForKeypress = WaitForKeypress::BeforeStartAndExit; + else + return ParserResult::runtimeError( "keypress argument must be one of: start, exit or both. '" + keypress + "' not recognised" ); + return ParserResult::ok( ParseResultType::Matched ); + }; + auto const setVerbosity = [&]( std::string const& verbosity ) { + auto lcVerbosity = toLower( verbosity ); + if( lcVerbosity == "quiet" ) + config.verbosity = Verbosity::Quiet; + else if( lcVerbosity == "normal" ) + config.verbosity = Verbosity::Normal; + else if( lcVerbosity == "high" ) + config.verbosity = Verbosity::High; + else + return ParserResult::runtimeError( "Unrecognised verbosity, '" + verbosity + "'" ); + return ParserResult::ok( ParseResultType::Matched ); + }; + auto const setReporter = [&]( std::string const& reporter ) { + IReporterRegistry::FactoryMap const& factories = getRegistryHub().getReporterRegistry().getFactories(); + + auto lcReporter = toLower( reporter ); + auto result = factories.find( lcReporter ); + + if( factories.end() != result ) + config.reporterName = lcReporter; + else + return ParserResult::runtimeError( "Unrecognized reporter, '" + reporter + "'. Check available with --list-reporters" ); + return ParserResult::ok( ParseResultType::Matched ); + }; + + auto cli + = ExeName( config.processName ) + | Help( config.showHelp ) + | Opt( config.listTests ) + ["-l"]["--list-tests"] + ( "list all/matching test cases" ) + | Opt( config.listTags ) + ["-t"]["--list-tags"] + ( "list all/matching tags" ) + | Opt( config.showSuccessfulTests ) + ["-s"]["--success"] + ( "include successful tests in output" ) + | Opt( config.shouldDebugBreak ) + ["-b"]["--break"] + ( "break into debugger on failure" ) + | Opt( config.noThrow ) + ["-e"]["--nothrow"] + ( "skip exception tests" ) + | Opt( config.showInvisibles ) + ["-i"]["--invisibles"] + ( "show invisibles (tabs, newlines)" ) + | Opt( config.outputFilename, "filename" ) + ["-o"]["--out"] + ( "output filename" ) + | Opt( setReporter, "name" ) + ["-r"]["--reporter"] + ( "reporter to use (defaults to console)" ) + | Opt( config.name, "name" ) + ["-n"]["--name"] + ( "suite name" ) + | Opt( [&]( bool ){ config.abortAfter = 1; } ) + ["-a"]["--abort"] + ( "abort at first failure" ) + | Opt( [&]( int x ){ config.abortAfter = x; }, "no. failures" ) + ["-x"]["--abortx"] + ( "abort after x failures" ) + | Opt( setWarning, "warning name" ) + ["-w"]["--warn"] + ( "enable warnings" ) + | Opt( [&]( bool flag ) { config.showDurations = flag ? ShowDurations::Always : ShowDurations::Never; }, "yes|no" ) + ["-d"]["--durations"] + ( "show test durations" ) + | Opt( loadTestNamesFromFile, "filename" ) + ["-f"]["--input-file"] + ( "load test names to run from a file" ) + | Opt( config.filenamesAsTags ) + ["-#"]["--filenames-as-tags"] + ( "adds a tag for the filename" ) + | Opt( config.sectionsToRun, "section name" ) + ["-c"]["--section"] + ( "specify section to run" ) + | Opt( setVerbosity, "quiet|normal|high" ) + ["-v"]["--verbosity"] + ( "set output verbosity" ) + | Opt( config.listTestNamesOnly ) + ["--list-test-names-only"] + ( "list all/matching test cases names only" ) + | Opt( config.listReporters ) + ["--list-reporters"] + ( "list all reporters" ) + | Opt( setTestOrder, "decl|lex|rand" ) + ["--order"] + ( "test case order (defaults to decl)" ) + | Opt( setRngSeed, "'time'|number" ) + ["--rng-seed"] + ( "set a specific seed for random numbers" ) + | Opt( setColourUsage, "yes|no" ) + ["--use-colour"] + ( "should output be colourised" ) + | Opt( config.libIdentify ) + ["--libidentify"] + ( "report name and version according to libidentify standard" ) + | Opt( setWaitForKeypress, "start|exit|both" ) + ["--wait-for-keypress"] + ( "waits for a keypress before exiting" ) + | Opt( config.benchmarkResolutionMultiple, "multiplier" ) + ["--benchmark-resolution-multiple"] + ( "multiple of clock resolution to run benchmarks" ) + + | Arg( config.testsOrTags, "test name|pattern|tags" ) + ( "which test or tests to use" ); + + return cli; + } + +} // end namespace Catch +// end catch_commandline.cpp +// start catch_common.cpp + +#include +#include + +namespace Catch { + + bool SourceLineInfo::empty() const noexcept { + return file[0] == '\0'; + } + bool SourceLineInfo::operator == ( SourceLineInfo const& other ) const noexcept { + return line == other.line && (file == other.file || std::strcmp(file, other.file) == 0); + } + bool SourceLineInfo::operator < ( SourceLineInfo const& other ) const noexcept { + // We can assume that the same file will usually have the same pointer. + // Thus, if the pointers are the same, there is no point in calling the strcmp + return line < other.line || ( line == other.line && file != other.file && (std::strcmp(file, other.file) < 0)); + } + + std::ostream& operator << ( std::ostream& os, SourceLineInfo const& info ) { +#ifndef __GNUG__ + os << info.file << '(' << info.line << ')'; +#else + os << info.file << ':' << info.line; +#endif + return os; + } + + std::string StreamEndStop::operator+() const { + return std::string(); + } + + NonCopyable::NonCopyable() = default; + NonCopyable::~NonCopyable() = default; + +} +// end catch_common.cpp +// start catch_config.cpp + +namespace Catch { + + Config::Config( ConfigData const& data ) + : m_data( data ), + m_stream( openStream() ) + { + TestSpecParser parser(ITagAliasRegistry::get()); + if (data.testsOrTags.empty()) { + parser.parse("~[.]"); // All not hidden tests + } + else { + m_hasTestFilters = true; + for( auto const& testOrTags : data.testsOrTags ) + parser.parse( testOrTags ); + } + m_testSpec = parser.testSpec(); + } + + std::string const& Config::getFilename() const { + return m_data.outputFilename ; + } + + bool Config::listTests() const { return m_data.listTests; } + bool Config::listTestNamesOnly() const { return m_data.listTestNamesOnly; } + bool Config::listTags() const { return m_data.listTags; } + bool Config::listReporters() const { return m_data.listReporters; } + + std::string Config::getProcessName() const { return m_data.processName; } + std::string const& Config::getReporterName() const { return m_data.reporterName; } + + std::vector const& Config::getTestsOrTags() const { return m_data.testsOrTags; } + std::vector const& Config::getSectionsToRun() const { return m_data.sectionsToRun; } + + TestSpec const& Config::testSpec() const { return m_testSpec; } + bool Config::hasTestFilters() const { return m_hasTestFilters; } + + bool Config::showHelp() const { return m_data.showHelp; } + + // IConfig interface + bool Config::allowThrows() const { return !m_data.noThrow; } + std::ostream& Config::stream() const { return m_stream->stream(); } + std::string Config::name() const { return m_data.name.empty() ? m_data.processName : m_data.name; } + bool Config::includeSuccessfulResults() const { return m_data.showSuccessfulTests; } + bool Config::warnAboutMissingAssertions() const { return !!(m_data.warnings & WarnAbout::NoAssertions); } + bool Config::warnAboutNoTests() const { return !!(m_data.warnings & WarnAbout::NoTests); } + ShowDurations::OrNot Config::showDurations() const { return m_data.showDurations; } + RunTests::InWhatOrder Config::runOrder() const { return m_data.runOrder; } + unsigned int Config::rngSeed() const { return m_data.rngSeed; } + int Config::benchmarkResolutionMultiple() const { return m_data.benchmarkResolutionMultiple; } + UseColour::YesOrNo Config::useColour() const { return m_data.useColour; } + bool Config::shouldDebugBreak() const { return m_data.shouldDebugBreak; } + int Config::abortAfter() const { return m_data.abortAfter; } + bool Config::showInvisibles() const { return m_data.showInvisibles; } + Verbosity Config::verbosity() const { return m_data.verbosity; } + + IStream const* Config::openStream() { + return Catch::makeStream(m_data.outputFilename); + } + +} // end namespace Catch +// end catch_config.cpp +// start catch_console_colour.cpp + +#if defined(__clang__) +# pragma clang diagnostic push +# pragma clang diagnostic ignored "-Wexit-time-destructors" +#endif + +// start catch_errno_guard.h + +namespace Catch { + + class ErrnoGuard { + public: + ErrnoGuard(); + ~ErrnoGuard(); + private: + int m_oldErrno; + }; + +} + +// end catch_errno_guard.h +#include + +namespace Catch { + namespace { + + struct IColourImpl { + virtual ~IColourImpl() = default; + virtual void use( Colour::Code _colourCode ) = 0; + }; + + struct NoColourImpl : IColourImpl { + void use( Colour::Code ) {} + + static IColourImpl* instance() { + static NoColourImpl s_instance; + return &s_instance; + } + }; + + } // anon namespace +} // namespace Catch + +#if !defined( CATCH_CONFIG_COLOUR_NONE ) && !defined( CATCH_CONFIG_COLOUR_WINDOWS ) && !defined( CATCH_CONFIG_COLOUR_ANSI ) +# ifdef CATCH_PLATFORM_WINDOWS +# define CATCH_CONFIG_COLOUR_WINDOWS +# else +# define CATCH_CONFIG_COLOUR_ANSI +# endif +#endif + +#if defined ( CATCH_CONFIG_COLOUR_WINDOWS ) ///////////////////////////////////////// + +namespace Catch { +namespace { + + class Win32ColourImpl : public IColourImpl { + public: + Win32ColourImpl() : stdoutHandle( GetStdHandle(STD_OUTPUT_HANDLE) ) + { + CONSOLE_SCREEN_BUFFER_INFO csbiInfo; + GetConsoleScreenBufferInfo( stdoutHandle, &csbiInfo ); + originalForegroundAttributes = csbiInfo.wAttributes & ~( BACKGROUND_GREEN | BACKGROUND_RED | BACKGROUND_BLUE | BACKGROUND_INTENSITY ); + originalBackgroundAttributes = csbiInfo.wAttributes & ~( FOREGROUND_GREEN | FOREGROUND_RED | FOREGROUND_BLUE | FOREGROUND_INTENSITY ); + } + + virtual void use( Colour::Code _colourCode ) override { + switch( _colourCode ) { + case Colour::None: return setTextAttribute( originalForegroundAttributes ); + case Colour::White: return setTextAttribute( FOREGROUND_GREEN | FOREGROUND_RED | FOREGROUND_BLUE ); + case Colour::Red: return setTextAttribute( FOREGROUND_RED ); + case Colour::Green: return setTextAttribute( FOREGROUND_GREEN ); + case Colour::Blue: return setTextAttribute( FOREGROUND_BLUE ); + case Colour::Cyan: return setTextAttribute( FOREGROUND_BLUE | FOREGROUND_GREEN ); + case Colour::Yellow: return setTextAttribute( FOREGROUND_RED | FOREGROUND_GREEN ); + case Colour::Grey: return setTextAttribute( 0 ); + + case Colour::LightGrey: return setTextAttribute( FOREGROUND_INTENSITY ); + case Colour::BrightRed: return setTextAttribute( FOREGROUND_INTENSITY | FOREGROUND_RED ); + case Colour::BrightGreen: return setTextAttribute( FOREGROUND_INTENSITY | FOREGROUND_GREEN ); + case Colour::BrightWhite: return setTextAttribute( FOREGROUND_INTENSITY | FOREGROUND_GREEN | FOREGROUND_RED | FOREGROUND_BLUE ); + case Colour::BrightYellow: return setTextAttribute( FOREGROUND_INTENSITY | FOREGROUND_RED | FOREGROUND_GREEN ); + + case Colour::Bright: CATCH_INTERNAL_ERROR( "not a colour" ); + + default: + CATCH_ERROR( "Unknown colour requested" ); + } + } + + private: + void setTextAttribute( WORD _textAttribute ) { + SetConsoleTextAttribute( stdoutHandle, _textAttribute | originalBackgroundAttributes ); + } + HANDLE stdoutHandle; + WORD originalForegroundAttributes; + WORD originalBackgroundAttributes; + }; + + IColourImpl* platformColourInstance() { + static Win32ColourImpl s_instance; + + IConfigPtr config = getCurrentContext().getConfig(); + UseColour::YesOrNo colourMode = config + ? config->useColour() + : UseColour::Auto; + if( colourMode == UseColour::Auto ) + colourMode = UseColour::Yes; + return colourMode == UseColour::Yes + ? &s_instance + : NoColourImpl::instance(); + } + +} // end anon namespace +} // end namespace Catch + +#elif defined( CATCH_CONFIG_COLOUR_ANSI ) ////////////////////////////////////// + +#include + +namespace Catch { +namespace { + + // use POSIX/ ANSI console terminal codes + // Thanks to Adam Strzelecki for original contribution + // (http://github.com/nanoant) + // https://github.com/philsquared/Catch/pull/131 + class PosixColourImpl : public IColourImpl { + public: + virtual void use( Colour::Code _colourCode ) override { + switch( _colourCode ) { + case Colour::None: + case Colour::White: return setColour( "[0m" ); + case Colour::Red: return setColour( "[0;31m" ); + case Colour::Green: return setColour( "[0;32m" ); + case Colour::Blue: return setColour( "[0;34m" ); + case Colour::Cyan: return setColour( "[0;36m" ); + case Colour::Yellow: return setColour( "[0;33m" ); + case Colour::Grey: return setColour( "[1;30m" ); + + case Colour::LightGrey: return setColour( "[0;37m" ); + case Colour::BrightRed: return setColour( "[1;31m" ); + case Colour::BrightGreen: return setColour( "[1;32m" ); + case Colour::BrightWhite: return setColour( "[1;37m" ); + case Colour::BrightYellow: return setColour( "[1;33m" ); + + case Colour::Bright: CATCH_INTERNAL_ERROR( "not a colour" ); + default: CATCH_INTERNAL_ERROR( "Unknown colour requested" ); + } + } + static IColourImpl* instance() { + static PosixColourImpl s_instance; + return &s_instance; + } + + private: + void setColour( const char* _escapeCode ) { + getCurrentContext().getConfig()->stream() + << '\033' << _escapeCode; + } + }; + + bool useColourOnPlatform() { + return +#ifdef CATCH_PLATFORM_MAC + !isDebuggerActive() && +#endif +#if !(defined(__DJGPP__) && defined(__STRICT_ANSI__)) + isatty(STDOUT_FILENO) +#else + false +#endif + ; + } + IColourImpl* platformColourInstance() { + ErrnoGuard guard; + IConfigPtr config = getCurrentContext().getConfig(); + UseColour::YesOrNo colourMode = config + ? config->useColour() + : UseColour::Auto; + if( colourMode == UseColour::Auto ) + colourMode = useColourOnPlatform() + ? UseColour::Yes + : UseColour::No; + return colourMode == UseColour::Yes + ? PosixColourImpl::instance() + : NoColourImpl::instance(); + } + +} // end anon namespace +} // end namespace Catch + +#else // not Windows or ANSI /////////////////////////////////////////////// + +namespace Catch { + + static IColourImpl* platformColourInstance() { return NoColourImpl::instance(); } + +} // end namespace Catch + +#endif // Windows/ ANSI/ None + +namespace Catch { + + Colour::Colour( Code _colourCode ) { use( _colourCode ); } + Colour::Colour( Colour&& rhs ) noexcept { + m_moved = rhs.m_moved; + rhs.m_moved = true; + } + Colour& Colour::operator=( Colour&& rhs ) noexcept { + m_moved = rhs.m_moved; + rhs.m_moved = true; + return *this; + } + + Colour::~Colour(){ if( !m_moved ) use( None ); } + + void Colour::use( Code _colourCode ) { + static IColourImpl* impl = platformColourInstance(); + impl->use( _colourCode ); + } + + std::ostream& operator << ( std::ostream& os, Colour const& ) { + return os; + } + +} // end namespace Catch + +#if defined(__clang__) +# pragma clang diagnostic pop +#endif + +// end catch_console_colour.cpp +// start catch_context.cpp + +namespace Catch { + + class Context : public IMutableContext, NonCopyable { + + public: // IContext + virtual IResultCapture* getResultCapture() override { + return m_resultCapture; + } + virtual IRunner* getRunner() override { + return m_runner; + } + + virtual IConfigPtr const& getConfig() const override { + return m_config; + } + + virtual ~Context() override; + + public: // IMutableContext + virtual void setResultCapture( IResultCapture* resultCapture ) override { + m_resultCapture = resultCapture; + } + virtual void setRunner( IRunner* runner ) override { + m_runner = runner; + } + virtual void setConfig( IConfigPtr const& config ) override { + m_config = config; + } + + friend IMutableContext& getCurrentMutableContext(); + + private: + IConfigPtr m_config; + IRunner* m_runner = nullptr; + IResultCapture* m_resultCapture = nullptr; + }; + + IMutableContext *IMutableContext::currentContext = nullptr; + + void IMutableContext::createContext() + { + currentContext = new Context(); + } + + void cleanUpContext() { + delete IMutableContext::currentContext; + IMutableContext::currentContext = nullptr; + } + IContext::~IContext() = default; + IMutableContext::~IMutableContext() = default; + Context::~Context() = default; +} +// end catch_context.cpp +// start catch_debug_console.cpp + +// start catch_debug_console.h + +#include + +namespace Catch { + void writeToDebugConsole( std::string const& text ); +} + +// end catch_debug_console.h +#ifdef CATCH_PLATFORM_WINDOWS + + namespace Catch { + void writeToDebugConsole( std::string const& text ) { + ::OutputDebugStringA( text.c_str() ); + } + } + +#else + + namespace Catch { + void writeToDebugConsole( std::string const& text ) { + // !TBD: Need a version for Mac/ XCode and other IDEs + Catch::cout() << text; + } + } + +#endif // Platform +// end catch_debug_console.cpp +// start catch_debugger.cpp + +#ifdef CATCH_PLATFORM_MAC + +# include +# include +# include +# include +# include +# include +# include + +namespace Catch { + + // The following function is taken directly from the following technical note: + // http://developer.apple.com/library/mac/#qa/qa2004/qa1361.html + + // Returns true if the current process is being debugged (either + // running under the debugger or has a debugger attached post facto). + bool isDebuggerActive(){ + + int mib[4]; + struct kinfo_proc info; + std::size_t size; + + // Initialize the flags so that, if sysctl fails for some bizarre + // reason, we get a predictable result. + + info.kp_proc.p_flag = 0; + + // Initialize mib, which tells sysctl the info we want, in this case + // we're looking for information about a specific process ID. + + mib[0] = CTL_KERN; + mib[1] = KERN_PROC; + mib[2] = KERN_PROC_PID; + mib[3] = getpid(); + + // Call sysctl. + + size = sizeof(info); + if( sysctl(mib, sizeof(mib) / sizeof(*mib), &info, &size, nullptr, 0) != 0 ) { + Catch::cerr() << "\n** Call to sysctl failed - unable to determine if debugger is active **\n" << std::endl; + return false; + } + + // We're being debugged if the P_TRACED flag is set. + + return ( (info.kp_proc.p_flag & P_TRACED) != 0 ); + } + } // namespace Catch + +#elif defined(CATCH_PLATFORM_LINUX) + #include + #include + + namespace Catch{ + // The standard POSIX way of detecting a debugger is to attempt to + // ptrace() the process, but this needs to be done from a child and not + // this process itself to still allow attaching to this process later + // if wanted, so is rather heavy. Under Linux we have the PID of the + // "debugger" (which doesn't need to be gdb, of course, it could also + // be strace, for example) in /proc/$PID/status, so just get it from + // there instead. + bool isDebuggerActive(){ + // Libstdc++ has a bug, where std::ifstream sets errno to 0 + // This way our users can properly assert over errno values + ErrnoGuard guard; + std::ifstream in("/proc/self/status"); + for( std::string line; std::getline(in, line); ) { + static const int PREFIX_LEN = 11; + if( line.compare(0, PREFIX_LEN, "TracerPid:\t") == 0 ) { + // We're traced if the PID is not 0 and no other PID starts + // with 0 digit, so it's enough to check for just a single + // character. + return line.length() > PREFIX_LEN && line[PREFIX_LEN] != '0'; + } + } + + return false; + } + } // namespace Catch +#elif defined(_MSC_VER) + extern "C" __declspec(dllimport) int __stdcall IsDebuggerPresent(); + namespace Catch { + bool isDebuggerActive() { + return IsDebuggerPresent() != 0; + } + } +#elif defined(__MINGW32__) + extern "C" __declspec(dllimport) int __stdcall IsDebuggerPresent(); + namespace Catch { + bool isDebuggerActive() { + return IsDebuggerPresent() != 0; + } + } +#else + namespace Catch { + bool isDebuggerActive() { return false; } + } +#endif // Platform +// end catch_debugger.cpp +// start catch_decomposer.cpp + +namespace Catch { + + ITransientExpression::~ITransientExpression() = default; + + void formatReconstructedExpression( std::ostream &os, std::string const& lhs, StringRef op, std::string const& rhs ) { + if( lhs.size() + rhs.size() < 40 && + lhs.find('\n') == std::string::npos && + rhs.find('\n') == std::string::npos ) + os << lhs << " " << op << " " << rhs; + else + os << lhs << "\n" << op << "\n" << rhs; + } +} +// end catch_decomposer.cpp +// start catch_enforce.cpp + +namespace Catch { +#if defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) && !defined(CATCH_CONFIG_DISABLE_EXCEPTIONS_CUSTOM_HANDLER) + [[noreturn]] + void throw_exception(std::exception const& e) { + Catch::cerr() << "Catch will terminate because it needed to throw an exception.\n" + << "The message was: " << e.what() << '\n'; + std::terminate(); + } +#endif +} // namespace Catch; +// end catch_enforce.cpp +// start catch_errno_guard.cpp + +#include + +namespace Catch { + ErrnoGuard::ErrnoGuard():m_oldErrno(errno){} + ErrnoGuard::~ErrnoGuard() { errno = m_oldErrno; } +} +// end catch_errno_guard.cpp +// start catch_exception_translator_registry.cpp + +// start catch_exception_translator_registry.h + +#include +#include +#include + +namespace Catch { + + class ExceptionTranslatorRegistry : public IExceptionTranslatorRegistry { + public: + ~ExceptionTranslatorRegistry(); + virtual void registerTranslator( const IExceptionTranslator* translator ); + virtual std::string translateActiveException() const override; + std::string tryTranslators() const; + + private: + std::vector> m_translators; + }; +} + +// end catch_exception_translator_registry.h +#ifdef __OBJC__ +#import "Foundation/Foundation.h" +#endif + +namespace Catch { + + ExceptionTranslatorRegistry::~ExceptionTranslatorRegistry() { + } + + void ExceptionTranslatorRegistry::registerTranslator( const IExceptionTranslator* translator ) { + m_translators.push_back( std::unique_ptr( translator ) ); + } + +#if !defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) + std::string ExceptionTranslatorRegistry::translateActiveException() const { + try { +#ifdef __OBJC__ + // In Objective-C try objective-c exceptions first + @try { + return tryTranslators(); + } + @catch (NSException *exception) { + return Catch::Detail::stringify( [exception description] ); + } +#else + // Compiling a mixed mode project with MSVC means that CLR + // exceptions will be caught in (...) as well. However, these + // do not fill-in std::current_exception and thus lead to crash + // when attempting rethrow. + // /EHa switch also causes structured exceptions to be caught + // here, but they fill-in current_exception properly, so + // at worst the output should be a little weird, instead of + // causing a crash. + if (std::current_exception() == nullptr) { + return "Non C++ exception. Possibly a CLR exception."; + } + return tryTranslators(); +#endif + } + catch( TestFailureException& ) { + std::rethrow_exception(std::current_exception()); + } + catch( std::exception& ex ) { + return ex.what(); + } + catch( std::string& msg ) { + return msg; + } + catch( const char* msg ) { + return msg; + } + catch(...) { + return "Unknown exception"; + } + } + + std::string ExceptionTranslatorRegistry::tryTranslators() const { + if (m_translators.empty()) { + std::rethrow_exception(std::current_exception()); + } else { + return m_translators[0]->translate(m_translators.begin() + 1, m_translators.end()); + } + } + +#else // ^^ Exceptions are enabled // Exceptions are disabled vv + std::string ExceptionTranslatorRegistry::translateActiveException() const { + CATCH_INTERNAL_ERROR("Attempted to translate active exception under CATCH_CONFIG_DISABLE_EXCEPTIONS!"); + } + + std::string ExceptionTranslatorRegistry::tryTranslators() const { + CATCH_INTERNAL_ERROR("Attempted to use exception translators under CATCH_CONFIG_DISABLE_EXCEPTIONS!"); + } +#endif + +} +// end catch_exception_translator_registry.cpp +// start catch_fatal_condition.cpp + +#if defined(__GNUC__) +# pragma GCC diagnostic push +# pragma GCC diagnostic ignored "-Wmissing-field-initializers" +#endif + +#if defined( CATCH_CONFIG_WINDOWS_SEH ) || defined( CATCH_CONFIG_POSIX_SIGNALS ) + +namespace { + // Report the error condition + void reportFatal( char const * const message ) { + Catch::getCurrentContext().getResultCapture()->handleFatalErrorCondition( message ); + } +} + +#endif // signals/SEH handling + +#if defined( CATCH_CONFIG_WINDOWS_SEH ) + +namespace Catch { + struct SignalDefs { DWORD id; const char* name; }; + + // There is no 1-1 mapping between signals and windows exceptions. + // Windows can easily distinguish between SO and SigSegV, + // but SigInt, SigTerm, etc are handled differently. + static SignalDefs signalDefs[] = { + { EXCEPTION_ILLEGAL_INSTRUCTION, "SIGILL - Illegal instruction signal" }, + { EXCEPTION_STACK_OVERFLOW, "SIGSEGV - Stack overflow" }, + { EXCEPTION_ACCESS_VIOLATION, "SIGSEGV - Segmentation violation signal" }, + { EXCEPTION_INT_DIVIDE_BY_ZERO, "Divide by zero error" }, + }; + + LONG CALLBACK FatalConditionHandler::handleVectoredException(PEXCEPTION_POINTERS ExceptionInfo) { + for (auto const& def : signalDefs) { + if (ExceptionInfo->ExceptionRecord->ExceptionCode == def.id) { + reportFatal(def.name); + } + } + // If its not an exception we care about, pass it along. + // This stops us from eating debugger breaks etc. + return EXCEPTION_CONTINUE_SEARCH; + } + + FatalConditionHandler::FatalConditionHandler() { + isSet = true; + // 32k seems enough for Catch to handle stack overflow, + // but the value was found experimentally, so there is no strong guarantee + guaranteeSize = 32 * 1024; + exceptionHandlerHandle = nullptr; + // Register as first handler in current chain + exceptionHandlerHandle = AddVectoredExceptionHandler(1, handleVectoredException); + // Pass in guarantee size to be filled + SetThreadStackGuarantee(&guaranteeSize); + } + + void FatalConditionHandler::reset() { + if (isSet) { + RemoveVectoredExceptionHandler(exceptionHandlerHandle); + SetThreadStackGuarantee(&guaranteeSize); + exceptionHandlerHandle = nullptr; + isSet = false; + } + } + + FatalConditionHandler::~FatalConditionHandler() { + reset(); + } + +bool FatalConditionHandler::isSet = false; +ULONG FatalConditionHandler::guaranteeSize = 0; +PVOID FatalConditionHandler::exceptionHandlerHandle = nullptr; + +} // namespace Catch + +#elif defined( CATCH_CONFIG_POSIX_SIGNALS ) + +namespace Catch { + + struct SignalDefs { + int id; + const char* name; + }; + + // 32kb for the alternate stack seems to be sufficient. However, this value + // is experimentally determined, so that's not guaranteed. + constexpr static std::size_t sigStackSize = 32768 >= MINSIGSTKSZ ? 32768 : MINSIGSTKSZ; + + static SignalDefs signalDefs[] = { + { SIGINT, "SIGINT - Terminal interrupt signal" }, + { SIGILL, "SIGILL - Illegal instruction signal" }, + { SIGFPE, "SIGFPE - Floating point error signal" }, + { SIGSEGV, "SIGSEGV - Segmentation violation signal" }, + { SIGTERM, "SIGTERM - Termination request signal" }, + { SIGABRT, "SIGABRT - Abort (abnormal termination) signal" } + }; + + void FatalConditionHandler::handleSignal( int sig ) { + char const * name = ""; + for (auto const& def : signalDefs) { + if (sig == def.id) { + name = def.name; + break; + } + } + reset(); + reportFatal(name); + raise( sig ); + } + + FatalConditionHandler::FatalConditionHandler() { + isSet = true; + stack_t sigStack; + sigStack.ss_sp = altStackMem; + sigStack.ss_size = sigStackSize; + sigStack.ss_flags = 0; + sigaltstack(&sigStack, &oldSigStack); + struct sigaction sa = { }; + + sa.sa_handler = handleSignal; + sa.sa_flags = SA_ONSTACK; + for (std::size_t i = 0; i < sizeof(signalDefs)/sizeof(SignalDefs); ++i) { + sigaction(signalDefs[i].id, &sa, &oldSigActions[i]); + } + } + + FatalConditionHandler::~FatalConditionHandler() { + reset(); + } + + void FatalConditionHandler::reset() { + if( isSet ) { + // Set signals back to previous values -- hopefully nobody overwrote them in the meantime + for( std::size_t i = 0; i < sizeof(signalDefs)/sizeof(SignalDefs); ++i ) { + sigaction(signalDefs[i].id, &oldSigActions[i], nullptr); + } + // Return the old stack + sigaltstack(&oldSigStack, nullptr); + isSet = false; + } + } + + bool FatalConditionHandler::isSet = false; + struct sigaction FatalConditionHandler::oldSigActions[sizeof(signalDefs)/sizeof(SignalDefs)] = {}; + stack_t FatalConditionHandler::oldSigStack = {}; + char FatalConditionHandler::altStackMem[sigStackSize] = {}; + +} // namespace Catch + +#else + +namespace Catch { + void FatalConditionHandler::reset() {} +} + +#endif // signals/SEH handling + +#if defined(__GNUC__) +# pragma GCC diagnostic pop +#endif +// end catch_fatal_condition.cpp +// start catch_generators.cpp + +// start catch_random_number_generator.h + +#include +#include + +namespace Catch { + + struct IConfig; + + std::mt19937& rng(); + void seedRng( IConfig const& config ); + unsigned int rngSeed(); + +} + +// end catch_random_number_generator.h +#include +#include + +namespace Catch { + +IGeneratorTracker::~IGeneratorTracker() {} + +const char* GeneratorException::what() const noexcept { + return m_msg; +} + +namespace Generators { + + GeneratorUntypedBase::~GeneratorUntypedBase() {} + + auto acquireGeneratorTracker( SourceLineInfo const& lineInfo ) -> IGeneratorTracker& { + return getResultCapture().acquireGeneratorTracker( lineInfo ); + } + +} // namespace Generators +} // namespace Catch +// end catch_generators.cpp +// start catch_interfaces_capture.cpp + +namespace Catch { + IResultCapture::~IResultCapture() = default; +} +// end catch_interfaces_capture.cpp +// start catch_interfaces_config.cpp + +namespace Catch { + IConfig::~IConfig() = default; +} +// end catch_interfaces_config.cpp +// start catch_interfaces_exception.cpp + +namespace Catch { + IExceptionTranslator::~IExceptionTranslator() = default; + IExceptionTranslatorRegistry::~IExceptionTranslatorRegistry() = default; +} +// end catch_interfaces_exception.cpp +// start catch_interfaces_registry_hub.cpp + +namespace Catch { + IRegistryHub::~IRegistryHub() = default; + IMutableRegistryHub::~IMutableRegistryHub() = default; +} +// end catch_interfaces_registry_hub.cpp +// start catch_interfaces_reporter.cpp + +// start catch_reporter_listening.h + +namespace Catch { + + class ListeningReporter : public IStreamingReporter { + using Reporters = std::vector; + Reporters m_listeners; + IStreamingReporterPtr m_reporter = nullptr; + ReporterPreferences m_preferences; + + public: + ListeningReporter(); + + void addListener( IStreamingReporterPtr&& listener ); + void addReporter( IStreamingReporterPtr&& reporter ); + + public: // IStreamingReporter + + ReporterPreferences getPreferences() const override; + + void noMatchingTestCases( std::string const& spec ) override; + + static std::set getSupportedVerbosities(); + + void benchmarkStarting( BenchmarkInfo const& benchmarkInfo ) override; + void benchmarkEnded( BenchmarkStats const& benchmarkStats ) override; + + void testRunStarting( TestRunInfo const& testRunInfo ) override; + void testGroupStarting( GroupInfo const& groupInfo ) override; + void testCaseStarting( TestCaseInfo const& testInfo ) override; + void sectionStarting( SectionInfo const& sectionInfo ) override; + void assertionStarting( AssertionInfo const& assertionInfo ) override; + + // The return value indicates if the messages buffer should be cleared: + bool assertionEnded( AssertionStats const& assertionStats ) override; + void sectionEnded( SectionStats const& sectionStats ) override; + void testCaseEnded( TestCaseStats const& testCaseStats ) override; + void testGroupEnded( TestGroupStats const& testGroupStats ) override; + void testRunEnded( TestRunStats const& testRunStats ) override; + + void skipTest( TestCaseInfo const& testInfo ) override; + bool isMulti() const override; + + }; + +} // end namespace Catch + +// end catch_reporter_listening.h +namespace Catch { + + ReporterConfig::ReporterConfig( IConfigPtr const& _fullConfig ) + : m_stream( &_fullConfig->stream() ), m_fullConfig( _fullConfig ) {} + + ReporterConfig::ReporterConfig( IConfigPtr const& _fullConfig, std::ostream& _stream ) + : m_stream( &_stream ), m_fullConfig( _fullConfig ) {} + + std::ostream& ReporterConfig::stream() const { return *m_stream; } + IConfigPtr ReporterConfig::fullConfig() const { return m_fullConfig; } + + TestRunInfo::TestRunInfo( std::string const& _name ) : name( _name ) {} + + GroupInfo::GroupInfo( std::string const& _name, + std::size_t _groupIndex, + std::size_t _groupsCount ) + : name( _name ), + groupIndex( _groupIndex ), + groupsCounts( _groupsCount ) + {} + + AssertionStats::AssertionStats( AssertionResult const& _assertionResult, + std::vector const& _infoMessages, + Totals const& _totals ) + : assertionResult( _assertionResult ), + infoMessages( _infoMessages ), + totals( _totals ) + { + assertionResult.m_resultData.lazyExpression.m_transientExpression = _assertionResult.m_resultData.lazyExpression.m_transientExpression; + + if( assertionResult.hasMessage() ) { + // Copy message into messages list. + // !TBD This should have been done earlier, somewhere + MessageBuilder builder( assertionResult.getTestMacroName(), assertionResult.getSourceInfo(), assertionResult.getResultType() ); + builder << assertionResult.getMessage(); + builder.m_info.message = builder.m_stream.str(); + + infoMessages.push_back( builder.m_info ); + } + } + + AssertionStats::~AssertionStats() = default; + + SectionStats::SectionStats( SectionInfo const& _sectionInfo, + Counts const& _assertions, + double _durationInSeconds, + bool _missingAssertions ) + : sectionInfo( _sectionInfo ), + assertions( _assertions ), + durationInSeconds( _durationInSeconds ), + missingAssertions( _missingAssertions ) + {} + + SectionStats::~SectionStats() = default; + + TestCaseStats::TestCaseStats( TestCaseInfo const& _testInfo, + Totals const& _totals, + std::string const& _stdOut, + std::string const& _stdErr, + bool _aborting ) + : testInfo( _testInfo ), + totals( _totals ), + stdOut( _stdOut ), + stdErr( _stdErr ), + aborting( _aborting ) + {} + + TestCaseStats::~TestCaseStats() = default; + + TestGroupStats::TestGroupStats( GroupInfo const& _groupInfo, + Totals const& _totals, + bool _aborting ) + : groupInfo( _groupInfo ), + totals( _totals ), + aborting( _aborting ) + {} + + TestGroupStats::TestGroupStats( GroupInfo const& _groupInfo ) + : groupInfo( _groupInfo ), + aborting( false ) + {} + + TestGroupStats::~TestGroupStats() = default; + + TestRunStats::TestRunStats( TestRunInfo const& _runInfo, + Totals const& _totals, + bool _aborting ) + : runInfo( _runInfo ), + totals( _totals ), + aborting( _aborting ) + {} + + TestRunStats::~TestRunStats() = default; + + void IStreamingReporter::fatalErrorEncountered( StringRef ) {} + bool IStreamingReporter::isMulti() const { return false; } + + IReporterFactory::~IReporterFactory() = default; + IReporterRegistry::~IReporterRegistry() = default; + +} // end namespace Catch +// end catch_interfaces_reporter.cpp +// start catch_interfaces_runner.cpp + +namespace Catch { + IRunner::~IRunner() = default; +} +// end catch_interfaces_runner.cpp +// start catch_interfaces_testcase.cpp + +namespace Catch { + ITestInvoker::~ITestInvoker() = default; + ITestCaseRegistry::~ITestCaseRegistry() = default; +} +// end catch_interfaces_testcase.cpp +// start catch_leak_detector.cpp + +#ifdef CATCH_CONFIG_WINDOWS_CRTDBG +#include + +namespace Catch { + + LeakDetector::LeakDetector() { + int flag = _CrtSetDbgFlag(_CRTDBG_REPORT_FLAG); + flag |= _CRTDBG_LEAK_CHECK_DF; + flag |= _CRTDBG_ALLOC_MEM_DF; + _CrtSetDbgFlag(flag); + _CrtSetReportMode(_CRT_WARN, _CRTDBG_MODE_FILE | _CRTDBG_MODE_DEBUG); + _CrtSetReportFile(_CRT_WARN, _CRTDBG_FILE_STDERR); + // Change this to leaking allocation's number to break there + _CrtSetBreakAlloc(-1); + } +} + +#else + + Catch::LeakDetector::LeakDetector() {} + +#endif + +Catch::LeakDetector::~LeakDetector() { + Catch::cleanUp(); +} +// end catch_leak_detector.cpp +// start catch_list.cpp + +// start catch_list.h + +#include + +namespace Catch { + + std::size_t listTests( Config const& config ); + + std::size_t listTestsNamesOnly( Config const& config ); + + struct TagInfo { + void add( std::string const& spelling ); + std::string all() const; + + std::set spellings; + std::size_t count = 0; + }; + + std::size_t listTags( Config const& config ); + + std::size_t listReporters(); + + Option list( std::shared_ptr const& config ); + +} // end namespace Catch + +// end catch_list.h +// start catch_text.h + +namespace Catch { + using namespace clara::TextFlow; +} + +// end catch_text.h +#include +#include +#include + +namespace Catch { + + std::size_t listTests( Config const& config ) { + TestSpec testSpec = config.testSpec(); + if( config.hasTestFilters() ) + Catch::cout() << "Matching test cases:\n"; + else { + Catch::cout() << "All available test cases:\n"; + } + + auto matchedTestCases = filterTests( getAllTestCasesSorted( config ), testSpec, config ); + for( auto const& testCaseInfo : matchedTestCases ) { + Colour::Code colour = testCaseInfo.isHidden() + ? Colour::SecondaryText + : Colour::None; + Colour colourGuard( colour ); + + Catch::cout() << Column( testCaseInfo.name ).initialIndent( 2 ).indent( 4 ) << "\n"; + if( config.verbosity() >= Verbosity::High ) { + Catch::cout() << Column( Catch::Detail::stringify( testCaseInfo.lineInfo ) ).indent(4) << std::endl; + std::string description = testCaseInfo.description; + if( description.empty() ) + description = "(NO DESCRIPTION)"; + Catch::cout() << Column( description ).indent(4) << std::endl; + } + if( !testCaseInfo.tags.empty() ) + Catch::cout() << Column( testCaseInfo.tagsAsString() ).indent( 6 ) << "\n"; + } + + if( !config.hasTestFilters() ) + Catch::cout() << pluralise( matchedTestCases.size(), "test case" ) << '\n' << std::endl; + else + Catch::cout() << pluralise( matchedTestCases.size(), "matching test case" ) << '\n' << std::endl; + return matchedTestCases.size(); + } + + std::size_t listTestsNamesOnly( Config const& config ) { + TestSpec testSpec = config.testSpec(); + std::size_t matchedTests = 0; + std::vector matchedTestCases = filterTests( getAllTestCasesSorted( config ), testSpec, config ); + for( auto const& testCaseInfo : matchedTestCases ) { + matchedTests++; + if( startsWith( testCaseInfo.name, '#' ) ) + Catch::cout() << '"' << testCaseInfo.name << '"'; + else + Catch::cout() << testCaseInfo.name; + if ( config.verbosity() >= Verbosity::High ) + Catch::cout() << "\t@" << testCaseInfo.lineInfo; + Catch::cout() << std::endl; + } + return matchedTests; + } + + void TagInfo::add( std::string const& spelling ) { + ++count; + spellings.insert( spelling ); + } + + std::string TagInfo::all() const { + std::string out; + for( auto const& spelling : spellings ) + out += "[" + spelling + "]"; + return out; + } + + std::size_t listTags( Config const& config ) { + TestSpec testSpec = config.testSpec(); + if( config.hasTestFilters() ) + Catch::cout() << "Tags for matching test cases:\n"; + else { + Catch::cout() << "All available tags:\n"; + } + + std::map tagCounts; + + std::vector matchedTestCases = filterTests( getAllTestCasesSorted( config ), testSpec, config ); + for( auto const& testCase : matchedTestCases ) { + for( auto const& tagName : testCase.getTestCaseInfo().tags ) { + std::string lcaseTagName = toLower( tagName ); + auto countIt = tagCounts.find( lcaseTagName ); + if( countIt == tagCounts.end() ) + countIt = tagCounts.insert( std::make_pair( lcaseTagName, TagInfo() ) ).first; + countIt->second.add( tagName ); + } + } + + for( auto const& tagCount : tagCounts ) { + ReusableStringStream rss; + rss << " " << std::setw(2) << tagCount.second.count << " "; + auto str = rss.str(); + auto wrapper = Column( tagCount.second.all() ) + .initialIndent( 0 ) + .indent( str.size() ) + .width( CATCH_CONFIG_CONSOLE_WIDTH-10 ); + Catch::cout() << str << wrapper << '\n'; + } + Catch::cout() << pluralise( tagCounts.size(), "tag" ) << '\n' << std::endl; + return tagCounts.size(); + } + + std::size_t listReporters() { + Catch::cout() << "Available reporters:\n"; + IReporterRegistry::FactoryMap const& factories = getRegistryHub().getReporterRegistry().getFactories(); + std::size_t maxNameLen = 0; + for( auto const& factoryKvp : factories ) + maxNameLen = (std::max)( maxNameLen, factoryKvp.first.size() ); + + for( auto const& factoryKvp : factories ) { + Catch::cout() + << Column( factoryKvp.first + ":" ) + .indent(2) + .width( 5+maxNameLen ) + + Column( factoryKvp.second->getDescription() ) + .initialIndent(0) + .indent(2) + .width( CATCH_CONFIG_CONSOLE_WIDTH - maxNameLen-8 ) + << "\n"; + } + Catch::cout() << std::endl; + return factories.size(); + } + + Option list( std::shared_ptr const& config ) { + Option listedCount; + getCurrentMutableContext().setConfig( config ); + if( config->listTests() ) + listedCount = listedCount.valueOr(0) + listTests( *config ); + if( config->listTestNamesOnly() ) + listedCount = listedCount.valueOr(0) + listTestsNamesOnly( *config ); + if( config->listTags() ) + listedCount = listedCount.valueOr(0) + listTags( *config ); + if( config->listReporters() ) + listedCount = listedCount.valueOr(0) + listReporters(); + return listedCount; + } + +} // end namespace Catch +// end catch_list.cpp +// start catch_matchers.cpp + +namespace Catch { +namespace Matchers { + namespace Impl { + + std::string MatcherUntypedBase::toString() const { + if( m_cachedToString.empty() ) + m_cachedToString = describe(); + return m_cachedToString; + } + + MatcherUntypedBase::~MatcherUntypedBase() = default; + + } // namespace Impl +} // namespace Matchers + +using namespace Matchers; +using Matchers::Impl::MatcherBase; + +} // namespace Catch +// end catch_matchers.cpp +// start catch_matchers_floating.cpp + +// start catch_polyfills.hpp + +namespace Catch { + bool isnan(float f); + bool isnan(double d); +} + +// end catch_polyfills.hpp +// start catch_to_string.hpp + +#include + +namespace Catch { + template + std::string to_string(T const& t) { +#if defined(CATCH_CONFIG_CPP11_TO_STRING) + return std::to_string(t); +#else + ReusableStringStream rss; + rss << t; + return rss.str(); +#endif + } +} // end namespace Catch + +// end catch_to_string.hpp +#include +#include +#include + +namespace Catch { +namespace Matchers { +namespace Floating { +enum class FloatingPointKind : uint8_t { + Float, + Double +}; +} +} +} + +namespace { + +template +struct Converter; + +template <> +struct Converter { + static_assert(sizeof(float) == sizeof(int32_t), "Important ULP matcher assumption violated"); + Converter(float f) { + std::memcpy(&i, &f, sizeof(f)); + } + int32_t i; +}; + +template <> +struct Converter { + static_assert(sizeof(double) == sizeof(int64_t), "Important ULP matcher assumption violated"); + Converter(double d) { + std::memcpy(&i, &d, sizeof(d)); + } + int64_t i; +}; + +template +auto convert(T t) -> Converter { + return Converter(t); +} + +template +bool almostEqualUlps(FP lhs, FP rhs, int maxUlpDiff) { + // Comparison with NaN should always be false. + // This way we can rule it out before getting into the ugly details + if (Catch::isnan(lhs) || Catch::isnan(rhs)) { + return false; + } + + auto lc = convert(lhs); + auto rc = convert(rhs); + + if ((lc.i < 0) != (rc.i < 0)) { + // Potentially we can have +0 and -0 + return lhs == rhs; + } + + auto ulpDiff = std::abs(lc.i - rc.i); + return ulpDiff <= maxUlpDiff; +} + +} + +namespace Catch { +namespace Matchers { +namespace Floating { + WithinAbsMatcher::WithinAbsMatcher(double target, double margin) + :m_target{ target }, m_margin{ margin } { + CATCH_ENFORCE(margin >= 0, "Invalid margin: " << margin << '.' + << " Margin has to be non-negative."); + } + + // Performs equivalent check of std::fabs(lhs - rhs) <= margin + // But without the subtraction to allow for INFINITY in comparison + bool WithinAbsMatcher::match(double const& matchee) const { + return (matchee + m_margin >= m_target) && (m_target + m_margin >= matchee); + } + + std::string WithinAbsMatcher::describe() const { + return "is within " + ::Catch::Detail::stringify(m_margin) + " of " + ::Catch::Detail::stringify(m_target); + } + + WithinUlpsMatcher::WithinUlpsMatcher(double target, int ulps, FloatingPointKind baseType) + :m_target{ target }, m_ulps{ ulps }, m_type{ baseType } { + CATCH_ENFORCE(ulps >= 0, "Invalid ULP setting: " << ulps << '.' + << " ULPs have to be non-negative."); + } + +#if defined(__clang__) +#pragma clang diagnostic push +// Clang <3.5 reports on the default branch in the switch below +#pragma clang diagnostic ignored "-Wunreachable-code" +#endif + + bool WithinUlpsMatcher::match(double const& matchee) const { + switch (m_type) { + case FloatingPointKind::Float: + return almostEqualUlps(static_cast(matchee), static_cast(m_target), m_ulps); + case FloatingPointKind::Double: + return almostEqualUlps(matchee, m_target, m_ulps); + default: + CATCH_INTERNAL_ERROR( "Unknown FloatingPointKind value" ); + } + } + +#if defined(__clang__) +#pragma clang diagnostic pop +#endif + + std::string WithinUlpsMatcher::describe() const { + return "is within " + Catch::to_string(m_ulps) + " ULPs of " + ::Catch::Detail::stringify(m_target) + ((m_type == FloatingPointKind::Float)? "f" : ""); + } + +}// namespace Floating + +Floating::WithinUlpsMatcher WithinULP(double target, int maxUlpDiff) { + return Floating::WithinUlpsMatcher(target, maxUlpDiff, Floating::FloatingPointKind::Double); +} + +Floating::WithinUlpsMatcher WithinULP(float target, int maxUlpDiff) { + return Floating::WithinUlpsMatcher(target, maxUlpDiff, Floating::FloatingPointKind::Float); +} + +Floating::WithinAbsMatcher WithinAbs(double target, double margin) { + return Floating::WithinAbsMatcher(target, margin); +} + +} // namespace Matchers +} // namespace Catch + +// end catch_matchers_floating.cpp +// start catch_matchers_generic.cpp + +std::string Catch::Matchers::Generic::Detail::finalizeDescription(const std::string& desc) { + if (desc.empty()) { + return "matches undescribed predicate"; + } else { + return "matches predicate: \"" + desc + '"'; + } +} +// end catch_matchers_generic.cpp +// start catch_matchers_string.cpp + +#include + +namespace Catch { +namespace Matchers { + + namespace StdString { + + CasedString::CasedString( std::string const& str, CaseSensitive::Choice caseSensitivity ) + : m_caseSensitivity( caseSensitivity ), + m_str( adjustString( str ) ) + {} + std::string CasedString::adjustString( std::string const& str ) const { + return m_caseSensitivity == CaseSensitive::No + ? toLower( str ) + : str; + } + std::string CasedString::caseSensitivitySuffix() const { + return m_caseSensitivity == CaseSensitive::No + ? " (case insensitive)" + : std::string(); + } + + StringMatcherBase::StringMatcherBase( std::string const& operation, CasedString const& comparator ) + : m_comparator( comparator ), + m_operation( operation ) { + } + + std::string StringMatcherBase::describe() const { + std::string description; + description.reserve(5 + m_operation.size() + m_comparator.m_str.size() + + m_comparator.caseSensitivitySuffix().size()); + description += m_operation; + description += ": \""; + description += m_comparator.m_str; + description += "\""; + description += m_comparator.caseSensitivitySuffix(); + return description; + } + + EqualsMatcher::EqualsMatcher( CasedString const& comparator ) : StringMatcherBase( "equals", comparator ) {} + + bool EqualsMatcher::match( std::string const& source ) const { + return m_comparator.adjustString( source ) == m_comparator.m_str; + } + + ContainsMatcher::ContainsMatcher( CasedString const& comparator ) : StringMatcherBase( "contains", comparator ) {} + + bool ContainsMatcher::match( std::string const& source ) const { + return contains( m_comparator.adjustString( source ), m_comparator.m_str ); + } + + StartsWithMatcher::StartsWithMatcher( CasedString const& comparator ) : StringMatcherBase( "starts with", comparator ) {} + + bool StartsWithMatcher::match( std::string const& source ) const { + return startsWith( m_comparator.adjustString( source ), m_comparator.m_str ); + } + + EndsWithMatcher::EndsWithMatcher( CasedString const& comparator ) : StringMatcherBase( "ends with", comparator ) {} + + bool EndsWithMatcher::match( std::string const& source ) const { + return endsWith( m_comparator.adjustString( source ), m_comparator.m_str ); + } + + RegexMatcher::RegexMatcher(std::string regex, CaseSensitive::Choice caseSensitivity): m_regex(std::move(regex)), m_caseSensitivity(caseSensitivity) {} + + bool RegexMatcher::match(std::string const& matchee) const { + auto flags = std::regex::ECMAScript; // ECMAScript is the default syntax option anyway + if (m_caseSensitivity == CaseSensitive::Choice::No) { + flags |= std::regex::icase; + } + auto reg = std::regex(m_regex, flags); + return std::regex_match(matchee, reg); + } + + std::string RegexMatcher::describe() const { + return "matches " + ::Catch::Detail::stringify(m_regex) + ((m_caseSensitivity == CaseSensitive::Choice::Yes)? " case sensitively" : " case insensitively"); + } + + } // namespace StdString + + StdString::EqualsMatcher Equals( std::string const& str, CaseSensitive::Choice caseSensitivity ) { + return StdString::EqualsMatcher( StdString::CasedString( str, caseSensitivity) ); + } + StdString::ContainsMatcher Contains( std::string const& str, CaseSensitive::Choice caseSensitivity ) { + return StdString::ContainsMatcher( StdString::CasedString( str, caseSensitivity) ); + } + StdString::EndsWithMatcher EndsWith( std::string const& str, CaseSensitive::Choice caseSensitivity ) { + return StdString::EndsWithMatcher( StdString::CasedString( str, caseSensitivity) ); + } + StdString::StartsWithMatcher StartsWith( std::string const& str, CaseSensitive::Choice caseSensitivity ) { + return StdString::StartsWithMatcher( StdString::CasedString( str, caseSensitivity) ); + } + + StdString::RegexMatcher Matches(std::string const& regex, CaseSensitive::Choice caseSensitivity) { + return StdString::RegexMatcher(regex, caseSensitivity); + } + +} // namespace Matchers +} // namespace Catch +// end catch_matchers_string.cpp +// start catch_message.cpp + +// start catch_uncaught_exceptions.h + +namespace Catch { + bool uncaught_exceptions(); +} // end namespace Catch + +// end catch_uncaught_exceptions.h +#include +#include + +namespace Catch { + + MessageInfo::MessageInfo( StringRef const& _macroName, + SourceLineInfo const& _lineInfo, + ResultWas::OfType _type ) + : macroName( _macroName ), + lineInfo( _lineInfo ), + type( _type ), + sequence( ++globalCount ) + {} + + bool MessageInfo::operator==( MessageInfo const& other ) const { + return sequence == other.sequence; + } + + bool MessageInfo::operator<( MessageInfo const& other ) const { + return sequence < other.sequence; + } + + // This may need protecting if threading support is added + unsigned int MessageInfo::globalCount = 0; + + //////////////////////////////////////////////////////////////////////////// + + Catch::MessageBuilder::MessageBuilder( StringRef const& macroName, + SourceLineInfo const& lineInfo, + ResultWas::OfType type ) + :m_info(macroName, lineInfo, type) {} + + //////////////////////////////////////////////////////////////////////////// + + ScopedMessage::ScopedMessage( MessageBuilder const& builder ) + : m_info( builder.m_info ), m_moved() + { + m_info.message = builder.m_stream.str(); + getResultCapture().pushScopedMessage( m_info ); + } + + ScopedMessage::ScopedMessage( ScopedMessage&& old ) + : m_info( old.m_info ), m_moved() + { + old.m_moved = true; + } + + ScopedMessage::~ScopedMessage() { + if ( !uncaught_exceptions() && !m_moved ){ + getResultCapture().popScopedMessage(m_info); + } + } + + Capturer::Capturer( StringRef macroName, SourceLineInfo const& lineInfo, ResultWas::OfType resultType, StringRef names ) { + auto trimmed = [&] (size_t start, size_t end) { + while (names[start] == ',' || isspace(names[start])) { + ++start; + } + while (names[end] == ',' || isspace(names[end])) { + --end; + } + return names.substr(start, end - start + 1); + }; + + size_t start = 0; + std::stack openings; + for (size_t pos = 0; pos < names.size(); ++pos) { + char c = names[pos]; + switch (c) { + case '[': + case '{': + case '(': + // It is basically impossible to disambiguate between + // comparison and start of template args in this context +// case '<': + openings.push(c); + break; + case ']': + case '}': + case ')': +// case '>': + openings.pop(); + break; + case ',': + if (start != pos && openings.size() == 0) { + m_messages.emplace_back(macroName, lineInfo, resultType); + m_messages.back().message = trimmed(start, pos); + m_messages.back().message += " := "; + start = pos; + } + } + } + assert(openings.size() == 0 && "Mismatched openings"); + m_messages.emplace_back(macroName, lineInfo, resultType); + m_messages.back().message = trimmed(start, names.size() - 1); + m_messages.back().message += " := "; + } + Capturer::~Capturer() { + if ( !uncaught_exceptions() ){ + assert( m_captured == m_messages.size() ); + for( size_t i = 0; i < m_captured; ++i ) + m_resultCapture.popScopedMessage( m_messages[i] ); + } + } + + void Capturer::captureValue( size_t index, std::string const& value ) { + assert( index < m_messages.size() ); + m_messages[index].message += value; + m_resultCapture.pushScopedMessage( m_messages[index] ); + m_captured++; + } + +} // end namespace Catch +// end catch_message.cpp +// start catch_output_redirect.cpp + +// start catch_output_redirect.h +#ifndef TWOBLUECUBES_CATCH_OUTPUT_REDIRECT_H +#define TWOBLUECUBES_CATCH_OUTPUT_REDIRECT_H + +#include +#include +#include + +namespace Catch { + + class RedirectedStream { + std::ostream& m_originalStream; + std::ostream& m_redirectionStream; + std::streambuf* m_prevBuf; + + public: + RedirectedStream( std::ostream& originalStream, std::ostream& redirectionStream ); + ~RedirectedStream(); + }; + + class RedirectedStdOut { + ReusableStringStream m_rss; + RedirectedStream m_cout; + public: + RedirectedStdOut(); + auto str() const -> std::string; + }; + + // StdErr has two constituent streams in C++, std::cerr and std::clog + // This means that we need to redirect 2 streams into 1 to keep proper + // order of writes + class RedirectedStdErr { + ReusableStringStream m_rss; + RedirectedStream m_cerr; + RedirectedStream m_clog; + public: + RedirectedStdErr(); + auto str() const -> std::string; + }; + + class RedirectedStreams { + public: + RedirectedStreams(RedirectedStreams const&) = delete; + RedirectedStreams& operator=(RedirectedStreams const&) = delete; + RedirectedStreams(RedirectedStreams&&) = delete; + RedirectedStreams& operator=(RedirectedStreams&&) = delete; + + RedirectedStreams(std::string& redirectedCout, std::string& redirectedCerr); + ~RedirectedStreams(); + private: + std::string& m_redirectedCout; + std::string& m_redirectedCerr; + RedirectedStdOut m_redirectedStdOut; + RedirectedStdErr m_redirectedStdErr; + }; + +#if defined(CATCH_CONFIG_NEW_CAPTURE) + + // Windows's implementation of std::tmpfile is terrible (it tries + // to create a file inside system folder, thus requiring elevated + // privileges for the binary), so we have to use tmpnam(_s) and + // create the file ourselves there. + class TempFile { + public: + TempFile(TempFile const&) = delete; + TempFile& operator=(TempFile const&) = delete; + TempFile(TempFile&&) = delete; + TempFile& operator=(TempFile&&) = delete; + + TempFile(); + ~TempFile(); + + std::FILE* getFile(); + std::string getContents(); + + private: + std::FILE* m_file = nullptr; + #if defined(_MSC_VER) + char m_buffer[L_tmpnam] = { 0 }; + #endif + }; + + class OutputRedirect { + public: + OutputRedirect(OutputRedirect const&) = delete; + OutputRedirect& operator=(OutputRedirect const&) = delete; + OutputRedirect(OutputRedirect&&) = delete; + OutputRedirect& operator=(OutputRedirect&&) = delete; + + OutputRedirect(std::string& stdout_dest, std::string& stderr_dest); + ~OutputRedirect(); + + private: + int m_originalStdout = -1; + int m_originalStderr = -1; + TempFile m_stdoutFile; + TempFile m_stderrFile; + std::string& m_stdoutDest; + std::string& m_stderrDest; + }; + +#endif + +} // end namespace Catch + +#endif // TWOBLUECUBES_CATCH_OUTPUT_REDIRECT_H +// end catch_output_redirect.h +#include +#include +#include +#include +#include + +#if defined(CATCH_CONFIG_NEW_CAPTURE) + #if defined(_MSC_VER) + #include //_dup and _dup2 + #define dup _dup + #define dup2 _dup2 + #define fileno _fileno + #else + #include // dup and dup2 + #endif +#endif + +namespace Catch { + + RedirectedStream::RedirectedStream( std::ostream& originalStream, std::ostream& redirectionStream ) + : m_originalStream( originalStream ), + m_redirectionStream( redirectionStream ), + m_prevBuf( m_originalStream.rdbuf() ) + { + m_originalStream.rdbuf( m_redirectionStream.rdbuf() ); + } + + RedirectedStream::~RedirectedStream() { + m_originalStream.rdbuf( m_prevBuf ); + } + + RedirectedStdOut::RedirectedStdOut() : m_cout( Catch::cout(), m_rss.get() ) {} + auto RedirectedStdOut::str() const -> std::string { return m_rss.str(); } + + RedirectedStdErr::RedirectedStdErr() + : m_cerr( Catch::cerr(), m_rss.get() ), + m_clog( Catch::clog(), m_rss.get() ) + {} + auto RedirectedStdErr::str() const -> std::string { return m_rss.str(); } + + RedirectedStreams::RedirectedStreams(std::string& redirectedCout, std::string& redirectedCerr) + : m_redirectedCout(redirectedCout), + m_redirectedCerr(redirectedCerr) + {} + + RedirectedStreams::~RedirectedStreams() { + m_redirectedCout += m_redirectedStdOut.str(); + m_redirectedCerr += m_redirectedStdErr.str(); + } + +#if defined(CATCH_CONFIG_NEW_CAPTURE) + +#if defined(_MSC_VER) + TempFile::TempFile() { + if (tmpnam_s(m_buffer)) { + CATCH_RUNTIME_ERROR("Could not get a temp filename"); + } + if (fopen_s(&m_file, m_buffer, "w")) { + char buffer[100]; + if (strerror_s(buffer, errno)) { + CATCH_RUNTIME_ERROR("Could not translate errno to a string"); + } + CATCH_RUNTIME_ERROR("Coul dnot open the temp file: '" << m_buffer << "' because: " << buffer); + } + } +#else + TempFile::TempFile() { + m_file = std::tmpfile(); + if (!m_file) { + CATCH_RUNTIME_ERROR("Could not create a temp file."); + } + } + +#endif + + TempFile::~TempFile() { + // TBD: What to do about errors here? + std::fclose(m_file); + // We manually create the file on Windows only, on Linux + // it will be autodeleted +#if defined(_MSC_VER) + std::remove(m_buffer); +#endif + } + + FILE* TempFile::getFile() { + return m_file; + } + + std::string TempFile::getContents() { + std::stringstream sstr; + char buffer[100] = {}; + std::rewind(m_file); + while (std::fgets(buffer, sizeof(buffer), m_file)) { + sstr << buffer; + } + return sstr.str(); + } + + OutputRedirect::OutputRedirect(std::string& stdout_dest, std::string& stderr_dest) : + m_originalStdout(dup(1)), + m_originalStderr(dup(2)), + m_stdoutDest(stdout_dest), + m_stderrDest(stderr_dest) { + dup2(fileno(m_stdoutFile.getFile()), 1); + dup2(fileno(m_stderrFile.getFile()), 2); + } + + OutputRedirect::~OutputRedirect() { + Catch::cout() << std::flush; + fflush(stdout); + // Since we support overriding these streams, we flush cerr + // even though std::cerr is unbuffered + Catch::cerr() << std::flush; + Catch::clog() << std::flush; + fflush(stderr); + + dup2(m_originalStdout, 1); + dup2(m_originalStderr, 2); + + m_stdoutDest += m_stdoutFile.getContents(); + m_stderrDest += m_stderrFile.getContents(); + } + +#endif // CATCH_CONFIG_NEW_CAPTURE + +} // namespace Catch + +#if defined(CATCH_CONFIG_NEW_CAPTURE) + #if defined(_MSC_VER) + #undef dup + #undef dup2 + #undef fileno + #endif +#endif +// end catch_output_redirect.cpp +// start catch_polyfills.cpp + +#include + +namespace Catch { + +#if !defined(CATCH_CONFIG_POLYFILL_ISNAN) + bool isnan(float f) { + return std::isnan(f); + } + bool isnan(double d) { + return std::isnan(d); + } +#else + // For now we only use this for embarcadero + bool isnan(float f) { + return std::_isnan(f); + } + bool isnan(double d) { + return std::_isnan(d); + } +#endif + +} // end namespace Catch +// end catch_polyfills.cpp +// start catch_random_number_generator.cpp + +namespace Catch { + + std::mt19937& rng() { + static std::mt19937 s_rng; + return s_rng; + } + + void seedRng( IConfig const& config ) { + if( config.rngSeed() != 0 ) { + std::srand( config.rngSeed() ); + rng().seed( config.rngSeed() ); + } + } + + unsigned int rngSeed() { + return getCurrentContext().getConfig()->rngSeed(); + } +} +// end catch_random_number_generator.cpp +// start catch_registry_hub.cpp + +// start catch_test_case_registry_impl.h + +#include +#include +#include +#include + +namespace Catch { + + class TestCase; + struct IConfig; + + std::vector sortTests( IConfig const& config, std::vector const& unsortedTestCases ); + bool matchTest( TestCase const& testCase, TestSpec const& testSpec, IConfig const& config ); + + void enforceNoDuplicateTestCases( std::vector const& functions ); + + std::vector filterTests( std::vector const& testCases, TestSpec const& testSpec, IConfig const& config ); + std::vector const& getAllTestCasesSorted( IConfig const& config ); + + class TestRegistry : public ITestCaseRegistry { + public: + virtual ~TestRegistry() = default; + + virtual void registerTest( TestCase const& testCase ); + + std::vector const& getAllTests() const override; + std::vector const& getAllTestsSorted( IConfig const& config ) const override; + + private: + std::vector m_functions; + mutable RunTests::InWhatOrder m_currentSortOrder = RunTests::InDeclarationOrder; + mutable std::vector m_sortedFunctions; + std::size_t m_unnamedCount = 0; + std::ios_base::Init m_ostreamInit; // Forces cout/ cerr to be initialised + }; + + /////////////////////////////////////////////////////////////////////////// + + class TestInvokerAsFunction : public ITestInvoker { + void(*m_testAsFunction)(); + public: + TestInvokerAsFunction( void(*testAsFunction)() ) noexcept; + + void invoke() const override; + }; + + std::string extractClassName( StringRef const& classOrQualifiedMethodName ); + + /////////////////////////////////////////////////////////////////////////// + +} // end namespace Catch + +// end catch_test_case_registry_impl.h +// start catch_reporter_registry.h + +#include + +namespace Catch { + + class ReporterRegistry : public IReporterRegistry { + + public: + + ~ReporterRegistry() override; + + IStreamingReporterPtr create( std::string const& name, IConfigPtr const& config ) const override; + + void registerReporter( std::string const& name, IReporterFactoryPtr const& factory ); + void registerListener( IReporterFactoryPtr const& factory ); + + FactoryMap const& getFactories() const override; + Listeners const& getListeners() const override; + + private: + FactoryMap m_factories; + Listeners m_listeners; + }; +} + +// end catch_reporter_registry.h +// start catch_tag_alias_registry.h + +// start catch_tag_alias.h + +#include + +namespace Catch { + + struct TagAlias { + TagAlias(std::string const& _tag, SourceLineInfo _lineInfo); + + std::string tag; + SourceLineInfo lineInfo; + }; + +} // end namespace Catch + +// end catch_tag_alias.h +#include + +namespace Catch { + + class TagAliasRegistry : public ITagAliasRegistry { + public: + ~TagAliasRegistry() override; + TagAlias const* find( std::string const& alias ) const override; + std::string expandAliases( std::string const& unexpandedTestSpec ) const override; + void add( std::string const& alias, std::string const& tag, SourceLineInfo const& lineInfo ); + + private: + std::map m_registry; + }; + +} // end namespace Catch + +// end catch_tag_alias_registry.h +// start catch_startup_exception_registry.h + +#include +#include + +namespace Catch { + + class StartupExceptionRegistry { + public: + void add(std::exception_ptr const& exception) noexcept; + std::vector const& getExceptions() const noexcept; + private: + std::vector m_exceptions; + }; + +} // end namespace Catch + +// end catch_startup_exception_registry.h +// start catch_singletons.hpp + +namespace Catch { + + struct ISingleton { + virtual ~ISingleton(); + }; + + void addSingleton( ISingleton* singleton ); + void cleanupSingletons(); + + template + class Singleton : SingletonImplT, public ISingleton { + + static auto getInternal() -> Singleton* { + static Singleton* s_instance = nullptr; + if( !s_instance ) { + s_instance = new Singleton; + addSingleton( s_instance ); + } + return s_instance; + } + + public: + static auto get() -> InterfaceT const& { + return *getInternal(); + } + static auto getMutable() -> MutableInterfaceT& { + return *getInternal(); + } + }; + +} // namespace Catch + +// end catch_singletons.hpp +namespace Catch { + + namespace { + + class RegistryHub : public IRegistryHub, public IMutableRegistryHub, + private NonCopyable { + + public: // IRegistryHub + RegistryHub() = default; + IReporterRegistry const& getReporterRegistry() const override { + return m_reporterRegistry; + } + ITestCaseRegistry const& getTestCaseRegistry() const override { + return m_testCaseRegistry; + } + IExceptionTranslatorRegistry const& getExceptionTranslatorRegistry() const override { + return m_exceptionTranslatorRegistry; + } + ITagAliasRegistry const& getTagAliasRegistry() const override { + return m_tagAliasRegistry; + } + StartupExceptionRegistry const& getStartupExceptionRegistry() const override { + return m_exceptionRegistry; + } + + public: // IMutableRegistryHub + void registerReporter( std::string const& name, IReporterFactoryPtr const& factory ) override { + m_reporterRegistry.registerReporter( name, factory ); + } + void registerListener( IReporterFactoryPtr const& factory ) override { + m_reporterRegistry.registerListener( factory ); + } + void registerTest( TestCase const& testInfo ) override { + m_testCaseRegistry.registerTest( testInfo ); + } + void registerTranslator( const IExceptionTranslator* translator ) override { + m_exceptionTranslatorRegistry.registerTranslator( translator ); + } + void registerTagAlias( std::string const& alias, std::string const& tag, SourceLineInfo const& lineInfo ) override { + m_tagAliasRegistry.add( alias, tag, lineInfo ); + } + void registerStartupException() noexcept override { + m_exceptionRegistry.add(std::current_exception()); + } + + private: + TestRegistry m_testCaseRegistry; + ReporterRegistry m_reporterRegistry; + ExceptionTranslatorRegistry m_exceptionTranslatorRegistry; + TagAliasRegistry m_tagAliasRegistry; + StartupExceptionRegistry m_exceptionRegistry; + }; + } + + using RegistryHubSingleton = Singleton; + + IRegistryHub const& getRegistryHub() { + return RegistryHubSingleton::get(); + } + IMutableRegistryHub& getMutableRegistryHub() { + return RegistryHubSingleton::getMutable(); + } + void cleanUp() { + cleanupSingletons(); + cleanUpContext(); + } + std::string translateActiveException() { + return getRegistryHub().getExceptionTranslatorRegistry().translateActiveException(); + } + +} // end namespace Catch +// end catch_registry_hub.cpp +// start catch_reporter_registry.cpp + +namespace Catch { + + ReporterRegistry::~ReporterRegistry() = default; + + IStreamingReporterPtr ReporterRegistry::create( std::string const& name, IConfigPtr const& config ) const { + auto it = m_factories.find( name ); + if( it == m_factories.end() ) + return nullptr; + return it->second->create( ReporterConfig( config ) ); + } + + void ReporterRegistry::registerReporter( std::string const& name, IReporterFactoryPtr const& factory ) { + m_factories.emplace(name, factory); + } + void ReporterRegistry::registerListener( IReporterFactoryPtr const& factory ) { + m_listeners.push_back( factory ); + } + + IReporterRegistry::FactoryMap const& ReporterRegistry::getFactories() const { + return m_factories; + } + IReporterRegistry::Listeners const& ReporterRegistry::getListeners() const { + return m_listeners; + } + +} +// end catch_reporter_registry.cpp +// start catch_result_type.cpp + +namespace Catch { + + bool isOk( ResultWas::OfType resultType ) { + return ( resultType & ResultWas::FailureBit ) == 0; + } + bool isJustInfo( int flags ) { + return flags == ResultWas::Info; + } + + ResultDisposition::Flags operator | ( ResultDisposition::Flags lhs, ResultDisposition::Flags rhs ) { + return static_cast( static_cast( lhs ) | static_cast( rhs ) ); + } + + bool shouldContinueOnFailure( int flags ) { return ( flags & ResultDisposition::ContinueOnFailure ) != 0; } + bool shouldSuppressFailure( int flags ) { return ( flags & ResultDisposition::SuppressFail ) != 0; } + +} // end namespace Catch +// end catch_result_type.cpp +// start catch_run_context.cpp + +#include +#include +#include + +namespace Catch { + + namespace Generators { + struct GeneratorTracker : TestCaseTracking::TrackerBase, IGeneratorTracker { + GeneratorBasePtr m_generator; + + GeneratorTracker( TestCaseTracking::NameAndLocation const& nameAndLocation, TrackerContext& ctx, ITracker* parent ) + : TrackerBase( nameAndLocation, ctx, parent ) + {} + ~GeneratorTracker(); + + static GeneratorTracker& acquire( TrackerContext& ctx, TestCaseTracking::NameAndLocation const& nameAndLocation ) { + std::shared_ptr tracker; + + ITracker& currentTracker = ctx.currentTracker(); + if( TestCaseTracking::ITrackerPtr childTracker = currentTracker.findChild( nameAndLocation ) ) { + assert( childTracker ); + assert( childTracker->isGeneratorTracker() ); + tracker = std::static_pointer_cast( childTracker ); + } + else { + tracker = std::make_shared( nameAndLocation, ctx, ¤tTracker ); + currentTracker.addChild( tracker ); + } + + if( !ctx.completedCycle() && !tracker->isComplete() ) { + tracker->open(); + } + + return *tracker; + } + + // TrackerBase interface + bool isGeneratorTracker() const override { return true; } + auto hasGenerator() const -> bool override { + return !!m_generator; + } + void close() override { + TrackerBase::close(); + // Generator interface only finds out if it has another item on atual move + if (m_runState == CompletedSuccessfully && m_generator->next()) { + m_children.clear(); + m_runState = Executing; + } + } + + // IGeneratorTracker interface + auto getGenerator() const -> GeneratorBasePtr const& override { + return m_generator; + } + void setGenerator( GeneratorBasePtr&& generator ) override { + m_generator = std::move( generator ); + } + }; + GeneratorTracker::~GeneratorTracker() {} + } + + RunContext::RunContext(IConfigPtr const& _config, IStreamingReporterPtr&& reporter) + : m_runInfo(_config->name()), + m_context(getCurrentMutableContext()), + m_config(_config), + m_reporter(std::move(reporter)), + m_lastAssertionInfo{ StringRef(), SourceLineInfo("",0), StringRef(), ResultDisposition::Normal }, + m_includeSuccessfulResults( m_config->includeSuccessfulResults() || m_reporter->getPreferences().shouldReportAllAssertions ) + { + m_context.setRunner(this); + m_context.setConfig(m_config); + m_context.setResultCapture(this); + m_reporter->testRunStarting(m_runInfo); + } + + RunContext::~RunContext() { + m_reporter->testRunEnded(TestRunStats(m_runInfo, m_totals, aborting())); + } + + void RunContext::testGroupStarting(std::string const& testSpec, std::size_t groupIndex, std::size_t groupsCount) { + m_reporter->testGroupStarting(GroupInfo(testSpec, groupIndex, groupsCount)); + } + + void RunContext::testGroupEnded(std::string const& testSpec, Totals const& totals, std::size_t groupIndex, std::size_t groupsCount) { + m_reporter->testGroupEnded(TestGroupStats(GroupInfo(testSpec, groupIndex, groupsCount), totals, aborting())); + } + + Totals RunContext::runTest(TestCase const& testCase) { + Totals prevTotals = m_totals; + + std::string redirectedCout; + std::string redirectedCerr; + + auto const& testInfo = testCase.getTestCaseInfo(); + + m_reporter->testCaseStarting(testInfo); + + m_activeTestCase = &testCase; + + ITracker& rootTracker = m_trackerContext.startRun(); + assert(rootTracker.isSectionTracker()); + static_cast(rootTracker).addInitialFilters(m_config->getSectionsToRun()); + do { + m_trackerContext.startCycle(); + m_testCaseTracker = &SectionTracker::acquire(m_trackerContext, TestCaseTracking::NameAndLocation(testInfo.name, testInfo.lineInfo)); + runCurrentTest(redirectedCout, redirectedCerr); + } while (!m_testCaseTracker->isSuccessfullyCompleted() && !aborting()); + + Totals deltaTotals = m_totals.delta(prevTotals); + if (testInfo.expectedToFail() && deltaTotals.testCases.passed > 0) { + deltaTotals.assertions.failed++; + deltaTotals.testCases.passed--; + deltaTotals.testCases.failed++; + } + m_totals.testCases += deltaTotals.testCases; + m_reporter->testCaseEnded(TestCaseStats(testInfo, + deltaTotals, + redirectedCout, + redirectedCerr, + aborting())); + + m_activeTestCase = nullptr; + m_testCaseTracker = nullptr; + + return deltaTotals; + } + + IConfigPtr RunContext::config() const { + return m_config; + } + + IStreamingReporter& RunContext::reporter() const { + return *m_reporter; + } + + void RunContext::assertionEnded(AssertionResult const & result) { + if (result.getResultType() == ResultWas::Ok) { + m_totals.assertions.passed++; + m_lastAssertionPassed = true; + } else if (!result.isOk()) { + m_lastAssertionPassed = false; + if( m_activeTestCase->getTestCaseInfo().okToFail() ) + m_totals.assertions.failedButOk++; + else + m_totals.assertions.failed++; + } + else { + m_lastAssertionPassed = true; + } + + // We have no use for the return value (whether messages should be cleared), because messages were made scoped + // and should be let to clear themselves out. + static_cast(m_reporter->assertionEnded(AssertionStats(result, m_messages, m_totals))); + + if (result.getResultType() != ResultWas::Warning) + m_messageScopes.clear(); + + // Reset working state + resetAssertionInfo(); + m_lastResult = result; + } + void RunContext::resetAssertionInfo() { + m_lastAssertionInfo.macroName = StringRef(); + m_lastAssertionInfo.capturedExpression = "{Unknown expression after the reported line}"_sr; + } + + bool RunContext::sectionStarted(SectionInfo const & sectionInfo, Counts & assertions) { + ITracker& sectionTracker = SectionTracker::acquire(m_trackerContext, TestCaseTracking::NameAndLocation(sectionInfo.name, sectionInfo.lineInfo)); + if (!sectionTracker.isOpen()) + return false; + m_activeSections.push_back(§ionTracker); + + m_lastAssertionInfo.lineInfo = sectionInfo.lineInfo; + + m_reporter->sectionStarting(sectionInfo); + + assertions = m_totals.assertions; + + return true; + } + auto RunContext::acquireGeneratorTracker( SourceLineInfo const& lineInfo ) -> IGeneratorTracker& { + using namespace Generators; + GeneratorTracker& tracker = GeneratorTracker::acquire( m_trackerContext, TestCaseTracking::NameAndLocation( "generator", lineInfo ) ); + assert( tracker.isOpen() ); + m_lastAssertionInfo.lineInfo = lineInfo; + return tracker; + } + + bool RunContext::testForMissingAssertions(Counts& assertions) { + if (assertions.total() != 0) + return false; + if (!m_config->warnAboutMissingAssertions()) + return false; + if (m_trackerContext.currentTracker().hasChildren()) + return false; + m_totals.assertions.failed++; + assertions.failed++; + return true; + } + + void RunContext::sectionEnded(SectionEndInfo const & endInfo) { + Counts assertions = m_totals.assertions - endInfo.prevAssertions; + bool missingAssertions = testForMissingAssertions(assertions); + + if (!m_activeSections.empty()) { + m_activeSections.back()->close(); + m_activeSections.pop_back(); + } + + m_reporter->sectionEnded(SectionStats(endInfo.sectionInfo, assertions, endInfo.durationInSeconds, missingAssertions)); + m_messages.clear(); + m_messageScopes.clear(); + } + + void RunContext::sectionEndedEarly(SectionEndInfo const & endInfo) { + if (m_unfinishedSections.empty()) + m_activeSections.back()->fail(); + else + m_activeSections.back()->close(); + m_activeSections.pop_back(); + + m_unfinishedSections.push_back(endInfo); + } + void RunContext::benchmarkStarting( BenchmarkInfo const& info ) { + m_reporter->benchmarkStarting( info ); + } + void RunContext::benchmarkEnded( BenchmarkStats const& stats ) { + m_reporter->benchmarkEnded( stats ); + } + + void RunContext::pushScopedMessage(MessageInfo const & message) { + m_messages.push_back(message); + } + + void RunContext::popScopedMessage(MessageInfo const & message) { + m_messages.erase(std::remove(m_messages.begin(), m_messages.end(), message), m_messages.end()); + } + + void RunContext::emplaceUnscopedMessage( MessageBuilder const& builder ) { + m_messageScopes.emplace_back( builder ); + } + + std::string RunContext::getCurrentTestName() const { + return m_activeTestCase + ? m_activeTestCase->getTestCaseInfo().name + : std::string(); + } + + const AssertionResult * RunContext::getLastResult() const { + return &(*m_lastResult); + } + + void RunContext::exceptionEarlyReported() { + m_shouldReportUnexpected = false; + } + + void RunContext::handleFatalErrorCondition( StringRef message ) { + // First notify reporter that bad things happened + m_reporter->fatalErrorEncountered(message); + + // Don't rebuild the result -- the stringification itself can cause more fatal errors + // Instead, fake a result data. + AssertionResultData tempResult( ResultWas::FatalErrorCondition, { false } ); + tempResult.message = message; + AssertionResult result(m_lastAssertionInfo, tempResult); + + assertionEnded(result); + + handleUnfinishedSections(); + + // Recreate section for test case (as we will lose the one that was in scope) + auto const& testCaseInfo = m_activeTestCase->getTestCaseInfo(); + SectionInfo testCaseSection(testCaseInfo.lineInfo, testCaseInfo.name); + + Counts assertions; + assertions.failed = 1; + SectionStats testCaseSectionStats(testCaseSection, assertions, 0, false); + m_reporter->sectionEnded(testCaseSectionStats); + + auto const& testInfo = m_activeTestCase->getTestCaseInfo(); + + Totals deltaTotals; + deltaTotals.testCases.failed = 1; + deltaTotals.assertions.failed = 1; + m_reporter->testCaseEnded(TestCaseStats(testInfo, + deltaTotals, + std::string(), + std::string(), + false)); + m_totals.testCases.failed++; + testGroupEnded(std::string(), m_totals, 1, 1); + m_reporter->testRunEnded(TestRunStats(m_runInfo, m_totals, false)); + } + + bool RunContext::lastAssertionPassed() { + return m_lastAssertionPassed; + } + + void RunContext::assertionPassed() { + m_lastAssertionPassed = true; + ++m_totals.assertions.passed; + resetAssertionInfo(); + m_messageScopes.clear(); + } + + bool RunContext::aborting() const { + return m_totals.assertions.failed >= static_cast(m_config->abortAfter()); + } + + void RunContext::runCurrentTest(std::string & redirectedCout, std::string & redirectedCerr) { + auto const& testCaseInfo = m_activeTestCase->getTestCaseInfo(); + SectionInfo testCaseSection(testCaseInfo.lineInfo, testCaseInfo.name); + m_reporter->sectionStarting(testCaseSection); + Counts prevAssertions = m_totals.assertions; + double duration = 0; + m_shouldReportUnexpected = true; + m_lastAssertionInfo = { "TEST_CASE"_sr, testCaseInfo.lineInfo, StringRef(), ResultDisposition::Normal }; + + seedRng(*m_config); + + Timer timer; + CATCH_TRY { + if (m_reporter->getPreferences().shouldRedirectStdOut) { +#if !defined(CATCH_CONFIG_EXPERIMENTAL_REDIRECT) + RedirectedStreams redirectedStreams(redirectedCout, redirectedCerr); + + timer.start(); + invokeActiveTestCase(); +#else + OutputRedirect r(redirectedCout, redirectedCerr); + timer.start(); + invokeActiveTestCase(); +#endif + } else { + timer.start(); + invokeActiveTestCase(); + } + duration = timer.getElapsedSeconds(); + } CATCH_CATCH_ANON (TestFailureException&) { + // This just means the test was aborted due to failure + } CATCH_CATCH_ALL { + // Under CATCH_CONFIG_FAST_COMPILE, unexpected exceptions under REQUIRE assertions + // are reported without translation at the point of origin. + if( m_shouldReportUnexpected ) { + AssertionReaction dummyReaction; + handleUnexpectedInflightException( m_lastAssertionInfo, translateActiveException(), dummyReaction ); + } + } + Counts assertions = m_totals.assertions - prevAssertions; + bool missingAssertions = testForMissingAssertions(assertions); + + m_testCaseTracker->close(); + handleUnfinishedSections(); + m_messages.clear(); + m_messageScopes.clear(); + + SectionStats testCaseSectionStats(testCaseSection, assertions, duration, missingAssertions); + m_reporter->sectionEnded(testCaseSectionStats); + } + + void RunContext::invokeActiveTestCase() { + FatalConditionHandler fatalConditionHandler; // Handle signals + m_activeTestCase->invoke(); + fatalConditionHandler.reset(); + } + + void RunContext::handleUnfinishedSections() { + // If sections ended prematurely due to an exception we stored their + // infos here so we can tear them down outside the unwind process. + for (auto it = m_unfinishedSections.rbegin(), + itEnd = m_unfinishedSections.rend(); + it != itEnd; + ++it) + sectionEnded(*it); + m_unfinishedSections.clear(); + } + + void RunContext::handleExpr( + AssertionInfo const& info, + ITransientExpression const& expr, + AssertionReaction& reaction + ) { + m_reporter->assertionStarting( info ); + + bool negated = isFalseTest( info.resultDisposition ); + bool result = expr.getResult() != negated; + + if( result ) { + if (!m_includeSuccessfulResults) { + assertionPassed(); + } + else { + reportExpr(info, ResultWas::Ok, &expr, negated); + } + } + else { + reportExpr(info, ResultWas::ExpressionFailed, &expr, negated ); + populateReaction( reaction ); + } + } + void RunContext::reportExpr( + AssertionInfo const &info, + ResultWas::OfType resultType, + ITransientExpression const *expr, + bool negated ) { + + m_lastAssertionInfo = info; + AssertionResultData data( resultType, LazyExpression( negated ) ); + + AssertionResult assertionResult{ info, data }; + assertionResult.m_resultData.lazyExpression.m_transientExpression = expr; + + assertionEnded( assertionResult ); + } + + void RunContext::handleMessage( + AssertionInfo const& info, + ResultWas::OfType resultType, + StringRef const& message, + AssertionReaction& reaction + ) { + m_reporter->assertionStarting( info ); + + m_lastAssertionInfo = info; + + AssertionResultData data( resultType, LazyExpression( false ) ); + data.message = message; + AssertionResult assertionResult{ m_lastAssertionInfo, data }; + assertionEnded( assertionResult ); + if( !assertionResult.isOk() ) + populateReaction( reaction ); + } + void RunContext::handleUnexpectedExceptionNotThrown( + AssertionInfo const& info, + AssertionReaction& reaction + ) { + handleNonExpr(info, Catch::ResultWas::DidntThrowException, reaction); + } + + void RunContext::handleUnexpectedInflightException( + AssertionInfo const& info, + std::string const& message, + AssertionReaction& reaction + ) { + m_lastAssertionInfo = info; + + AssertionResultData data( ResultWas::ThrewException, LazyExpression( false ) ); + data.message = message; + AssertionResult assertionResult{ info, data }; + assertionEnded( assertionResult ); + populateReaction( reaction ); + } + + void RunContext::populateReaction( AssertionReaction& reaction ) { + reaction.shouldDebugBreak = m_config->shouldDebugBreak(); + reaction.shouldThrow = aborting() || (m_lastAssertionInfo.resultDisposition & ResultDisposition::Normal); + } + + void RunContext::handleIncomplete( + AssertionInfo const& info + ) { + m_lastAssertionInfo = info; + + AssertionResultData data( ResultWas::ThrewException, LazyExpression( false ) ); + data.message = "Exception translation was disabled by CATCH_CONFIG_FAST_COMPILE"; + AssertionResult assertionResult{ info, data }; + assertionEnded( assertionResult ); + } + void RunContext::handleNonExpr( + AssertionInfo const &info, + ResultWas::OfType resultType, + AssertionReaction &reaction + ) { + m_lastAssertionInfo = info; + + AssertionResultData data( resultType, LazyExpression( false ) ); + AssertionResult assertionResult{ info, data }; + assertionEnded( assertionResult ); + + if( !assertionResult.isOk() ) + populateReaction( reaction ); + } + + IResultCapture& getResultCapture() { + if (auto* capture = getCurrentContext().getResultCapture()) + return *capture; + else + CATCH_INTERNAL_ERROR("No result capture instance"); + } +} +// end catch_run_context.cpp +// start catch_section.cpp + +namespace Catch { + + Section::Section( SectionInfo const& info ) + : m_info( info ), + m_sectionIncluded( getResultCapture().sectionStarted( m_info, m_assertions ) ) + { + m_timer.start(); + } + + Section::~Section() { + if( m_sectionIncluded ) { + SectionEndInfo endInfo{ m_info, m_assertions, m_timer.getElapsedSeconds() }; + if( uncaught_exceptions() ) + getResultCapture().sectionEndedEarly( endInfo ); + else + getResultCapture().sectionEnded( endInfo ); + } + } + + // This indicates whether the section should be executed or not + Section::operator bool() const { + return m_sectionIncluded; + } + +} // end namespace Catch +// end catch_section.cpp +// start catch_section_info.cpp + +namespace Catch { + + SectionInfo::SectionInfo + ( SourceLineInfo const& _lineInfo, + std::string const& _name ) + : name( _name ), + lineInfo( _lineInfo ) + {} + +} // end namespace Catch +// end catch_section_info.cpp +// start catch_session.cpp + +// start catch_session.h + +#include + +namespace Catch { + + class Session : NonCopyable { + public: + + Session(); + ~Session() override; + + void showHelp() const; + void libIdentify(); + + int applyCommandLine( int argc, char const * const * argv ); + #if defined(CATCH_CONFIG_WCHAR) && defined(WIN32) && defined(UNICODE) + int applyCommandLine( int argc, wchar_t const * const * argv ); + #endif + + void useConfigData( ConfigData const& configData ); + + template + int run(int argc, CharT const * const argv[]) { + if (m_startupExceptions) + return 1; + int returnCode = applyCommandLine(argc, argv); + if (returnCode == 0) + returnCode = run(); + return returnCode; + } + + int run(); + + clara::Parser const& cli() const; + void cli( clara::Parser const& newParser ); + ConfigData& configData(); + Config& config(); + private: + int runInternal(); + + clara::Parser m_cli; + ConfigData m_configData; + std::shared_ptr m_config; + bool m_startupExceptions = false; + }; + +} // end namespace Catch + +// end catch_session.h +// start catch_version.h + +#include + +namespace Catch { + + // Versioning information + struct Version { + Version( Version const& ) = delete; + Version& operator=( Version const& ) = delete; + Version( unsigned int _majorVersion, + unsigned int _minorVersion, + unsigned int _patchNumber, + char const * const _branchName, + unsigned int _buildNumber ); + + unsigned int const majorVersion; + unsigned int const minorVersion; + unsigned int const patchNumber; + + // buildNumber is only used if branchName is not null + char const * const branchName; + unsigned int const buildNumber; + + friend std::ostream& operator << ( std::ostream& os, Version const& version ); + }; + + Version const& libraryVersion(); +} + +// end catch_version.h +#include +#include + +namespace Catch { + + namespace { + const int MaxExitCode = 255; + + IStreamingReporterPtr createReporter(std::string const& reporterName, IConfigPtr const& config) { + auto reporter = Catch::getRegistryHub().getReporterRegistry().create(reporterName, config); + CATCH_ENFORCE(reporter, "No reporter registered with name: '" << reporterName << "'"); + + return reporter; + } + + IStreamingReporterPtr makeReporter(std::shared_ptr const& config) { + if (Catch::getRegistryHub().getReporterRegistry().getListeners().empty()) { + return createReporter(config->getReporterName(), config); + } + + // On older platforms, returning std::unique_ptr + // when the return type is std::unique_ptr + // doesn't compile without a std::move call. However, this causes + // a warning on newer platforms. Thus, we have to work around + // it a bit and downcast the pointer manually. + auto ret = std::unique_ptr(new ListeningReporter); + auto& multi = static_cast(*ret); + auto const& listeners = Catch::getRegistryHub().getReporterRegistry().getListeners(); + for (auto const& listener : listeners) { + multi.addListener(listener->create(Catch::ReporterConfig(config))); + } + multi.addReporter(createReporter(config->getReporterName(), config)); + return ret; + } + + Catch::Totals runTests(std::shared_ptr const& config) { + auto reporter = makeReporter(config); + + RunContext context(config, std::move(reporter)); + + Totals totals; + + context.testGroupStarting(config->name(), 1, 1); + + TestSpec testSpec = config->testSpec(); + + auto const& allTestCases = getAllTestCasesSorted(*config); + for (auto const& testCase : allTestCases) { + if (!context.aborting() && matchTest(testCase, testSpec, *config)) + totals += context.runTest(testCase); + else + context.reporter().skipTest(testCase); + } + + if (config->warnAboutNoTests() && totals.testCases.total() == 0) { + ReusableStringStream testConfig; + + bool first = true; + for (const auto& input : config->getTestsOrTags()) { + if (!first) { testConfig << ' '; } + first = false; + testConfig << input; + } + + context.reporter().noMatchingTestCases(testConfig.str()); + totals.error = -1; + } + + context.testGroupEnded(config->name(), totals, 1, 1); + return totals; + } + + void applyFilenamesAsTags(Catch::IConfig const& config) { + auto& tests = const_cast&>(getAllTestCasesSorted(config)); + for (auto& testCase : tests) { + auto tags = testCase.tags; + + std::string filename = testCase.lineInfo.file; + auto lastSlash = filename.find_last_of("\\/"); + if (lastSlash != std::string::npos) { + filename.erase(0, lastSlash); + filename[0] = '#'; + } + + auto lastDot = filename.find_last_of('.'); + if (lastDot != std::string::npos) { + filename.erase(lastDot); + } + + tags.push_back(std::move(filename)); + setTags(testCase, tags); + } + } + + } // anon namespace + + Session::Session() { + static bool alreadyInstantiated = false; + if( alreadyInstantiated ) { + CATCH_TRY { CATCH_INTERNAL_ERROR( "Only one instance of Catch::Session can ever be used" ); } + CATCH_CATCH_ALL { getMutableRegistryHub().registerStartupException(); } + } + + // There cannot be exceptions at startup in no-exception mode. +#if !defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) + const auto& exceptions = getRegistryHub().getStartupExceptionRegistry().getExceptions(); + if ( !exceptions.empty() ) { + m_startupExceptions = true; + Colour colourGuard( Colour::Red ); + Catch::cerr() << "Errors occurred during startup!" << '\n'; + // iterate over all exceptions and notify user + for ( const auto& ex_ptr : exceptions ) { + try { + std::rethrow_exception(ex_ptr); + } catch ( std::exception const& ex ) { + Catch::cerr() << Column( ex.what() ).indent(2) << '\n'; + } + } + } +#endif + + alreadyInstantiated = true; + m_cli = makeCommandLineParser( m_configData ); + } + Session::~Session() { + Catch::cleanUp(); + } + + void Session::showHelp() const { + Catch::cout() + << "\nCatch v" << libraryVersion() << "\n" + << m_cli << std::endl + << "For more detailed usage please see the project docs\n" << std::endl; + } + void Session::libIdentify() { + Catch::cout() + << std::left << std::setw(16) << "description: " << "A Catch test executable\n" + << std::left << std::setw(16) << "category: " << "testframework\n" + << std::left << std::setw(16) << "framework: " << "Catch Test\n" + << std::left << std::setw(16) << "version: " << libraryVersion() << std::endl; + } + + int Session::applyCommandLine( int argc, char const * const * argv ) { + if( m_startupExceptions ) + return 1; + + auto result = m_cli.parse( clara::Args( argc, argv ) ); + if( !result ) { + config(); + getCurrentMutableContext().setConfig(m_config); + Catch::cerr() + << Colour( Colour::Red ) + << "\nError(s) in input:\n" + << Column( result.errorMessage() ).indent( 2 ) + << "\n\n"; + Catch::cerr() << "Run with -? for usage\n" << std::endl; + return MaxExitCode; + } + + if( m_configData.showHelp ) + showHelp(); + if( m_configData.libIdentify ) + libIdentify(); + m_config.reset(); + return 0; + } + +#if defined(CATCH_CONFIG_WCHAR) && defined(WIN32) && defined(UNICODE) + int Session::applyCommandLine( int argc, wchar_t const * const * argv ) { + + char **utf8Argv = new char *[ argc ]; + + for ( int i = 0; i < argc; ++i ) { + int bufSize = WideCharToMultiByte( CP_UTF8, 0, argv[i], -1, NULL, 0, NULL, NULL ); + + utf8Argv[ i ] = new char[ bufSize ]; + + WideCharToMultiByte( CP_UTF8, 0, argv[i], -1, utf8Argv[i], bufSize, NULL, NULL ); + } + + int returnCode = applyCommandLine( argc, utf8Argv ); + + for ( int i = 0; i < argc; ++i ) + delete [] utf8Argv[ i ]; + + delete [] utf8Argv; + + return returnCode; + } +#endif + + void Session::useConfigData( ConfigData const& configData ) { + m_configData = configData; + m_config.reset(); + } + + int Session::run() { + if( ( m_configData.waitForKeypress & WaitForKeypress::BeforeStart ) != 0 ) { + Catch::cout() << "...waiting for enter/ return before starting" << std::endl; + static_cast(std::getchar()); + } + int exitCode = runInternal(); + if( ( m_configData.waitForKeypress & WaitForKeypress::BeforeExit ) != 0 ) { + Catch::cout() << "...waiting for enter/ return before exiting, with code: " << exitCode << std::endl; + static_cast(std::getchar()); + } + return exitCode; + } + + clara::Parser const& Session::cli() const { + return m_cli; + } + void Session::cli( clara::Parser const& newParser ) { + m_cli = newParser; + } + ConfigData& Session::configData() { + return m_configData; + } + Config& Session::config() { + if( !m_config ) + m_config = std::make_shared( m_configData ); + return *m_config; + } + + int Session::runInternal() { + if( m_startupExceptions ) + return 1; + + if (m_configData.showHelp || m_configData.libIdentify) { + return 0; + } + + CATCH_TRY { + config(); // Force config to be constructed + + seedRng( *m_config ); + + if( m_configData.filenamesAsTags ) + applyFilenamesAsTags( *m_config ); + + // Handle list request + if( Option listed = list( m_config ) ) + return static_cast( *listed ); + + auto totals = runTests( m_config ); + // Note that on unices only the lower 8 bits are usually used, clamping + // the return value to 255 prevents false negative when some multiple + // of 256 tests has failed + return (std::min) (MaxExitCode, (std::max) (totals.error, static_cast(totals.assertions.failed))); + } +#if !defined(CATCH_CONFIG_DISABLE_EXCEPTIONS) + catch( std::exception& ex ) { + Catch::cerr() << ex.what() << std::endl; + return MaxExitCode; + } +#endif + } + +} // end namespace Catch +// end catch_session.cpp +// start catch_singletons.cpp + +#include + +namespace Catch { + + namespace { + static auto getSingletons() -> std::vector*& { + static std::vector* g_singletons = nullptr; + if( !g_singletons ) + g_singletons = new std::vector(); + return g_singletons; + } + } + + ISingleton::~ISingleton() {} + + void addSingleton(ISingleton* singleton ) { + getSingletons()->push_back( singleton ); + } + void cleanupSingletons() { + auto& singletons = getSingletons(); + for( auto singleton : *singletons ) + delete singleton; + delete singletons; + singletons = nullptr; + } + +} // namespace Catch +// end catch_singletons.cpp +// start catch_startup_exception_registry.cpp + +namespace Catch { +void StartupExceptionRegistry::add( std::exception_ptr const& exception ) noexcept { + CATCH_TRY { + m_exceptions.push_back(exception); + } CATCH_CATCH_ALL { + // If we run out of memory during start-up there's really not a lot more we can do about it + std::terminate(); + } + } + + std::vector const& StartupExceptionRegistry::getExceptions() const noexcept { + return m_exceptions; + } + +} // end namespace Catch +// end catch_startup_exception_registry.cpp +// start catch_stream.cpp + +#include +#include +#include +#include +#include +#include + +namespace Catch { + + Catch::IStream::~IStream() = default; + + namespace detail { namespace { + template + class StreamBufImpl : public std::streambuf { + char data[bufferSize]; + WriterF m_writer; + + public: + StreamBufImpl() { + setp( data, data + sizeof(data) ); + } + + ~StreamBufImpl() noexcept { + StreamBufImpl::sync(); + } + + private: + int overflow( int c ) override { + sync(); + + if( c != EOF ) { + if( pbase() == epptr() ) + m_writer( std::string( 1, static_cast( c ) ) ); + else + sputc( static_cast( c ) ); + } + return 0; + } + + int sync() override { + if( pbase() != pptr() ) { + m_writer( std::string( pbase(), static_cast( pptr() - pbase() ) ) ); + setp( pbase(), epptr() ); + } + return 0; + } + }; + + /////////////////////////////////////////////////////////////////////////// + + struct OutputDebugWriter { + + void operator()( std::string const&str ) { + writeToDebugConsole( str ); + } + }; + + /////////////////////////////////////////////////////////////////////////// + + class FileStream : public IStream { + mutable std::ofstream m_ofs; + public: + FileStream( StringRef filename ) { + m_ofs.open( filename.c_str() ); + CATCH_ENFORCE( !m_ofs.fail(), "Unable to open file: '" << filename << "'" ); + } + ~FileStream() override = default; + public: // IStream + std::ostream& stream() const override { + return m_ofs; + } + }; + + /////////////////////////////////////////////////////////////////////////// + + class CoutStream : public IStream { + mutable std::ostream m_os; + public: + // Store the streambuf from cout up-front because + // cout may get redirected when running tests + CoutStream() : m_os( Catch::cout().rdbuf() ) {} + ~CoutStream() override = default; + + public: // IStream + std::ostream& stream() const override { return m_os; } + }; + + /////////////////////////////////////////////////////////////////////////// + + class DebugOutStream : public IStream { + std::unique_ptr> m_streamBuf; + mutable std::ostream m_os; + public: + DebugOutStream() + : m_streamBuf( new StreamBufImpl() ), + m_os( m_streamBuf.get() ) + {} + + ~DebugOutStream() override = default; + + public: // IStream + std::ostream& stream() const override { return m_os; } + }; + + }} // namespace anon::detail + + /////////////////////////////////////////////////////////////////////////// + + auto makeStream( StringRef const &filename ) -> IStream const* { + if( filename.empty() ) + return new detail::CoutStream(); + else if( filename[0] == '%' ) { + if( filename == "%debug" ) + return new detail::DebugOutStream(); + else + CATCH_ERROR( "Unrecognised stream: '" << filename << "'" ); + } + else + return new detail::FileStream( filename ); + } + + // This class encapsulates the idea of a pool of ostringstreams that can be reused. + struct StringStreams { + std::vector> m_streams; + std::vector m_unused; + std::ostringstream m_referenceStream; // Used for copy state/ flags from + + auto add() -> std::size_t { + if( m_unused.empty() ) { + m_streams.push_back( std::unique_ptr( new std::ostringstream ) ); + return m_streams.size()-1; + } + else { + auto index = m_unused.back(); + m_unused.pop_back(); + return index; + } + } + + void release( std::size_t index ) { + m_streams[index]->copyfmt( m_referenceStream ); // Restore initial flags and other state + m_unused.push_back(index); + } + }; + + ReusableStringStream::ReusableStringStream() + : m_index( Singleton::getMutable().add() ), + m_oss( Singleton::getMutable().m_streams[m_index].get() ) + {} + + ReusableStringStream::~ReusableStringStream() { + static_cast( m_oss )->str(""); + m_oss->clear(); + Singleton::getMutable().release( m_index ); + } + + auto ReusableStringStream::str() const -> std::string { + return static_cast( m_oss )->str(); + } + + /////////////////////////////////////////////////////////////////////////// + +#ifndef CATCH_CONFIG_NOSTDOUT // If you #define this you must implement these functions + std::ostream& cout() { return std::cout; } + std::ostream& cerr() { return std::cerr; } + std::ostream& clog() { return std::clog; } +#endif +} +// end catch_stream.cpp +// start catch_string_manip.cpp + +#include +#include +#include +#include + +namespace Catch { + + namespace { + char toLowerCh(char c) { + return static_cast( std::tolower( c ) ); + } + } + + bool startsWith( std::string const& s, std::string const& prefix ) { + return s.size() >= prefix.size() && std::equal(prefix.begin(), prefix.end(), s.begin()); + } + bool startsWith( std::string const& s, char prefix ) { + return !s.empty() && s[0] == prefix; + } + bool endsWith( std::string const& s, std::string const& suffix ) { + return s.size() >= suffix.size() && std::equal(suffix.rbegin(), suffix.rend(), s.rbegin()); + } + bool endsWith( std::string const& s, char suffix ) { + return !s.empty() && s[s.size()-1] == suffix; + } + bool contains( std::string const& s, std::string const& infix ) { + return s.find( infix ) != std::string::npos; + } + void toLowerInPlace( std::string& s ) { + std::transform( s.begin(), s.end(), s.begin(), toLowerCh ); + } + std::string toLower( std::string const& s ) { + std::string lc = s; + toLowerInPlace( lc ); + return lc; + } + std::string trim( std::string const& str ) { + static char const* whitespaceChars = "\n\r\t "; + std::string::size_type start = str.find_first_not_of( whitespaceChars ); + std::string::size_type end = str.find_last_not_of( whitespaceChars ); + + return start != std::string::npos ? str.substr( start, 1+end-start ) : std::string(); + } + + bool replaceInPlace( std::string& str, std::string const& replaceThis, std::string const& withThis ) { + bool replaced = false; + std::size_t i = str.find( replaceThis ); + while( i != std::string::npos ) { + replaced = true; + str = str.substr( 0, i ) + withThis + str.substr( i+replaceThis.size() ); + if( i < str.size()-withThis.size() ) + i = str.find( replaceThis, i+withThis.size() ); + else + i = std::string::npos; + } + return replaced; + } + + pluralise::pluralise( std::size_t count, std::string const& label ) + : m_count( count ), + m_label( label ) + {} + + std::ostream& operator << ( std::ostream& os, pluralise const& pluraliser ) { + os << pluraliser.m_count << ' ' << pluraliser.m_label; + if( pluraliser.m_count != 1 ) + os << 's'; + return os; + } + +} +// end catch_string_manip.cpp +// start catch_stringref.cpp + +#if defined(__clang__) +# pragma clang diagnostic push +# pragma clang diagnostic ignored "-Wexit-time-destructors" +#endif + +#include +#include +#include + +namespace { + const uint32_t byte_2_lead = 0xC0; + const uint32_t byte_3_lead = 0xE0; + const uint32_t byte_4_lead = 0xF0; +} + +namespace Catch { + StringRef::StringRef( char const* rawChars ) noexcept + : StringRef( rawChars, static_cast(std::strlen(rawChars) ) ) + {} + + StringRef::operator std::string() const { + return std::string( m_start, m_size ); + } + + void StringRef::swap( StringRef& other ) noexcept { + std::swap( m_start, other.m_start ); + std::swap( m_size, other.m_size ); + std::swap( m_data, other.m_data ); + } + + auto StringRef::c_str() const -> char const* { + if( isSubstring() ) + const_cast( this )->takeOwnership(); + return m_start; + } + auto StringRef::currentData() const noexcept -> char const* { + return m_start; + } + + auto StringRef::isOwned() const noexcept -> bool { + return m_data != nullptr; + } + auto StringRef::isSubstring() const noexcept -> bool { + return m_start[m_size] != '\0'; + } + + void StringRef::takeOwnership() { + if( !isOwned() ) { + m_data = new char[m_size+1]; + memcpy( m_data, m_start, m_size ); + m_data[m_size] = '\0'; + m_start = m_data; + } + } + auto StringRef::substr( size_type start, size_type size ) const noexcept -> StringRef { + if( start < m_size ) + return StringRef( m_start+start, size ); + else + return StringRef(); + } + auto StringRef::operator == ( StringRef const& other ) const noexcept -> bool { + return + size() == other.size() && + (std::strncmp( m_start, other.m_start, size() ) == 0); + } + auto StringRef::operator != ( StringRef const& other ) const noexcept -> bool { + return !operator==( other ); + } + + auto StringRef::operator[](size_type index) const noexcept -> char { + return m_start[index]; + } + + auto StringRef::numberOfCharacters() const noexcept -> size_type { + size_type noChars = m_size; + // Make adjustments for uft encodings + for( size_type i=0; i < m_size; ++i ) { + char c = m_start[i]; + if( ( c & byte_2_lead ) == byte_2_lead ) { + noChars--; + if (( c & byte_3_lead ) == byte_3_lead ) + noChars--; + if( ( c & byte_4_lead ) == byte_4_lead ) + noChars--; + } + } + return noChars; + } + + auto operator + ( StringRef const& lhs, StringRef const& rhs ) -> std::string { + std::string str; + str.reserve( lhs.size() + rhs.size() ); + str += lhs; + str += rhs; + return str; + } + auto operator + ( StringRef const& lhs, const char* rhs ) -> std::string { + return std::string( lhs ) + std::string( rhs ); + } + auto operator + ( char const* lhs, StringRef const& rhs ) -> std::string { + return std::string( lhs ) + std::string( rhs ); + } + + auto operator << ( std::ostream& os, StringRef const& str ) -> std::ostream& { + return os.write(str.currentData(), str.size()); + } + + auto operator+=( std::string& lhs, StringRef const& rhs ) -> std::string& { + lhs.append(rhs.currentData(), rhs.size()); + return lhs; + } + +} // namespace Catch + +#if defined(__clang__) +# pragma clang diagnostic pop +#endif +// end catch_stringref.cpp +// start catch_tag_alias.cpp + +namespace Catch { + TagAlias::TagAlias(std::string const & _tag, SourceLineInfo _lineInfo): tag(_tag), lineInfo(_lineInfo) {} +} +// end catch_tag_alias.cpp +// start catch_tag_alias_autoregistrar.cpp + +namespace Catch { + + RegistrarForTagAliases::RegistrarForTagAliases(char const* alias, char const* tag, SourceLineInfo const& lineInfo) { + CATCH_TRY { + getMutableRegistryHub().registerTagAlias(alias, tag, lineInfo); + } CATCH_CATCH_ALL { + // Do not throw when constructing global objects, instead register the exception to be processed later + getMutableRegistryHub().registerStartupException(); + } + } + +} +// end catch_tag_alias_autoregistrar.cpp +// start catch_tag_alias_registry.cpp + +#include + +namespace Catch { + + TagAliasRegistry::~TagAliasRegistry() {} + + TagAlias const* TagAliasRegistry::find( std::string const& alias ) const { + auto it = m_registry.find( alias ); + if( it != m_registry.end() ) + return &(it->second); + else + return nullptr; + } + + std::string TagAliasRegistry::expandAliases( std::string const& unexpandedTestSpec ) const { + std::string expandedTestSpec = unexpandedTestSpec; + for( auto const& registryKvp : m_registry ) { + std::size_t pos = expandedTestSpec.find( registryKvp.first ); + if( pos != std::string::npos ) { + expandedTestSpec = expandedTestSpec.substr( 0, pos ) + + registryKvp.second.tag + + expandedTestSpec.substr( pos + registryKvp.first.size() ); + } + } + return expandedTestSpec; + } + + void TagAliasRegistry::add( std::string const& alias, std::string const& tag, SourceLineInfo const& lineInfo ) { + CATCH_ENFORCE( startsWith(alias, "[@") && endsWith(alias, ']'), + "error: tag alias, '" << alias << "' is not of the form [@alias name].\n" << lineInfo ); + + CATCH_ENFORCE( m_registry.insert(std::make_pair(alias, TagAlias(tag, lineInfo))).second, + "error: tag alias, '" << alias << "' already registered.\n" + << "\tFirst seen at: " << find(alias)->lineInfo << "\n" + << "\tRedefined at: " << lineInfo ); + } + + ITagAliasRegistry::~ITagAliasRegistry() {} + + ITagAliasRegistry const& ITagAliasRegistry::get() { + return getRegistryHub().getTagAliasRegistry(); + } + +} // end namespace Catch +// end catch_tag_alias_registry.cpp +// start catch_test_case_info.cpp + +#include +#include +#include +#include + +namespace Catch { + + namespace { + TestCaseInfo::SpecialProperties parseSpecialTag( std::string const& tag ) { + if( startsWith( tag, '.' ) || + tag == "!hide" ) + return TestCaseInfo::IsHidden; + else if( tag == "!throws" ) + return TestCaseInfo::Throws; + else if( tag == "!shouldfail" ) + return TestCaseInfo::ShouldFail; + else if( tag == "!mayfail" ) + return TestCaseInfo::MayFail; + else if( tag == "!nonportable" ) + return TestCaseInfo::NonPortable; + else if( tag == "!benchmark" ) + return static_cast( TestCaseInfo::Benchmark | TestCaseInfo::IsHidden ); + else + return TestCaseInfo::None; + } + bool isReservedTag( std::string const& tag ) { + return parseSpecialTag( tag ) == TestCaseInfo::None && tag.size() > 0 && !std::isalnum( static_cast(tag[0]) ); + } + void enforceNotReservedTag( std::string const& tag, SourceLineInfo const& _lineInfo ) { + CATCH_ENFORCE( !isReservedTag(tag), + "Tag name: [" << tag << "] is not allowed.\n" + << "Tag names starting with non alpha-numeric characters are reserved\n" + << _lineInfo ); + } + } + + TestCase makeTestCase( ITestInvoker* _testCase, + std::string const& _className, + NameAndTags const& nameAndTags, + SourceLineInfo const& _lineInfo ) + { + bool isHidden = false; + + // Parse out tags + std::vector tags; + std::string desc, tag; + bool inTag = false; + std::string _descOrTags = nameAndTags.tags; + for (char c : _descOrTags) { + if( !inTag ) { + if( c == '[' ) + inTag = true; + else + desc += c; + } + else { + if( c == ']' ) { + TestCaseInfo::SpecialProperties prop = parseSpecialTag( tag ); + if( ( prop & TestCaseInfo::IsHidden ) != 0 ) + isHidden = true; + else if( prop == TestCaseInfo::None ) + enforceNotReservedTag( tag, _lineInfo ); + + tags.push_back( tag ); + tag.clear(); + inTag = false; + } + else + tag += c; + } + } + if( isHidden ) { + tags.push_back( "." ); + } + + TestCaseInfo info( nameAndTags.name, _className, desc, tags, _lineInfo ); + return TestCase( _testCase, std::move(info) ); + } + + void setTags( TestCaseInfo& testCaseInfo, std::vector tags ) { + std::sort(begin(tags), end(tags)); + tags.erase(std::unique(begin(tags), end(tags)), end(tags)); + testCaseInfo.lcaseTags.clear(); + + for( auto const& tag : tags ) { + std::string lcaseTag = toLower( tag ); + testCaseInfo.properties = static_cast( testCaseInfo.properties | parseSpecialTag( lcaseTag ) ); + testCaseInfo.lcaseTags.push_back( lcaseTag ); + } + testCaseInfo.tags = std::move(tags); + } + + TestCaseInfo::TestCaseInfo( std::string const& _name, + std::string const& _className, + std::string const& _description, + std::vector const& _tags, + SourceLineInfo const& _lineInfo ) + : name( _name ), + className( _className ), + description( _description ), + lineInfo( _lineInfo ), + properties( None ) + { + setTags( *this, _tags ); + } + + bool TestCaseInfo::isHidden() const { + return ( properties & IsHidden ) != 0; + } + bool TestCaseInfo::throws() const { + return ( properties & Throws ) != 0; + } + bool TestCaseInfo::okToFail() const { + return ( properties & (ShouldFail | MayFail ) ) != 0; + } + bool TestCaseInfo::expectedToFail() const { + return ( properties & (ShouldFail ) ) != 0; + } + + std::string TestCaseInfo::tagsAsString() const { + std::string ret; + // '[' and ']' per tag + std::size_t full_size = 2 * tags.size(); + for (const auto& tag : tags) { + full_size += tag.size(); + } + ret.reserve(full_size); + for (const auto& tag : tags) { + ret.push_back('['); + ret.append(tag); + ret.push_back(']'); + } + + return ret; + } + + TestCase::TestCase( ITestInvoker* testCase, TestCaseInfo&& info ) : TestCaseInfo( std::move(info) ), test( testCase ) {} + + TestCase TestCase::withName( std::string const& _newName ) const { + TestCase other( *this ); + other.name = _newName; + return other; + } + + void TestCase::invoke() const { + test->invoke(); + } + + bool TestCase::operator == ( TestCase const& other ) const { + return test.get() == other.test.get() && + name == other.name && + className == other.className; + } + + bool TestCase::operator < ( TestCase const& other ) const { + return name < other.name; + } + + TestCaseInfo const& TestCase::getTestCaseInfo() const + { + return *this; + } + +} // end namespace Catch +// end catch_test_case_info.cpp +// start catch_test_case_registry_impl.cpp + +#include + +namespace Catch { + + std::vector sortTests( IConfig const& config, std::vector const& unsortedTestCases ) { + + std::vector sorted = unsortedTestCases; + + switch( config.runOrder() ) { + case RunTests::InLexicographicalOrder: + std::sort( sorted.begin(), sorted.end() ); + break; + case RunTests::InRandomOrder: + seedRng( config ); + std::shuffle( sorted.begin(), sorted.end(), rng() ); + break; + case RunTests::InDeclarationOrder: + // already in declaration order + break; + } + return sorted; + } + bool matchTest( TestCase const& testCase, TestSpec const& testSpec, IConfig const& config ) { + return testSpec.matches( testCase ) && ( config.allowThrows() || !testCase.throws() ); + } + + void enforceNoDuplicateTestCases( std::vector const& functions ) { + std::set seenFunctions; + for( auto const& function : functions ) { + auto prev = seenFunctions.insert( function ); + CATCH_ENFORCE( prev.second, + "error: TEST_CASE( \"" << function.name << "\" ) already defined.\n" + << "\tFirst seen at " << prev.first->getTestCaseInfo().lineInfo << "\n" + << "\tRedefined at " << function.getTestCaseInfo().lineInfo ); + } + } + + std::vector filterTests( std::vector const& testCases, TestSpec const& testSpec, IConfig const& config ) { + std::vector filtered; + filtered.reserve( testCases.size() ); + for( auto const& testCase : testCases ) + if( matchTest( testCase, testSpec, config ) ) + filtered.push_back( testCase ); + return filtered; + } + std::vector const& getAllTestCasesSorted( IConfig const& config ) { + return getRegistryHub().getTestCaseRegistry().getAllTestsSorted( config ); + } + + void TestRegistry::registerTest( TestCase const& testCase ) { + std::string name = testCase.getTestCaseInfo().name; + if( name.empty() ) { + ReusableStringStream rss; + rss << "Anonymous test case " << ++m_unnamedCount; + return registerTest( testCase.withName( rss.str() ) ); + } + m_functions.push_back( testCase ); + } + + std::vector const& TestRegistry::getAllTests() const { + return m_functions; + } + std::vector const& TestRegistry::getAllTestsSorted( IConfig const& config ) const { + if( m_sortedFunctions.empty() ) + enforceNoDuplicateTestCases( m_functions ); + + if( m_currentSortOrder != config.runOrder() || m_sortedFunctions.empty() ) { + m_sortedFunctions = sortTests( config, m_functions ); + m_currentSortOrder = config.runOrder(); + } + return m_sortedFunctions; + } + + /////////////////////////////////////////////////////////////////////////// + TestInvokerAsFunction::TestInvokerAsFunction( void(*testAsFunction)() ) noexcept : m_testAsFunction( testAsFunction ) {} + + void TestInvokerAsFunction::invoke() const { + m_testAsFunction(); + } + + std::string extractClassName( StringRef const& classOrQualifiedMethodName ) { + std::string className = classOrQualifiedMethodName; + if( startsWith( className, '&' ) ) + { + std::size_t lastColons = className.rfind( "::" ); + std::size_t penultimateColons = className.rfind( "::", lastColons-1 ); + if( penultimateColons == std::string::npos ) + penultimateColons = 1; + className = className.substr( penultimateColons, lastColons-penultimateColons ); + } + return className; + } + +} // end namespace Catch +// end catch_test_case_registry_impl.cpp +// start catch_test_case_tracker.cpp + +#include +#include +#include +#include +#include + +#if defined(__clang__) +# pragma clang diagnostic push +# pragma clang diagnostic ignored "-Wexit-time-destructors" +#endif + +namespace Catch { +namespace TestCaseTracking { + + NameAndLocation::NameAndLocation( std::string const& _name, SourceLineInfo const& _location ) + : name( _name ), + location( _location ) + {} + + ITracker::~ITracker() = default; + + TrackerContext& TrackerContext::instance() { + static TrackerContext s_instance; + return s_instance; + } + + ITracker& TrackerContext::startRun() { + m_rootTracker = std::make_shared( NameAndLocation( "{root}", CATCH_INTERNAL_LINEINFO ), *this, nullptr ); + m_currentTracker = nullptr; + m_runState = Executing; + return *m_rootTracker; + } + + void TrackerContext::endRun() { + m_rootTracker.reset(); + m_currentTracker = nullptr; + m_runState = NotStarted; + } + + void TrackerContext::startCycle() { + m_currentTracker = m_rootTracker.get(); + m_runState = Executing; + } + void TrackerContext::completeCycle() { + m_runState = CompletedCycle; + } + + bool TrackerContext::completedCycle() const { + return m_runState == CompletedCycle; + } + ITracker& TrackerContext::currentTracker() { + return *m_currentTracker; + } + void TrackerContext::setCurrentTracker( ITracker* tracker ) { + m_currentTracker = tracker; + } + + TrackerBase::TrackerBase( NameAndLocation const& nameAndLocation, TrackerContext& ctx, ITracker* parent ) + : m_nameAndLocation( nameAndLocation ), + m_ctx( ctx ), + m_parent( parent ) + {} + + NameAndLocation const& TrackerBase::nameAndLocation() const { + return m_nameAndLocation; + } + bool TrackerBase::isComplete() const { + return m_runState == CompletedSuccessfully || m_runState == Failed; + } + bool TrackerBase::isSuccessfullyCompleted() const { + return m_runState == CompletedSuccessfully; + } + bool TrackerBase::isOpen() const { + return m_runState != NotStarted && !isComplete(); + } + bool TrackerBase::hasChildren() const { + return !m_children.empty(); + } + + void TrackerBase::addChild( ITrackerPtr const& child ) { + m_children.push_back( child ); + } + + ITrackerPtr TrackerBase::findChild( NameAndLocation const& nameAndLocation ) { + auto it = std::find_if( m_children.begin(), m_children.end(), + [&nameAndLocation]( ITrackerPtr const& tracker ){ + return + tracker->nameAndLocation().location == nameAndLocation.location && + tracker->nameAndLocation().name == nameAndLocation.name; + } ); + return( it != m_children.end() ) + ? *it + : nullptr; + } + ITracker& TrackerBase::parent() { + assert( m_parent ); // Should always be non-null except for root + return *m_parent; + } + + void TrackerBase::openChild() { + if( m_runState != ExecutingChildren ) { + m_runState = ExecutingChildren; + if( m_parent ) + m_parent->openChild(); + } + } + + bool TrackerBase::isSectionTracker() const { return false; } + bool TrackerBase::isGeneratorTracker() const { return false; } + + void TrackerBase::open() { + m_runState = Executing; + moveToThis(); + if( m_parent ) + m_parent->openChild(); + } + + void TrackerBase::close() { + + // Close any still open children (e.g. generators) + while( &m_ctx.currentTracker() != this ) + m_ctx.currentTracker().close(); + + switch( m_runState ) { + case NeedsAnotherRun: + break; + + case Executing: + m_runState = CompletedSuccessfully; + break; + case ExecutingChildren: + if( m_children.empty() || m_children.back()->isComplete() ) + m_runState = CompletedSuccessfully; + break; + + case NotStarted: + case CompletedSuccessfully: + case Failed: + CATCH_INTERNAL_ERROR( "Illogical state: " << m_runState ); + + default: + CATCH_INTERNAL_ERROR( "Unknown state: " << m_runState ); + } + moveToParent(); + m_ctx.completeCycle(); + } + void TrackerBase::fail() { + m_runState = Failed; + if( m_parent ) + m_parent->markAsNeedingAnotherRun(); + moveToParent(); + m_ctx.completeCycle(); + } + void TrackerBase::markAsNeedingAnotherRun() { + m_runState = NeedsAnotherRun; + } + + void TrackerBase::moveToParent() { + assert( m_parent ); + m_ctx.setCurrentTracker( m_parent ); + } + void TrackerBase::moveToThis() { + m_ctx.setCurrentTracker( this ); + } + + SectionTracker::SectionTracker( NameAndLocation const& nameAndLocation, TrackerContext& ctx, ITracker* parent ) + : TrackerBase( nameAndLocation, ctx, parent ) + { + if( parent ) { + while( !parent->isSectionTracker() ) + parent = &parent->parent(); + + SectionTracker& parentSection = static_cast( *parent ); + addNextFilters( parentSection.m_filters ); + } + } + + bool SectionTracker::isComplete() const { + bool complete = true; + + if ((m_filters.empty() || m_filters[0] == "") || + std::find(m_filters.begin(), m_filters.end(), + m_nameAndLocation.name) != m_filters.end()) + complete = TrackerBase::isComplete(); + return complete; + + } + + bool SectionTracker::isSectionTracker() const { return true; } + + SectionTracker& SectionTracker::acquire( TrackerContext& ctx, NameAndLocation const& nameAndLocation ) { + std::shared_ptr section; + + ITracker& currentTracker = ctx.currentTracker(); + if( ITrackerPtr childTracker = currentTracker.findChild( nameAndLocation ) ) { + assert( childTracker ); + assert( childTracker->isSectionTracker() ); + section = std::static_pointer_cast( childTracker ); + } + else { + section = std::make_shared( nameAndLocation, ctx, ¤tTracker ); + currentTracker.addChild( section ); + } + if( !ctx.completedCycle() ) + section->tryOpen(); + return *section; + } + + void SectionTracker::tryOpen() { + if( !isComplete() && (m_filters.empty() || m_filters[0].empty() || m_filters[0] == m_nameAndLocation.name ) ) + open(); + } + + void SectionTracker::addInitialFilters( std::vector const& filters ) { + if( !filters.empty() ) { + m_filters.push_back(""); // Root - should never be consulted + m_filters.push_back(""); // Test Case - not a section filter + m_filters.insert( m_filters.end(), filters.begin(), filters.end() ); + } + } + void SectionTracker::addNextFilters( std::vector const& filters ) { + if( filters.size() > 1 ) + m_filters.insert( m_filters.end(), ++filters.begin(), filters.end() ); + } + +} // namespace TestCaseTracking + +using TestCaseTracking::ITracker; +using TestCaseTracking::TrackerContext; +using TestCaseTracking::SectionTracker; + +} // namespace Catch + +#if defined(__clang__) +# pragma clang diagnostic pop +#endif +// end catch_test_case_tracker.cpp +// start catch_test_registry.cpp + +namespace Catch { + + auto makeTestInvoker( void(*testAsFunction)() ) noexcept -> ITestInvoker* { + return new(std::nothrow) TestInvokerAsFunction( testAsFunction ); + } + + NameAndTags::NameAndTags( StringRef const& name_ , StringRef const& tags_ ) noexcept : name( name_ ), tags( tags_ ) {} + + AutoReg::AutoReg( ITestInvoker* invoker, SourceLineInfo const& lineInfo, StringRef const& classOrMethod, NameAndTags const& nameAndTags ) noexcept { + CATCH_TRY { + getMutableRegistryHub() + .registerTest( + makeTestCase( + invoker, + extractClassName( classOrMethod ), + nameAndTags, + lineInfo)); + } CATCH_CATCH_ALL { + // Do not throw when constructing global objects, instead register the exception to be processed later + getMutableRegistryHub().registerStartupException(); + } + } + + AutoReg::~AutoReg() = default; +} +// end catch_test_registry.cpp +// start catch_test_spec.cpp + +#include +#include +#include +#include + +namespace Catch { + + TestSpec::Pattern::~Pattern() = default; + TestSpec::NamePattern::~NamePattern() = default; + TestSpec::TagPattern::~TagPattern() = default; + TestSpec::ExcludedPattern::~ExcludedPattern() = default; + + TestSpec::NamePattern::NamePattern( std::string const& name ) + : m_wildcardPattern( toLower( name ), CaseSensitive::No ) + {} + bool TestSpec::NamePattern::matches( TestCaseInfo const& testCase ) const { + return m_wildcardPattern.matches( toLower( testCase.name ) ); + } + + TestSpec::TagPattern::TagPattern( std::string const& tag ) : m_tag( toLower( tag ) ) {} + bool TestSpec::TagPattern::matches( TestCaseInfo const& testCase ) const { + return std::find(begin(testCase.lcaseTags), + end(testCase.lcaseTags), + m_tag) != end(testCase.lcaseTags); + } + + TestSpec::ExcludedPattern::ExcludedPattern( PatternPtr const& underlyingPattern ) : m_underlyingPattern( underlyingPattern ) {} + bool TestSpec::ExcludedPattern::matches( TestCaseInfo const& testCase ) const { return !m_underlyingPattern->matches( testCase ); } + + bool TestSpec::Filter::matches( TestCaseInfo const& testCase ) const { + // All patterns in a filter must match for the filter to be a match + for( auto const& pattern : m_patterns ) { + if( !pattern->matches( testCase ) ) + return false; + } + return true; + } + + bool TestSpec::hasFilters() const { + return !m_filters.empty(); + } + bool TestSpec::matches( TestCaseInfo const& testCase ) const { + // A TestSpec matches if any filter matches + for( auto const& filter : m_filters ) + if( filter.matches( testCase ) ) + return true; + return false; + } +} +// end catch_test_spec.cpp +// start catch_test_spec_parser.cpp + +namespace Catch { + + TestSpecParser::TestSpecParser( ITagAliasRegistry const& tagAliases ) : m_tagAliases( &tagAliases ) {} + + TestSpecParser& TestSpecParser::parse( std::string const& arg ) { + m_mode = None; + m_exclusion = false; + m_start = std::string::npos; + m_arg = m_tagAliases->expandAliases( arg ); + m_escapeChars.clear(); + for( m_pos = 0; m_pos < m_arg.size(); ++m_pos ) + visitChar( m_arg[m_pos] ); + if( m_mode == Name ) + addPattern(); + return *this; + } + TestSpec TestSpecParser::testSpec() { + addFilter(); + return m_testSpec; + } + + void TestSpecParser::visitChar( char c ) { + if( m_mode == None ) { + switch( c ) { + case ' ': return; + case '~': m_exclusion = true; return; + case '[': return startNewMode( Tag, ++m_pos ); + case '"': return startNewMode( QuotedName, ++m_pos ); + case '\\': return escape(); + default: startNewMode( Name, m_pos ); break; + } + } + if( m_mode == Name ) { + if( c == ',' ) { + addPattern(); + addFilter(); + } + else if( c == '[' ) { + if( subString() == "exclude:" ) + m_exclusion = true; + else + addPattern(); + startNewMode( Tag, ++m_pos ); + } + else if( c == '\\' ) + escape(); + } + else if( m_mode == EscapedName ) + m_mode = Name; + else if( m_mode == QuotedName && c == '"' ) + addPattern(); + else if( m_mode == Tag && c == ']' ) + addPattern(); + } + void TestSpecParser::startNewMode( Mode mode, std::size_t start ) { + m_mode = mode; + m_start = start; + } + void TestSpecParser::escape() { + if( m_mode == None ) + m_start = m_pos; + m_mode = EscapedName; + m_escapeChars.push_back( m_pos ); + } + std::string TestSpecParser::subString() const { return m_arg.substr( m_start, m_pos - m_start ); } + + void TestSpecParser::addFilter() { + if( !m_currentFilter.m_patterns.empty() ) { + m_testSpec.m_filters.push_back( m_currentFilter ); + m_currentFilter = TestSpec::Filter(); + } + } + + TestSpec parseTestSpec( std::string const& arg ) { + return TestSpecParser( ITagAliasRegistry::get() ).parse( arg ).testSpec(); + } + +} // namespace Catch +// end catch_test_spec_parser.cpp +// start catch_timer.cpp + +#include + +static const uint64_t nanosecondsInSecond = 1000000000; + +namespace Catch { + + auto getCurrentNanosecondsSinceEpoch() -> uint64_t { + return std::chrono::duration_cast( std::chrono::high_resolution_clock::now().time_since_epoch() ).count(); + } + + namespace { + auto estimateClockResolution() -> uint64_t { + uint64_t sum = 0; + static const uint64_t iterations = 1000000; + + auto startTime = getCurrentNanosecondsSinceEpoch(); + + for( std::size_t i = 0; i < iterations; ++i ) { + + uint64_t ticks; + uint64_t baseTicks = getCurrentNanosecondsSinceEpoch(); + do { + ticks = getCurrentNanosecondsSinceEpoch(); + } while( ticks == baseTicks ); + + auto delta = ticks - baseTicks; + sum += delta; + + // If we have been calibrating for over 3 seconds -- the clock + // is terrible and we should move on. + // TBD: How to signal that the measured resolution is probably wrong? + if (ticks > startTime + 3 * nanosecondsInSecond) { + return sum / ( i + 1u ); + } + } + + // We're just taking the mean, here. To do better we could take the std. dev and exclude outliers + // - and potentially do more iterations if there's a high variance. + return sum/iterations; + } + } + auto getEstimatedClockResolution() -> uint64_t { + static auto s_resolution = estimateClockResolution(); + return s_resolution; + } + + void Timer::start() { + m_nanoseconds = getCurrentNanosecondsSinceEpoch(); + } + auto Timer::getElapsedNanoseconds() const -> uint64_t { + return getCurrentNanosecondsSinceEpoch() - m_nanoseconds; + } + auto Timer::getElapsedMicroseconds() const -> uint64_t { + return getElapsedNanoseconds()/1000; + } + auto Timer::getElapsedMilliseconds() const -> unsigned int { + return static_cast(getElapsedMicroseconds()/1000); + } + auto Timer::getElapsedSeconds() const -> double { + return getElapsedMicroseconds()/1000000.0; + } + +} // namespace Catch +// end catch_timer.cpp +// start catch_tostring.cpp + +#if defined(__clang__) +# pragma clang diagnostic push +# pragma clang diagnostic ignored "-Wexit-time-destructors" +# pragma clang diagnostic ignored "-Wglobal-constructors" +#endif + +// Enable specific decls locally +#if !defined(CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER) +#define CATCH_CONFIG_ENABLE_CHRONO_STRINGMAKER +#endif + +#include +#include + +namespace Catch { + +namespace Detail { + + const std::string unprintableString = "{?}"; + + namespace { + const int hexThreshold = 255; + + struct Endianness { + enum Arch { Big, Little }; + + static Arch which() { + union _{ + int asInt; + char asChar[sizeof (int)]; + } u; + + u.asInt = 1; + return ( u.asChar[sizeof(int)-1] == 1 ) ? Big : Little; + } + }; + } + + std::string rawMemoryToString( const void *object, std::size_t size ) { + // Reverse order for little endian architectures + int i = 0, end = static_cast( size ), inc = 1; + if( Endianness::which() == Endianness::Little ) { + i = end-1; + end = inc = -1; + } + + unsigned char const *bytes = static_cast(object); + ReusableStringStream rss; + rss << "0x" << std::setfill('0') << std::hex; + for( ; i != end; i += inc ) + rss << std::setw(2) << static_cast(bytes[i]); + return rss.str(); + } +} + +template +std::string fpToString( T value, int precision ) { + if (Catch::isnan(value)) { + return "nan"; + } + + ReusableStringStream rss; + rss << std::setprecision( precision ) + << std::fixed + << value; + std::string d = rss.str(); + std::size_t i = d.find_last_not_of( '0' ); + if( i != std::string::npos && i != d.size()-1 ) { + if( d[i] == '.' ) + i++; + d = d.substr( 0, i+1 ); + } + return d; +} + +//// ======================================================= //// +// +// Out-of-line defs for full specialization of StringMaker +// +//// ======================================================= //// + +std::string StringMaker::convert(const std::string& str) { + if (!getCurrentContext().getConfig()->showInvisibles()) { + return '"' + str + '"'; + } + + std::string s("\""); + for (char c : str) { + switch (c) { + case '\n': + s.append("\\n"); + break; + case '\t': + s.append("\\t"); + break; + default: + s.push_back(c); + break; + } + } + s.append("\""); + return s; +} + +#ifdef CATCH_CONFIG_CPP17_STRING_VIEW +std::string StringMaker::convert(std::string_view str) { + return ::Catch::Detail::stringify(std::string{ str }); +} +#endif + +std::string StringMaker::convert(char const* str) { + if (str) { + return ::Catch::Detail::stringify(std::string{ str }); + } else { + return{ "{null string}" }; + } +} +std::string StringMaker::convert(char* str) { + if (str) { + return ::Catch::Detail::stringify(std::string{ str }); + } else { + return{ "{null string}" }; + } +} + +#ifdef CATCH_CONFIG_WCHAR +std::string StringMaker::convert(const std::wstring& wstr) { + std::string s; + s.reserve(wstr.size()); + for (auto c : wstr) { + s += (c <= 0xff) ? static_cast(c) : '?'; + } + return ::Catch::Detail::stringify(s); +} + +# ifdef CATCH_CONFIG_CPP17_STRING_VIEW +std::string StringMaker::convert(std::wstring_view str) { + return StringMaker::convert(std::wstring(str)); +} +# endif + +std::string StringMaker::convert(wchar_t const * str) { + if (str) { + return ::Catch::Detail::stringify(std::wstring{ str }); + } else { + return{ "{null string}" }; + } +} +std::string StringMaker::convert(wchar_t * str) { + if (str) { + return ::Catch::Detail::stringify(std::wstring{ str }); + } else { + return{ "{null string}" }; + } +} +#endif + +std::string StringMaker::convert(int value) { + return ::Catch::Detail::stringify(static_cast(value)); +} +std::string StringMaker::convert(long value) { + return ::Catch::Detail::stringify(static_cast(value)); +} +std::string StringMaker::convert(long long value) { + ReusableStringStream rss; + rss << value; + if (value > Detail::hexThreshold) { + rss << " (0x" << std::hex << value << ')'; + } + return rss.str(); +} + +std::string StringMaker::convert(unsigned int value) { + return ::Catch::Detail::stringify(static_cast(value)); +} +std::string StringMaker::convert(unsigned long value) { + return ::Catch::Detail::stringify(static_cast(value)); +} +std::string StringMaker::convert(unsigned long long value) { + ReusableStringStream rss; + rss << value; + if (value > Detail::hexThreshold) { + rss << " (0x" << std::hex << value << ')'; + } + return rss.str(); +} + +std::string StringMaker::convert(bool b) { + return b ? "true" : "false"; +} + +std::string StringMaker::convert(signed char value) { + if (value == '\r') { + return "'\\r'"; + } else if (value == '\f') { + return "'\\f'"; + } else if (value == '\n') { + return "'\\n'"; + } else if (value == '\t') { + return "'\\t'"; + } else if ('\0' <= value && value < ' ') { + return ::Catch::Detail::stringify(static_cast(value)); + } else { + char chstr[] = "' '"; + chstr[1] = value; + return chstr; + } +} +std::string StringMaker::convert(char c) { + return ::Catch::Detail::stringify(static_cast(c)); +} +std::string StringMaker::convert(unsigned char c) { + return ::Catch::Detail::stringify(static_cast(c)); +} + +std::string StringMaker::convert(std::nullptr_t) { + return "nullptr"; +} + +std::string StringMaker::convert(float value) { + return fpToString(value, 5) + 'f'; +} +std::string StringMaker::convert(double value) { + return fpToString(value, 10); +} + +std::string ratio_string::symbol() { return "a"; } +std::string ratio_string::symbol() { return "f"; } +std::string ratio_string::symbol() { return "p"; } +std::string ratio_string::symbol() { return "n"; } +std::string ratio_string::symbol() { return "u"; } +std::string ratio_string::symbol() { return "m"; } + +} // end namespace Catch + +#if defined(__clang__) +# pragma clang diagnostic pop +#endif + +// end catch_tostring.cpp +// start catch_totals.cpp + +namespace Catch { + + Counts Counts::operator - ( Counts const& other ) const { + Counts diff; + diff.passed = passed - other.passed; + diff.failed = failed - other.failed; + diff.failedButOk = failedButOk - other.failedButOk; + return diff; + } + + Counts& Counts::operator += ( Counts const& other ) { + passed += other.passed; + failed += other.failed; + failedButOk += other.failedButOk; + return *this; + } + + std::size_t Counts::total() const { + return passed + failed + failedButOk; + } + bool Counts::allPassed() const { + return failed == 0 && failedButOk == 0; + } + bool Counts::allOk() const { + return failed == 0; + } + + Totals Totals::operator - ( Totals const& other ) const { + Totals diff; + diff.assertions = assertions - other.assertions; + diff.testCases = testCases - other.testCases; + return diff; + } + + Totals& Totals::operator += ( Totals const& other ) { + assertions += other.assertions; + testCases += other.testCases; + return *this; + } + + Totals Totals::delta( Totals const& prevTotals ) const { + Totals diff = *this - prevTotals; + if( diff.assertions.failed > 0 ) + ++diff.testCases.failed; + else if( diff.assertions.failedButOk > 0 ) + ++diff.testCases.failedButOk; + else + ++diff.testCases.passed; + return diff; + } + +} +// end catch_totals.cpp +// start catch_uncaught_exceptions.cpp + +#include + +namespace Catch { + bool uncaught_exceptions() { +#if defined(CATCH_CONFIG_CPP17_UNCAUGHT_EXCEPTIONS) + return std::uncaught_exceptions() > 0; +#else + return std::uncaught_exception(); +#endif + } +} // end namespace Catch +// end catch_uncaught_exceptions.cpp +// start catch_version.cpp + +#include + +namespace Catch { + + Version::Version + ( unsigned int _majorVersion, + unsigned int _minorVersion, + unsigned int _patchNumber, + char const * const _branchName, + unsigned int _buildNumber ) + : majorVersion( _majorVersion ), + minorVersion( _minorVersion ), + patchNumber( _patchNumber ), + branchName( _branchName ), + buildNumber( _buildNumber ) + {} + + std::ostream& operator << ( std::ostream& os, Version const& version ) { + os << version.majorVersion << '.' + << version.minorVersion << '.' + << version.patchNumber; + // branchName is never null -> 0th char is \0 if it is empty + if (version.branchName[0]) { + os << '-' << version.branchName + << '.' << version.buildNumber; + } + return os; + } + + Version const& libraryVersion() { + static Version version( 2, 7, 0, "", 0 ); + return version; + } + +} +// end catch_version.cpp +// start catch_wildcard_pattern.cpp + +#include + +namespace Catch { + + WildcardPattern::WildcardPattern( std::string const& pattern, + CaseSensitive::Choice caseSensitivity ) + : m_caseSensitivity( caseSensitivity ), + m_pattern( adjustCase( pattern ) ) + { + if( startsWith( m_pattern, '*' ) ) { + m_pattern = m_pattern.substr( 1 ); + m_wildcard = WildcardAtStart; + } + if( endsWith( m_pattern, '*' ) ) { + m_pattern = m_pattern.substr( 0, m_pattern.size()-1 ); + m_wildcard = static_cast( m_wildcard | WildcardAtEnd ); + } + } + + bool WildcardPattern::matches( std::string const& str ) const { + switch( m_wildcard ) { + case NoWildcard: + return m_pattern == adjustCase( str ); + case WildcardAtStart: + return endsWith( adjustCase( str ), m_pattern ); + case WildcardAtEnd: + return startsWith( adjustCase( str ), m_pattern ); + case WildcardAtBothEnds: + return contains( adjustCase( str ), m_pattern ); + default: + CATCH_INTERNAL_ERROR( "Unknown enum" ); + } + } + + std::string WildcardPattern::adjustCase( std::string const& str ) const { + return m_caseSensitivity == CaseSensitive::No ? toLower( str ) : str; + } +} +// end catch_wildcard_pattern.cpp +// start catch_xmlwriter.cpp + +#include + +using uchar = unsigned char; + +namespace Catch { + +namespace { + + size_t trailingBytes(unsigned char c) { + if ((c & 0xE0) == 0xC0) { + return 2; + } + if ((c & 0xF0) == 0xE0) { + return 3; + } + if ((c & 0xF8) == 0xF0) { + return 4; + } + CATCH_INTERNAL_ERROR("Invalid multibyte utf-8 start byte encountered"); + } + + uint32_t headerValue(unsigned char c) { + if ((c & 0xE0) == 0xC0) { + return c & 0x1F; + } + if ((c & 0xF0) == 0xE0) { + return c & 0x0F; + } + if ((c & 0xF8) == 0xF0) { + return c & 0x07; + } + CATCH_INTERNAL_ERROR("Invalid multibyte utf-8 start byte encountered"); + } + + void hexEscapeChar(std::ostream& os, unsigned char c) { + std::ios_base::fmtflags f(os.flags()); + os << "\\x" + << std::uppercase << std::hex << std::setfill('0') << std::setw(2) + << static_cast(c); + os.flags(f); + } + +} // anonymous namespace + + XmlEncode::XmlEncode( std::string const& str, ForWhat forWhat ) + : m_str( str ), + m_forWhat( forWhat ) + {} + + void XmlEncode::encodeTo( std::ostream& os ) const { + // Apostrophe escaping not necessary if we always use " to write attributes + // (see: http://www.w3.org/TR/xml/#syntax) + + for( std::size_t idx = 0; idx < m_str.size(); ++ idx ) { + uchar c = m_str[idx]; + switch (c) { + case '<': os << "<"; break; + case '&': os << "&"; break; + + case '>': + // See: http://www.w3.org/TR/xml/#syntax + if (idx > 2 && m_str[idx - 1] == ']' && m_str[idx - 2] == ']') + os << ">"; + else + os << c; + break; + + case '\"': + if (m_forWhat == ForAttributes) + os << """; + else + os << c; + break; + + default: + // Check for control characters and invalid utf-8 + + // Escape control characters in standard ascii + // see http://stackoverflow.com/questions/404107/why-are-control-characters-illegal-in-xml-1-0 + if (c < 0x09 || (c > 0x0D && c < 0x20) || c == 0x7F) { + hexEscapeChar(os, c); + break; + } + + // Plain ASCII: Write it to stream + if (c < 0x7F) { + os << c; + break; + } + + // UTF-8 territory + // Check if the encoding is valid and if it is not, hex escape bytes. + // Important: We do not check the exact decoded values for validity, only the encoding format + // First check that this bytes is a valid lead byte: + // This means that it is not encoded as 1111 1XXX + // Or as 10XX XXXX + if (c < 0xC0 || + c >= 0xF8) { + hexEscapeChar(os, c); + break; + } + + auto encBytes = trailingBytes(c); + // Are there enough bytes left to avoid accessing out-of-bounds memory? + if (idx + encBytes - 1 >= m_str.size()) { + hexEscapeChar(os, c); + break; + } + // The header is valid, check data + // The next encBytes bytes must together be a valid utf-8 + // This means: bitpattern 10XX XXXX and the extracted value is sane (ish) + bool valid = true; + uint32_t value = headerValue(c); + for (std::size_t n = 1; n < encBytes; ++n) { + uchar nc = m_str[idx + n]; + valid &= ((nc & 0xC0) == 0x80); + value = (value << 6) | (nc & 0x3F); + } + + if ( + // Wrong bit pattern of following bytes + (!valid) || + // Overlong encodings + (value < 0x80) || + (0x80 <= value && value < 0x800 && encBytes > 2) || + (0x800 < value && value < 0x10000 && encBytes > 3) || + // Encoded value out of range + (value >= 0x110000) + ) { + hexEscapeChar(os, c); + break; + } + + // If we got here, this is in fact a valid(ish) utf-8 sequence + for (std::size_t n = 0; n < encBytes; ++n) { + os << m_str[idx + n]; + } + idx += encBytes - 1; + break; + } + } + } + + std::ostream& operator << ( std::ostream& os, XmlEncode const& xmlEncode ) { + xmlEncode.encodeTo( os ); + return os; + } + + XmlWriter::ScopedElement::ScopedElement( XmlWriter* writer ) + : m_writer( writer ) + {} + + XmlWriter::ScopedElement::ScopedElement( ScopedElement&& other ) noexcept + : m_writer( other.m_writer ){ + other.m_writer = nullptr; + } + XmlWriter::ScopedElement& XmlWriter::ScopedElement::operator=( ScopedElement&& other ) noexcept { + if ( m_writer ) { + m_writer->endElement(); + } + m_writer = other.m_writer; + other.m_writer = nullptr; + return *this; + } + + XmlWriter::ScopedElement::~ScopedElement() { + if( m_writer ) + m_writer->endElement(); + } + + XmlWriter::ScopedElement& XmlWriter::ScopedElement::writeText( std::string const& text, bool indent ) { + m_writer->writeText( text, indent ); + return *this; + } + + XmlWriter::XmlWriter( std::ostream& os ) : m_os( os ) + { + writeDeclaration(); + } + + XmlWriter::~XmlWriter() { + while( !m_tags.empty() ) + endElement(); + } + + XmlWriter& XmlWriter::startElement( std::string const& name ) { + ensureTagClosed(); + newlineIfNecessary(); + m_os << m_indent << '<' << name; + m_tags.push_back( name ); + m_indent += " "; + m_tagIsOpen = true; + return *this; + } + + XmlWriter::ScopedElement XmlWriter::scopedElement( std::string const& name ) { + ScopedElement scoped( this ); + startElement( name ); + return scoped; + } + + XmlWriter& XmlWriter::endElement() { + newlineIfNecessary(); + m_indent = m_indent.substr( 0, m_indent.size()-2 ); + if( m_tagIsOpen ) { + m_os << "/>"; + m_tagIsOpen = false; + } + else { + m_os << m_indent << ""; + } + m_os << std::endl; + m_tags.pop_back(); + return *this; + } + + XmlWriter& XmlWriter::writeAttribute( std::string const& name, std::string const& attribute ) { + if( !name.empty() && !attribute.empty() ) + m_os << ' ' << name << "=\"" << XmlEncode( attribute, XmlEncode::ForAttributes ) << '"'; + return *this; + } + + XmlWriter& XmlWriter::writeAttribute( std::string const& name, bool attribute ) { + m_os << ' ' << name << "=\"" << ( attribute ? "true" : "false" ) << '"'; + return *this; + } + + XmlWriter& XmlWriter::writeText( std::string const& text, bool indent ) { + if( !text.empty() ){ + bool tagWasOpen = m_tagIsOpen; + ensureTagClosed(); + if( tagWasOpen && indent ) + m_os << m_indent; + m_os << XmlEncode( text ); + m_needsNewline = true; + } + return *this; + } + + XmlWriter& XmlWriter::writeComment( std::string const& text ) { + ensureTagClosed(); + m_os << m_indent << ""; + m_needsNewline = true; + return *this; + } + + void XmlWriter::writeStylesheetRef( std::string const& url ) { + m_os << "\n"; + } + + XmlWriter& XmlWriter::writeBlankLine() { + ensureTagClosed(); + m_os << '\n'; + return *this; + } + + void XmlWriter::ensureTagClosed() { + if( m_tagIsOpen ) { + m_os << ">" << std::endl; + m_tagIsOpen = false; + } + } + + void XmlWriter::writeDeclaration() { + m_os << "\n"; + } + + void XmlWriter::newlineIfNecessary() { + if( m_needsNewline ) { + m_os << std::endl; + m_needsNewline = false; + } + } +} +// end catch_xmlwriter.cpp +// start catch_reporter_bases.cpp + +#include +#include +#include +#include +#include + +namespace Catch { + void prepareExpandedExpression(AssertionResult& result) { + result.getExpandedExpression(); + } + + // Because formatting using c++ streams is stateful, drop down to C is required + // Alternatively we could use stringstream, but its performance is... not good. + std::string getFormattedDuration( double duration ) { + // Max exponent + 1 is required to represent the whole part + // + 1 for decimal point + // + 3 for the 3 decimal places + // + 1 for null terminator + const std::size_t maxDoubleSize = DBL_MAX_10_EXP + 1 + 1 + 3 + 1; + char buffer[maxDoubleSize]; + + // Save previous errno, to prevent sprintf from overwriting it + ErrnoGuard guard; +#ifdef _MSC_VER + sprintf_s(buffer, "%.3f", duration); +#else + std::sprintf(buffer, "%.3f", duration); +#endif + return std::string(buffer); + } + + TestEventListenerBase::TestEventListenerBase(ReporterConfig const & _config) + :StreamingReporterBase(_config) {} + + std::set TestEventListenerBase::getSupportedVerbosities() { + return { Verbosity::Quiet, Verbosity::Normal, Verbosity::High }; + } + + void TestEventListenerBase::assertionStarting(AssertionInfo const &) {} + + bool TestEventListenerBase::assertionEnded(AssertionStats const &) { + return false; + } + +} // end namespace Catch +// end catch_reporter_bases.cpp +// start catch_reporter_compact.cpp + +namespace { + +#ifdef CATCH_PLATFORM_MAC + const char* failedString() { return "FAILED"; } + const char* passedString() { return "PASSED"; } +#else + const char* failedString() { return "failed"; } + const char* passedString() { return "passed"; } +#endif + + // Colour::LightGrey + Catch::Colour::Code dimColour() { return Catch::Colour::FileName; } + + std::string bothOrAll( std::size_t count ) { + return count == 1 ? std::string() : + count == 2 ? "both " : "all " ; + } + +} // anon namespace + +namespace Catch { +namespace { +// Colour, message variants: +// - white: No tests ran. +// - red: Failed [both/all] N test cases, failed [both/all] M assertions. +// - white: Passed [both/all] N test cases (no assertions). +// - red: Failed N tests cases, failed M assertions. +// - green: Passed [both/all] N tests cases with M assertions. +void printTotals(std::ostream& out, const Totals& totals) { + if (totals.testCases.total() == 0) { + out << "No tests ran."; + } else if (totals.testCases.failed == totals.testCases.total()) { + Colour colour(Colour::ResultError); + const std::string qualify_assertions_failed = + totals.assertions.failed == totals.assertions.total() ? + bothOrAll(totals.assertions.failed) : std::string(); + out << + "Failed " << bothOrAll(totals.testCases.failed) + << pluralise(totals.testCases.failed, "test case") << ", " + "failed " << qualify_assertions_failed << + pluralise(totals.assertions.failed, "assertion") << '.'; + } else if (totals.assertions.total() == 0) { + out << + "Passed " << bothOrAll(totals.testCases.total()) + << pluralise(totals.testCases.total(), "test case") + << " (no assertions)."; + } else if (totals.assertions.failed) { + Colour colour(Colour::ResultError); + out << + "Failed " << pluralise(totals.testCases.failed, "test case") << ", " + "failed " << pluralise(totals.assertions.failed, "assertion") << '.'; + } else { + Colour colour(Colour::ResultSuccess); + out << + "Passed " << bothOrAll(totals.testCases.passed) + << pluralise(totals.testCases.passed, "test case") << + " with " << pluralise(totals.assertions.passed, "assertion") << '.'; + } +} + +// Implementation of CompactReporter formatting +class AssertionPrinter { +public: + AssertionPrinter& operator= (AssertionPrinter const&) = delete; + AssertionPrinter(AssertionPrinter const&) = delete; + AssertionPrinter(std::ostream& _stream, AssertionStats const& _stats, bool _printInfoMessages) + : stream(_stream) + , result(_stats.assertionResult) + , messages(_stats.infoMessages) + , itMessage(_stats.infoMessages.begin()) + , printInfoMessages(_printInfoMessages) {} + + void print() { + printSourceInfo(); + + itMessage = messages.begin(); + + switch (result.getResultType()) { + case ResultWas::Ok: + printResultType(Colour::ResultSuccess, passedString()); + printOriginalExpression(); + printReconstructedExpression(); + if (!result.hasExpression()) + printRemainingMessages(Colour::None); + else + printRemainingMessages(); + break; + case ResultWas::ExpressionFailed: + if (result.isOk()) + printResultType(Colour::ResultSuccess, failedString() + std::string(" - but was ok")); + else + printResultType(Colour::Error, failedString()); + printOriginalExpression(); + printReconstructedExpression(); + printRemainingMessages(); + break; + case ResultWas::ThrewException: + printResultType(Colour::Error, failedString()); + printIssue("unexpected exception with message:"); + printMessage(); + printExpressionWas(); + printRemainingMessages(); + break; + case ResultWas::FatalErrorCondition: + printResultType(Colour::Error, failedString()); + printIssue("fatal error condition with message:"); + printMessage(); + printExpressionWas(); + printRemainingMessages(); + break; + case ResultWas::DidntThrowException: + printResultType(Colour::Error, failedString()); + printIssue("expected exception, got none"); + printExpressionWas(); + printRemainingMessages(); + break; + case ResultWas::Info: + printResultType(Colour::None, "info"); + printMessage(); + printRemainingMessages(); + break; + case ResultWas::Warning: + printResultType(Colour::None, "warning"); + printMessage(); + printRemainingMessages(); + break; + case ResultWas::ExplicitFailure: + printResultType(Colour::Error, failedString()); + printIssue("explicitly"); + printRemainingMessages(Colour::None); + break; + // These cases are here to prevent compiler warnings + case ResultWas::Unknown: + case ResultWas::FailureBit: + case ResultWas::Exception: + printResultType(Colour::Error, "** internal error **"); + break; + } + } + +private: + void printSourceInfo() const { + Colour colourGuard(Colour::FileName); + stream << result.getSourceInfo() << ':'; + } + + void printResultType(Colour::Code colour, std::string const& passOrFail) const { + if (!passOrFail.empty()) { + { + Colour colourGuard(colour); + stream << ' ' << passOrFail; + } + stream << ':'; + } + } + + void printIssue(std::string const& issue) const { + stream << ' ' << issue; + } + + void printExpressionWas() { + if (result.hasExpression()) { + stream << ';'; + { + Colour colour(dimColour()); + stream << " expression was:"; + } + printOriginalExpression(); + } + } + + void printOriginalExpression() const { + if (result.hasExpression()) { + stream << ' ' << result.getExpression(); + } + } + + void printReconstructedExpression() const { + if (result.hasExpandedExpression()) { + { + Colour colour(dimColour()); + stream << " for: "; + } + stream << result.getExpandedExpression(); + } + } + + void printMessage() { + if (itMessage != messages.end()) { + stream << " '" << itMessage->message << '\''; + ++itMessage; + } + } + + void printRemainingMessages(Colour::Code colour = dimColour()) { + if (itMessage == messages.end()) + return; + + // using messages.end() directly yields (or auto) compilation error: + std::vector::const_iterator itEnd = messages.end(); + const std::size_t N = static_cast(std::distance(itMessage, itEnd)); + + { + Colour colourGuard(colour); + stream << " with " << pluralise(N, "message") << ':'; + } + + for (; itMessage != itEnd; ) { + // If this assertion is a warning ignore any INFO messages + if (printInfoMessages || itMessage->type != ResultWas::Info) { + stream << " '" << itMessage->message << '\''; + if (++itMessage != itEnd) { + Colour colourGuard(dimColour()); + stream << " and"; + } + } + } + } + +private: + std::ostream& stream; + AssertionResult const& result; + std::vector messages; + std::vector::const_iterator itMessage; + bool printInfoMessages; +}; + +} // anon namespace + + std::string CompactReporter::getDescription() { + return "Reports test results on a single line, suitable for IDEs"; + } + + ReporterPreferences CompactReporter::getPreferences() const { + return m_reporterPrefs; + } + + void CompactReporter::noMatchingTestCases( std::string const& spec ) { + stream << "No test cases matched '" << spec << '\'' << std::endl; + } + + void CompactReporter::assertionStarting( AssertionInfo const& ) {} + + bool CompactReporter::assertionEnded( AssertionStats const& _assertionStats ) { + AssertionResult const& result = _assertionStats.assertionResult; + + bool printInfoMessages = true; + + // Drop out if result was successful and we're not printing those + if( !m_config->includeSuccessfulResults() && result.isOk() ) { + if( result.getResultType() != ResultWas::Warning ) + return false; + printInfoMessages = false; + } + + AssertionPrinter printer( stream, _assertionStats, printInfoMessages ); + printer.print(); + + stream << std::endl; + return true; + } + + void CompactReporter::sectionEnded(SectionStats const& _sectionStats) { + if (m_config->showDurations() == ShowDurations::Always) { + stream << getFormattedDuration(_sectionStats.durationInSeconds) << " s: " << _sectionStats.sectionInfo.name << std::endl; + } + } + + void CompactReporter::testRunEnded( TestRunStats const& _testRunStats ) { + printTotals( stream, _testRunStats.totals ); + stream << '\n' << std::endl; + StreamingReporterBase::testRunEnded( _testRunStats ); + } + + CompactReporter::~CompactReporter() {} + + CATCH_REGISTER_REPORTER( "compact", CompactReporter ) + +} // end namespace Catch +// end catch_reporter_compact.cpp +// start catch_reporter_console.cpp + +#include +#include + +#if defined(_MSC_VER) +#pragma warning(push) +#pragma warning(disable:4061) // Not all labels are EXPLICITLY handled in switch + // Note that 4062 (not all labels are handled + // and default is missing) is enabled +#endif + +namespace Catch { + +namespace { + +// Formatter impl for ConsoleReporter +class ConsoleAssertionPrinter { +public: + ConsoleAssertionPrinter& operator= (ConsoleAssertionPrinter const&) = delete; + ConsoleAssertionPrinter(ConsoleAssertionPrinter const&) = delete; + ConsoleAssertionPrinter(std::ostream& _stream, AssertionStats const& _stats, bool _printInfoMessages) + : stream(_stream), + stats(_stats), + result(_stats.assertionResult), + colour(Colour::None), + message(result.getMessage()), + messages(_stats.infoMessages), + printInfoMessages(_printInfoMessages) { + switch (result.getResultType()) { + case ResultWas::Ok: + colour = Colour::Success; + passOrFail = "PASSED"; + //if( result.hasMessage() ) + if (_stats.infoMessages.size() == 1) + messageLabel = "with message"; + if (_stats.infoMessages.size() > 1) + messageLabel = "with messages"; + break; + case ResultWas::ExpressionFailed: + if (result.isOk()) { + colour = Colour::Success; + passOrFail = "FAILED - but was ok"; + } else { + colour = Colour::Error; + passOrFail = "FAILED"; + } + if (_stats.infoMessages.size() == 1) + messageLabel = "with message"; + if (_stats.infoMessages.size() > 1) + messageLabel = "with messages"; + break; + case ResultWas::ThrewException: + colour = Colour::Error; + passOrFail = "FAILED"; + messageLabel = "due to unexpected exception with "; + if (_stats.infoMessages.size() == 1) + messageLabel += "message"; + if (_stats.infoMessages.size() > 1) + messageLabel += "messages"; + break; + case ResultWas::FatalErrorCondition: + colour = Colour::Error; + passOrFail = "FAILED"; + messageLabel = "due to a fatal error condition"; + break; + case ResultWas::DidntThrowException: + colour = Colour::Error; + passOrFail = "FAILED"; + messageLabel = "because no exception was thrown where one was expected"; + break; + case ResultWas::Info: + messageLabel = "info"; + break; + case ResultWas::Warning: + messageLabel = "warning"; + break; + case ResultWas::ExplicitFailure: + passOrFail = "FAILED"; + colour = Colour::Error; + if (_stats.infoMessages.size() == 1) + messageLabel = "explicitly with message"; + if (_stats.infoMessages.size() > 1) + messageLabel = "explicitly with messages"; + break; + // These cases are here to prevent compiler warnings + case ResultWas::Unknown: + case ResultWas::FailureBit: + case ResultWas::Exception: + passOrFail = "** internal error **"; + colour = Colour::Error; + break; + } + } + + void print() const { + printSourceInfo(); + if (stats.totals.assertions.total() > 0) { + printResultType(); + printOriginalExpression(); + printReconstructedExpression(); + } else { + stream << '\n'; + } + printMessage(); + } + +private: + void printResultType() const { + if (!passOrFail.empty()) { + Colour colourGuard(colour); + stream << passOrFail << ":\n"; + } + } + void printOriginalExpression() const { + if (result.hasExpression()) { + Colour colourGuard(Colour::OriginalExpression); + stream << " "; + stream << result.getExpressionInMacro(); + stream << '\n'; + } + } + void printReconstructedExpression() const { + if (result.hasExpandedExpression()) { + stream << "with expansion:\n"; + Colour colourGuard(Colour::ReconstructedExpression); + stream << Column(result.getExpandedExpression()).indent(2) << '\n'; + } + } + void printMessage() const { + if (!messageLabel.empty()) + stream << messageLabel << ':' << '\n'; + for (auto const& msg : messages) { + // If this assertion is a warning ignore any INFO messages + if (printInfoMessages || msg.type != ResultWas::Info) + stream << Column(msg.message).indent(2) << '\n'; + } + } + void printSourceInfo() const { + Colour colourGuard(Colour::FileName); + stream << result.getSourceInfo() << ": "; + } + + std::ostream& stream; + AssertionStats const& stats; + AssertionResult const& result; + Colour::Code colour; + std::string passOrFail; + std::string messageLabel; + std::string message; + std::vector messages; + bool printInfoMessages; +}; + +std::size_t makeRatio(std::size_t number, std::size_t total) { + std::size_t ratio = total > 0 ? CATCH_CONFIG_CONSOLE_WIDTH * number / total : 0; + return (ratio == 0 && number > 0) ? 1 : ratio; +} + +std::size_t& findMax(std::size_t& i, std::size_t& j, std::size_t& k) { + if (i > j && i > k) + return i; + else if (j > k) + return j; + else + return k; +} + +struct ColumnInfo { + enum Justification { Left, Right }; + std::string name; + int width; + Justification justification; +}; +struct ColumnBreak {}; +struct RowBreak {}; + +class Duration { + enum class Unit { + Auto, + Nanoseconds, + Microseconds, + Milliseconds, + Seconds, + Minutes + }; + static const uint64_t s_nanosecondsInAMicrosecond = 1000; + static const uint64_t s_nanosecondsInAMillisecond = 1000 * s_nanosecondsInAMicrosecond; + static const uint64_t s_nanosecondsInASecond = 1000 * s_nanosecondsInAMillisecond; + static const uint64_t s_nanosecondsInAMinute = 60 * s_nanosecondsInASecond; + + uint64_t m_inNanoseconds; + Unit m_units; + +public: + explicit Duration(uint64_t inNanoseconds, Unit units = Unit::Auto) + : m_inNanoseconds(inNanoseconds), + m_units(units) { + if (m_units == Unit::Auto) { + if (m_inNanoseconds < s_nanosecondsInAMicrosecond) + m_units = Unit::Nanoseconds; + else if (m_inNanoseconds < s_nanosecondsInAMillisecond) + m_units = Unit::Microseconds; + else if (m_inNanoseconds < s_nanosecondsInASecond) + m_units = Unit::Milliseconds; + else if (m_inNanoseconds < s_nanosecondsInAMinute) + m_units = Unit::Seconds; + else + m_units = Unit::Minutes; + } + + } + + auto value() const -> double { + switch (m_units) { + case Unit::Microseconds: + return m_inNanoseconds / static_cast(s_nanosecondsInAMicrosecond); + case Unit::Milliseconds: + return m_inNanoseconds / static_cast(s_nanosecondsInAMillisecond); + case Unit::Seconds: + return m_inNanoseconds / static_cast(s_nanosecondsInASecond); + case Unit::Minutes: + return m_inNanoseconds / static_cast(s_nanosecondsInAMinute); + default: + return static_cast(m_inNanoseconds); + } + } + auto unitsAsString() const -> std::string { + switch (m_units) { + case Unit::Nanoseconds: + return "ns"; + case Unit::Microseconds: + return "us"; + case Unit::Milliseconds: + return "ms"; + case Unit::Seconds: + return "s"; + case Unit::Minutes: + return "m"; + default: + return "** internal error **"; + } + + } + friend auto operator << (std::ostream& os, Duration const& duration) -> std::ostream& { + return os << duration.value() << " " << duration.unitsAsString(); + } +}; +} // end anon namespace + +class TablePrinter { + std::ostream& m_os; + std::vector m_columnInfos; + std::ostringstream m_oss; + int m_currentColumn = -1; + bool m_isOpen = false; + +public: + TablePrinter( std::ostream& os, std::vector columnInfos ) + : m_os( os ), + m_columnInfos( std::move( columnInfos ) ) {} + + auto columnInfos() const -> std::vector const& { + return m_columnInfos; + } + + void open() { + if (!m_isOpen) { + m_isOpen = true; + *this << RowBreak(); + for (auto const& info : m_columnInfos) + *this << info.name << ColumnBreak(); + *this << RowBreak(); + m_os << Catch::getLineOfChars<'-'>() << "\n"; + } + } + void close() { + if (m_isOpen) { + *this << RowBreak(); + m_os << std::endl; + m_isOpen = false; + } + } + + template + friend TablePrinter& operator << (TablePrinter& tp, T const& value) { + tp.m_oss << value; + return tp; + } + + friend TablePrinter& operator << (TablePrinter& tp, ColumnBreak) { + auto colStr = tp.m_oss.str(); + // This takes account of utf8 encodings + auto strSize = Catch::StringRef(colStr).numberOfCharacters(); + tp.m_oss.str(""); + tp.open(); + if (tp.m_currentColumn == static_cast(tp.m_columnInfos.size() - 1)) { + tp.m_currentColumn = -1; + tp.m_os << "\n"; + } + tp.m_currentColumn++; + + auto colInfo = tp.m_columnInfos[tp.m_currentColumn]; + auto padding = (strSize + 2 < static_cast(colInfo.width)) + ? std::string(colInfo.width - (strSize + 2), ' ') + : std::string(); + if (colInfo.justification == ColumnInfo::Left) + tp.m_os << colStr << padding << " "; + else + tp.m_os << padding << colStr << " "; + return tp; + } + + friend TablePrinter& operator << (TablePrinter& tp, RowBreak) { + if (tp.m_currentColumn > 0) { + tp.m_os << "\n"; + tp.m_currentColumn = -1; + } + return tp; + } +}; + +ConsoleReporter::ConsoleReporter(ReporterConfig const& config) + : StreamingReporterBase(config), + m_tablePrinter(new TablePrinter(config.stream(), + { + { "benchmark name", CATCH_CONFIG_CONSOLE_WIDTH - 32, ColumnInfo::Left }, + { "iters", 8, ColumnInfo::Right }, + { "elapsed ns", 14, ColumnInfo::Right }, + { "average", 14, ColumnInfo::Right } + })) {} +ConsoleReporter::~ConsoleReporter() = default; + +std::string ConsoleReporter::getDescription() { + return "Reports test results as plain lines of text"; +} + +void ConsoleReporter::noMatchingTestCases(std::string const& spec) { + stream << "No test cases matched '" << spec << '\'' << std::endl; +} + +void ConsoleReporter::assertionStarting(AssertionInfo const&) {} + +bool ConsoleReporter::assertionEnded(AssertionStats const& _assertionStats) { + AssertionResult const& result = _assertionStats.assertionResult; + + bool includeResults = m_config->includeSuccessfulResults() || !result.isOk(); + + // Drop out if result was successful but we're not printing them. + if (!includeResults && result.getResultType() != ResultWas::Warning) + return false; + + lazyPrint(); + + ConsoleAssertionPrinter printer(stream, _assertionStats, includeResults); + printer.print(); + stream << std::endl; + return true; +} + +void ConsoleReporter::sectionStarting(SectionInfo const& _sectionInfo) { + m_headerPrinted = false; + StreamingReporterBase::sectionStarting(_sectionInfo); +} +void ConsoleReporter::sectionEnded(SectionStats const& _sectionStats) { + m_tablePrinter->close(); + if (_sectionStats.missingAssertions) { + lazyPrint(); + Colour colour(Colour::ResultError); + if (m_sectionStack.size() > 1) + stream << "\nNo assertions in section"; + else + stream << "\nNo assertions in test case"; + stream << " '" << _sectionStats.sectionInfo.name << "'\n" << std::endl; + } + if (m_config->showDurations() == ShowDurations::Always) { + stream << getFormattedDuration(_sectionStats.durationInSeconds) << " s: " << _sectionStats.sectionInfo.name << std::endl; + } + if (m_headerPrinted) { + m_headerPrinted = false; + } + StreamingReporterBase::sectionEnded(_sectionStats); +} + +void ConsoleReporter::benchmarkStarting(BenchmarkInfo const& info) { + lazyPrintWithoutClosingBenchmarkTable(); + + auto nameCol = Column( info.name ).width( static_cast( m_tablePrinter->columnInfos()[0].width - 2 ) ); + + bool firstLine = true; + for (auto line : nameCol) { + if (!firstLine) + (*m_tablePrinter) << ColumnBreak() << ColumnBreak() << ColumnBreak(); + else + firstLine = false; + + (*m_tablePrinter) << line << ColumnBreak(); + } +} +void ConsoleReporter::benchmarkEnded(BenchmarkStats const& stats) { + Duration average(stats.elapsedTimeInNanoseconds / stats.iterations); + (*m_tablePrinter) + << stats.iterations << ColumnBreak() + << stats.elapsedTimeInNanoseconds << ColumnBreak() + << average << ColumnBreak(); +} + +void ConsoleReporter::testCaseEnded(TestCaseStats const& _testCaseStats) { + m_tablePrinter->close(); + StreamingReporterBase::testCaseEnded(_testCaseStats); + m_headerPrinted = false; +} +void ConsoleReporter::testGroupEnded(TestGroupStats const& _testGroupStats) { + if (currentGroupInfo.used) { + printSummaryDivider(); + stream << "Summary for group '" << _testGroupStats.groupInfo.name << "':\n"; + printTotals(_testGroupStats.totals); + stream << '\n' << std::endl; + } + StreamingReporterBase::testGroupEnded(_testGroupStats); +} +void ConsoleReporter::testRunEnded(TestRunStats const& _testRunStats) { + printTotalsDivider(_testRunStats.totals); + printTotals(_testRunStats.totals); + stream << std::endl; + StreamingReporterBase::testRunEnded(_testRunStats); +} + +void ConsoleReporter::lazyPrint() { + + m_tablePrinter->close(); + lazyPrintWithoutClosingBenchmarkTable(); +} + +void ConsoleReporter::lazyPrintWithoutClosingBenchmarkTable() { + + if (!currentTestRunInfo.used) + lazyPrintRunInfo(); + if (!currentGroupInfo.used) + lazyPrintGroupInfo(); + + if (!m_headerPrinted) { + printTestCaseAndSectionHeader(); + m_headerPrinted = true; + } +} +void ConsoleReporter::lazyPrintRunInfo() { + stream << '\n' << getLineOfChars<'~'>() << '\n'; + Colour colour(Colour::SecondaryText); + stream << currentTestRunInfo->name + << " is a Catch v" << libraryVersion() << " host application.\n" + << "Run with -? for options\n\n"; + + if (m_config->rngSeed() != 0) + stream << "Randomness seeded to: " << m_config->rngSeed() << "\n\n"; + + currentTestRunInfo.used = true; +} +void ConsoleReporter::lazyPrintGroupInfo() { + if (!currentGroupInfo->name.empty() && currentGroupInfo->groupsCounts > 1) { + printClosedHeader("Group: " + currentGroupInfo->name); + currentGroupInfo.used = true; + } +} +void ConsoleReporter::printTestCaseAndSectionHeader() { + assert(!m_sectionStack.empty()); + printOpenHeader(currentTestCaseInfo->name); + + if (m_sectionStack.size() > 1) { + Colour colourGuard(Colour::Headers); + + auto + it = m_sectionStack.begin() + 1, // Skip first section (test case) + itEnd = m_sectionStack.end(); + for (; it != itEnd; ++it) + printHeaderString(it->name, 2); + } + + SourceLineInfo lineInfo = m_sectionStack.back().lineInfo; + + if (!lineInfo.empty()) { + stream << getLineOfChars<'-'>() << '\n'; + Colour colourGuard(Colour::FileName); + stream << lineInfo << '\n'; + } + stream << getLineOfChars<'.'>() << '\n' << std::endl; +} + +void ConsoleReporter::printClosedHeader(std::string const& _name) { + printOpenHeader(_name); + stream << getLineOfChars<'.'>() << '\n'; +} +void ConsoleReporter::printOpenHeader(std::string const& _name) { + stream << getLineOfChars<'-'>() << '\n'; + { + Colour colourGuard(Colour::Headers); + printHeaderString(_name); + } +} + +// if string has a : in first line will set indent to follow it on +// subsequent lines +void ConsoleReporter::printHeaderString(std::string const& _string, std::size_t indent) { + std::size_t i = _string.find(": "); + if (i != std::string::npos) + i += 2; + else + i = 0; + stream << Column(_string).indent(indent + i).initialIndent(indent) << '\n'; +} + +struct SummaryColumn { + + SummaryColumn( std::string _label, Colour::Code _colour ) + : label( std::move( _label ) ), + colour( _colour ) {} + SummaryColumn addRow( std::size_t count ) { + ReusableStringStream rss; + rss << count; + std::string row = rss.str(); + for (auto& oldRow : rows) { + while (oldRow.size() < row.size()) + oldRow = ' ' + oldRow; + while (oldRow.size() > row.size()) + row = ' ' + row; + } + rows.push_back(row); + return *this; + } + + std::string label; + Colour::Code colour; + std::vector rows; + +}; + +void ConsoleReporter::printTotals( Totals const& totals ) { + if (totals.testCases.total() == 0) { + stream << Colour(Colour::Warning) << "No tests ran\n"; + } else if (totals.assertions.total() > 0 && totals.testCases.allPassed()) { + stream << Colour(Colour::ResultSuccess) << "All tests passed"; + stream << " (" + << pluralise(totals.assertions.passed, "assertion") << " in " + << pluralise(totals.testCases.passed, "test case") << ')' + << '\n'; + } else { + + std::vector columns; + columns.push_back(SummaryColumn("", Colour::None) + .addRow(totals.testCases.total()) + .addRow(totals.assertions.total())); + columns.push_back(SummaryColumn("passed", Colour::Success) + .addRow(totals.testCases.passed) + .addRow(totals.assertions.passed)); + columns.push_back(SummaryColumn("failed", Colour::ResultError) + .addRow(totals.testCases.failed) + .addRow(totals.assertions.failed)); + columns.push_back(SummaryColumn("failed as expected", Colour::ResultExpectedFailure) + .addRow(totals.testCases.failedButOk) + .addRow(totals.assertions.failedButOk)); + + printSummaryRow("test cases", columns, 0); + printSummaryRow("assertions", columns, 1); + } +} +void ConsoleReporter::printSummaryRow(std::string const& label, std::vector const& cols, std::size_t row) { + for (auto col : cols) { + std::string value = col.rows[row]; + if (col.label.empty()) { + stream << label << ": "; + if (value != "0") + stream << value; + else + stream << Colour(Colour::Warning) << "- none -"; + } else if (value != "0") { + stream << Colour(Colour::LightGrey) << " | "; + stream << Colour(col.colour) + << value << ' ' << col.label; + } + } + stream << '\n'; +} + +void ConsoleReporter::printTotalsDivider(Totals const& totals) { + if (totals.testCases.total() > 0) { + std::size_t failedRatio = makeRatio(totals.testCases.failed, totals.testCases.total()); + std::size_t failedButOkRatio = makeRatio(totals.testCases.failedButOk, totals.testCases.total()); + std::size_t passedRatio = makeRatio(totals.testCases.passed, totals.testCases.total()); + while (failedRatio + failedButOkRatio + passedRatio < CATCH_CONFIG_CONSOLE_WIDTH - 1) + findMax(failedRatio, failedButOkRatio, passedRatio)++; + while (failedRatio + failedButOkRatio + passedRatio > CATCH_CONFIG_CONSOLE_WIDTH - 1) + findMax(failedRatio, failedButOkRatio, passedRatio)--; + + stream << Colour(Colour::Error) << std::string(failedRatio, '='); + stream << Colour(Colour::ResultExpectedFailure) << std::string(failedButOkRatio, '='); + if (totals.testCases.allPassed()) + stream << Colour(Colour::ResultSuccess) << std::string(passedRatio, '='); + else + stream << Colour(Colour::Success) << std::string(passedRatio, '='); + } else { + stream << Colour(Colour::Warning) << std::string(CATCH_CONFIG_CONSOLE_WIDTH - 1, '='); + } + stream << '\n'; +} +void ConsoleReporter::printSummaryDivider() { + stream << getLineOfChars<'-'>() << '\n'; +} + +CATCH_REGISTER_REPORTER("console", ConsoleReporter) + +} // end namespace Catch + +#if defined(_MSC_VER) +#pragma warning(pop) +#endif +// end catch_reporter_console.cpp +// start catch_reporter_junit.cpp + +#include +#include +#include +#include + +namespace Catch { + + namespace { + std::string getCurrentTimestamp() { + // Beware, this is not reentrant because of backward compatibility issues + // Also, UTC only, again because of backward compatibility (%z is C++11) + time_t rawtime; + std::time(&rawtime); + auto const timeStampSize = sizeof("2017-01-16T17:06:45Z"); + +#ifdef _MSC_VER + std::tm timeInfo = {}; + gmtime_s(&timeInfo, &rawtime); +#else + std::tm* timeInfo; + timeInfo = std::gmtime(&rawtime); +#endif + + char timeStamp[timeStampSize]; + const char * const fmt = "%Y-%m-%dT%H:%M:%SZ"; + +#ifdef _MSC_VER + std::strftime(timeStamp, timeStampSize, fmt, &timeInfo); +#else + std::strftime(timeStamp, timeStampSize, fmt, timeInfo); +#endif + return std::string(timeStamp); + } + + std::string fileNameTag(const std::vector &tags) { + auto it = std::find_if(begin(tags), + end(tags), + [] (std::string const& tag) {return tag.front() == '#'; }); + if (it != tags.end()) + return it->substr(1); + return std::string(); + } + } // anonymous namespace + + JunitReporter::JunitReporter( ReporterConfig const& _config ) + : CumulativeReporterBase( _config ), + xml( _config.stream() ) + { + m_reporterPrefs.shouldRedirectStdOut = true; + m_reporterPrefs.shouldReportAllAssertions = true; + } + + JunitReporter::~JunitReporter() {} + + std::string JunitReporter::getDescription() { + return "Reports test results in an XML format that looks like Ant's junitreport target"; + } + + void JunitReporter::noMatchingTestCases( std::string const& /*spec*/ ) {} + + void JunitReporter::testRunStarting( TestRunInfo const& runInfo ) { + CumulativeReporterBase::testRunStarting( runInfo ); + xml.startElement( "testsuites" ); + if( m_config->rngSeed() != 0 ) { + xml.startElement( "properties" ); + xml.scopedElement( "property" ) + .writeAttribute( "name", "random-seed" ) + .writeAttribute( "value", m_config->rngSeed() ); + xml.endElement(); + } + } + + void JunitReporter::testGroupStarting( GroupInfo const& groupInfo ) { + suiteTimer.start(); + stdOutForSuite.clear(); + stdErrForSuite.clear(); + unexpectedExceptions = 0; + CumulativeReporterBase::testGroupStarting( groupInfo ); + } + + void JunitReporter::testCaseStarting( TestCaseInfo const& testCaseInfo ) { + m_okToFail = testCaseInfo.okToFail(); + } + + bool JunitReporter::assertionEnded( AssertionStats const& assertionStats ) { + if( assertionStats.assertionResult.getResultType() == ResultWas::ThrewException && !m_okToFail ) + unexpectedExceptions++; + return CumulativeReporterBase::assertionEnded( assertionStats ); + } + + void JunitReporter::testCaseEnded( TestCaseStats const& testCaseStats ) { + stdOutForSuite += testCaseStats.stdOut; + stdErrForSuite += testCaseStats.stdErr; + CumulativeReporterBase::testCaseEnded( testCaseStats ); + } + + void JunitReporter::testGroupEnded( TestGroupStats const& testGroupStats ) { + double suiteTime = suiteTimer.getElapsedSeconds(); + CumulativeReporterBase::testGroupEnded( testGroupStats ); + writeGroup( *m_testGroups.back(), suiteTime ); + } + + void JunitReporter::testRunEndedCumulative() { + xml.endElement(); + } + + void JunitReporter::writeGroup( TestGroupNode const& groupNode, double suiteTime ) { + XmlWriter::ScopedElement e = xml.scopedElement( "testsuite" ); + TestGroupStats const& stats = groupNode.value; + xml.writeAttribute( "name", stats.groupInfo.name ); + xml.writeAttribute( "errors", unexpectedExceptions ); + xml.writeAttribute( "failures", stats.totals.assertions.failed-unexpectedExceptions ); + xml.writeAttribute( "tests", stats.totals.assertions.total() ); + xml.writeAttribute( "hostname", "tbd" ); // !TBD + if( m_config->showDurations() == ShowDurations::Never ) + xml.writeAttribute( "time", "" ); + else + xml.writeAttribute( "time", suiteTime ); + xml.writeAttribute( "timestamp", getCurrentTimestamp() ); + + // Write test cases + for( auto const& child : groupNode.children ) + writeTestCase( *child ); + + xml.scopedElement( "system-out" ).writeText( trim( stdOutForSuite ), false ); + xml.scopedElement( "system-err" ).writeText( trim( stdErrForSuite ), false ); + } + + void JunitReporter::writeTestCase( TestCaseNode const& testCaseNode ) { + TestCaseStats const& stats = testCaseNode.value; + + // All test cases have exactly one section - which represents the + // test case itself. That section may have 0-n nested sections + assert( testCaseNode.children.size() == 1 ); + SectionNode const& rootSection = *testCaseNode.children.front(); + + std::string className = stats.testInfo.className; + + if( className.empty() ) { + className = fileNameTag(stats.testInfo.tags); + if ( className.empty() ) + className = "global"; + } + + if ( !m_config->name().empty() ) + className = m_config->name() + "." + className; + + writeSection( className, "", rootSection ); + } + + void JunitReporter::writeSection( std::string const& className, + std::string const& rootName, + SectionNode const& sectionNode ) { + std::string name = trim( sectionNode.stats.sectionInfo.name ); + if( !rootName.empty() ) + name = rootName + '/' + name; + + if( !sectionNode.assertions.empty() || + !sectionNode.stdOut.empty() || + !sectionNode.stdErr.empty() ) { + XmlWriter::ScopedElement e = xml.scopedElement( "testcase" ); + if( className.empty() ) { + xml.writeAttribute( "classname", name ); + xml.writeAttribute( "name", "root" ); + } + else { + xml.writeAttribute( "classname", className ); + xml.writeAttribute( "name", name ); + } + xml.writeAttribute( "time", ::Catch::Detail::stringify( sectionNode.stats.durationInSeconds ) ); + + writeAssertions( sectionNode ); + + if( !sectionNode.stdOut.empty() ) + xml.scopedElement( "system-out" ).writeText( trim( sectionNode.stdOut ), false ); + if( !sectionNode.stdErr.empty() ) + xml.scopedElement( "system-err" ).writeText( trim( sectionNode.stdErr ), false ); + } + for( auto const& childNode : sectionNode.childSections ) + if( className.empty() ) + writeSection( name, "", *childNode ); + else + writeSection( className, name, *childNode ); + } + + void JunitReporter::writeAssertions( SectionNode const& sectionNode ) { + for( auto const& assertion : sectionNode.assertions ) + writeAssertion( assertion ); + } + + void JunitReporter::writeAssertion( AssertionStats const& stats ) { + AssertionResult const& result = stats.assertionResult; + if( !result.isOk() ) { + std::string elementName; + switch( result.getResultType() ) { + case ResultWas::ThrewException: + case ResultWas::FatalErrorCondition: + elementName = "error"; + break; + case ResultWas::ExplicitFailure: + elementName = "failure"; + break; + case ResultWas::ExpressionFailed: + elementName = "failure"; + break; + case ResultWas::DidntThrowException: + elementName = "failure"; + break; + + // We should never see these here: + case ResultWas::Info: + case ResultWas::Warning: + case ResultWas::Ok: + case ResultWas::Unknown: + case ResultWas::FailureBit: + case ResultWas::Exception: + elementName = "internalError"; + break; + } + + XmlWriter::ScopedElement e = xml.scopedElement( elementName ); + + xml.writeAttribute( "message", result.getExpandedExpression() ); + xml.writeAttribute( "type", result.getTestMacroName() ); + + ReusableStringStream rss; + if( !result.getMessage().empty() ) + rss << result.getMessage() << '\n'; + for( auto const& msg : stats.infoMessages ) + if( msg.type == ResultWas::Info ) + rss << msg.message << '\n'; + + rss << "at " << result.getSourceInfo(); + xml.writeText( rss.str(), false ); + } + } + + CATCH_REGISTER_REPORTER( "junit", JunitReporter ) + +} // end namespace Catch +// end catch_reporter_junit.cpp +// start catch_reporter_listening.cpp + +#include + +namespace Catch { + + ListeningReporter::ListeningReporter() { + // We will assume that listeners will always want all assertions + m_preferences.shouldReportAllAssertions = true; + } + + void ListeningReporter::addListener( IStreamingReporterPtr&& listener ) { + m_listeners.push_back( std::move( listener ) ); + } + + void ListeningReporter::addReporter(IStreamingReporterPtr&& reporter) { + assert(!m_reporter && "Listening reporter can wrap only 1 real reporter"); + m_reporter = std::move( reporter ); + m_preferences.shouldRedirectStdOut = m_reporter->getPreferences().shouldRedirectStdOut; + } + + ReporterPreferences ListeningReporter::getPreferences() const { + return m_preferences; + } + + std::set ListeningReporter::getSupportedVerbosities() { + return std::set{ }; + } + + void ListeningReporter::noMatchingTestCases( std::string const& spec ) { + for ( auto const& listener : m_listeners ) { + listener->noMatchingTestCases( spec ); + } + m_reporter->noMatchingTestCases( spec ); + } + + void ListeningReporter::benchmarkStarting( BenchmarkInfo const& benchmarkInfo ) { + for ( auto const& listener : m_listeners ) { + listener->benchmarkStarting( benchmarkInfo ); + } + m_reporter->benchmarkStarting( benchmarkInfo ); + } + void ListeningReporter::benchmarkEnded( BenchmarkStats const& benchmarkStats ) { + for ( auto const& listener : m_listeners ) { + listener->benchmarkEnded( benchmarkStats ); + } + m_reporter->benchmarkEnded( benchmarkStats ); + } + + void ListeningReporter::testRunStarting( TestRunInfo const& testRunInfo ) { + for ( auto const& listener : m_listeners ) { + listener->testRunStarting( testRunInfo ); + } + m_reporter->testRunStarting( testRunInfo ); + } + + void ListeningReporter::testGroupStarting( GroupInfo const& groupInfo ) { + for ( auto const& listener : m_listeners ) { + listener->testGroupStarting( groupInfo ); + } + m_reporter->testGroupStarting( groupInfo ); + } + + void ListeningReporter::testCaseStarting( TestCaseInfo const& testInfo ) { + for ( auto const& listener : m_listeners ) { + listener->testCaseStarting( testInfo ); + } + m_reporter->testCaseStarting( testInfo ); + } + + void ListeningReporter::sectionStarting( SectionInfo const& sectionInfo ) { + for ( auto const& listener : m_listeners ) { + listener->sectionStarting( sectionInfo ); + } + m_reporter->sectionStarting( sectionInfo ); + } + + void ListeningReporter::assertionStarting( AssertionInfo const& assertionInfo ) { + for ( auto const& listener : m_listeners ) { + listener->assertionStarting( assertionInfo ); + } + m_reporter->assertionStarting( assertionInfo ); + } + + // The return value indicates if the messages buffer should be cleared: + bool ListeningReporter::assertionEnded( AssertionStats const& assertionStats ) { + for( auto const& listener : m_listeners ) { + static_cast( listener->assertionEnded( assertionStats ) ); + } + return m_reporter->assertionEnded( assertionStats ); + } + + void ListeningReporter::sectionEnded( SectionStats const& sectionStats ) { + for ( auto const& listener : m_listeners ) { + listener->sectionEnded( sectionStats ); + } + m_reporter->sectionEnded( sectionStats ); + } + + void ListeningReporter::testCaseEnded( TestCaseStats const& testCaseStats ) { + for ( auto const& listener : m_listeners ) { + listener->testCaseEnded( testCaseStats ); + } + m_reporter->testCaseEnded( testCaseStats ); + } + + void ListeningReporter::testGroupEnded( TestGroupStats const& testGroupStats ) { + for ( auto const& listener : m_listeners ) { + listener->testGroupEnded( testGroupStats ); + } + m_reporter->testGroupEnded( testGroupStats ); + } + + void ListeningReporter::testRunEnded( TestRunStats const& testRunStats ) { + for ( auto const& listener : m_listeners ) { + listener->testRunEnded( testRunStats ); + } + m_reporter->testRunEnded( testRunStats ); + } + + void ListeningReporter::skipTest( TestCaseInfo const& testInfo ) { + for ( auto const& listener : m_listeners ) { + listener->skipTest( testInfo ); + } + m_reporter->skipTest( testInfo ); + } + + bool ListeningReporter::isMulti() const { + return true; + } + +} // end namespace Catch +// end catch_reporter_listening.cpp +// start catch_reporter_xml.cpp + +#if defined(_MSC_VER) +#pragma warning(push) +#pragma warning(disable:4061) // Not all labels are EXPLICITLY handled in switch + // Note that 4062 (not all labels are handled + // and default is missing) is enabled +#endif + +namespace Catch { + XmlReporter::XmlReporter( ReporterConfig const& _config ) + : StreamingReporterBase( _config ), + m_xml(_config.stream()) + { + m_reporterPrefs.shouldRedirectStdOut = true; + m_reporterPrefs.shouldReportAllAssertions = true; + } + + XmlReporter::~XmlReporter() = default; + + std::string XmlReporter::getDescription() { + return "Reports test results as an XML document"; + } + + std::string XmlReporter::getStylesheetRef() const { + return std::string(); + } + + void XmlReporter::writeSourceInfo( SourceLineInfo const& sourceInfo ) { + m_xml + .writeAttribute( "filename", sourceInfo.file ) + .writeAttribute( "line", sourceInfo.line ); + } + + void XmlReporter::noMatchingTestCases( std::string const& s ) { + StreamingReporterBase::noMatchingTestCases( s ); + } + + void XmlReporter::testRunStarting( TestRunInfo const& testInfo ) { + StreamingReporterBase::testRunStarting( testInfo ); + std::string stylesheetRef = getStylesheetRef(); + if( !stylesheetRef.empty() ) + m_xml.writeStylesheetRef( stylesheetRef ); + m_xml.startElement( "Catch" ); + if( !m_config->name().empty() ) + m_xml.writeAttribute( "name", m_config->name() ); + if( m_config->rngSeed() != 0 ) + m_xml.scopedElement( "Randomness" ) + .writeAttribute( "seed", m_config->rngSeed() ); + } + + void XmlReporter::testGroupStarting( GroupInfo const& groupInfo ) { + StreamingReporterBase::testGroupStarting( groupInfo ); + m_xml.startElement( "Group" ) + .writeAttribute( "name", groupInfo.name ); + } + + void XmlReporter::testCaseStarting( TestCaseInfo const& testInfo ) { + StreamingReporterBase::testCaseStarting(testInfo); + m_xml.startElement( "TestCase" ) + .writeAttribute( "name", trim( testInfo.name ) ) + .writeAttribute( "description", testInfo.description ) + .writeAttribute( "tags", testInfo.tagsAsString() ); + + writeSourceInfo( testInfo.lineInfo ); + + if ( m_config->showDurations() == ShowDurations::Always ) + m_testCaseTimer.start(); + m_xml.ensureTagClosed(); + } + + void XmlReporter::sectionStarting( SectionInfo const& sectionInfo ) { + StreamingReporterBase::sectionStarting( sectionInfo ); + if( m_sectionDepth++ > 0 ) { + m_xml.startElement( "Section" ) + .writeAttribute( "name", trim( sectionInfo.name ) ); + writeSourceInfo( sectionInfo.lineInfo ); + m_xml.ensureTagClosed(); + } + } + + void XmlReporter::assertionStarting( AssertionInfo const& ) { } + + bool XmlReporter::assertionEnded( AssertionStats const& assertionStats ) { + + AssertionResult const& result = assertionStats.assertionResult; + + bool includeResults = m_config->includeSuccessfulResults() || !result.isOk(); + + if( includeResults || result.getResultType() == ResultWas::Warning ) { + // Print any info messages in tags. + for( auto const& msg : assertionStats.infoMessages ) { + if( msg.type == ResultWas::Info && includeResults ) { + m_xml.scopedElement( "Info" ) + .writeText( msg.message ); + } else if ( msg.type == ResultWas::Warning ) { + m_xml.scopedElement( "Warning" ) + .writeText( msg.message ); + } + } + } + + // Drop out if result was successful but we're not printing them. + if( !includeResults && result.getResultType() != ResultWas::Warning ) + return true; + + // Print the expression if there is one. + if( result.hasExpression() ) { + m_xml.startElement( "Expression" ) + .writeAttribute( "success", result.succeeded() ) + .writeAttribute( "type", result.getTestMacroName() ); + + writeSourceInfo( result.getSourceInfo() ); + + m_xml.scopedElement( "Original" ) + .writeText( result.getExpression() ); + m_xml.scopedElement( "Expanded" ) + .writeText( result.getExpandedExpression() ); + } + + // And... Print a result applicable to each result type. + switch( result.getResultType() ) { + case ResultWas::ThrewException: + m_xml.startElement( "Exception" ); + writeSourceInfo( result.getSourceInfo() ); + m_xml.writeText( result.getMessage() ); + m_xml.endElement(); + break; + case ResultWas::FatalErrorCondition: + m_xml.startElement( "FatalErrorCondition" ); + writeSourceInfo( result.getSourceInfo() ); + m_xml.writeText( result.getMessage() ); + m_xml.endElement(); + break; + case ResultWas::Info: + m_xml.scopedElement( "Info" ) + .writeText( result.getMessage() ); + break; + case ResultWas::Warning: + // Warning will already have been written + break; + case ResultWas::ExplicitFailure: + m_xml.startElement( "Failure" ); + writeSourceInfo( result.getSourceInfo() ); + m_xml.writeText( result.getMessage() ); + m_xml.endElement(); + break; + default: + break; + } + + if( result.hasExpression() ) + m_xml.endElement(); + + return true; + } + + void XmlReporter::sectionEnded( SectionStats const& sectionStats ) { + StreamingReporterBase::sectionEnded( sectionStats ); + if( --m_sectionDepth > 0 ) { + XmlWriter::ScopedElement e = m_xml.scopedElement( "OverallResults" ); + e.writeAttribute( "successes", sectionStats.assertions.passed ); + e.writeAttribute( "failures", sectionStats.assertions.failed ); + e.writeAttribute( "expectedFailures", sectionStats.assertions.failedButOk ); + + if ( m_config->showDurations() == ShowDurations::Always ) + e.writeAttribute( "durationInSeconds", sectionStats.durationInSeconds ); + + m_xml.endElement(); + } + } + + void XmlReporter::testCaseEnded( TestCaseStats const& testCaseStats ) { + StreamingReporterBase::testCaseEnded( testCaseStats ); + XmlWriter::ScopedElement e = m_xml.scopedElement( "OverallResult" ); + e.writeAttribute( "success", testCaseStats.totals.assertions.allOk() ); + + if ( m_config->showDurations() == ShowDurations::Always ) + e.writeAttribute( "durationInSeconds", m_testCaseTimer.getElapsedSeconds() ); + + if( !testCaseStats.stdOut.empty() ) + m_xml.scopedElement( "StdOut" ).writeText( trim( testCaseStats.stdOut ), false ); + if( !testCaseStats.stdErr.empty() ) + m_xml.scopedElement( "StdErr" ).writeText( trim( testCaseStats.stdErr ), false ); + + m_xml.endElement(); + } + + void XmlReporter::testGroupEnded( TestGroupStats const& testGroupStats ) { + StreamingReporterBase::testGroupEnded( testGroupStats ); + // TODO: Check testGroupStats.aborting and act accordingly. + m_xml.scopedElement( "OverallResults" ) + .writeAttribute( "successes", testGroupStats.totals.assertions.passed ) + .writeAttribute( "failures", testGroupStats.totals.assertions.failed ) + .writeAttribute( "expectedFailures", testGroupStats.totals.assertions.failedButOk ); + m_xml.endElement(); + } + + void XmlReporter::testRunEnded( TestRunStats const& testRunStats ) { + StreamingReporterBase::testRunEnded( testRunStats ); + m_xml.scopedElement( "OverallResults" ) + .writeAttribute( "successes", testRunStats.totals.assertions.passed ) + .writeAttribute( "failures", testRunStats.totals.assertions.failed ) + .writeAttribute( "expectedFailures", testRunStats.totals.assertions.failedButOk ); + m_xml.endElement(); + } + + CATCH_REGISTER_REPORTER( "xml", XmlReporter ) + +} // end namespace Catch + +#if defined(_MSC_VER) +#pragma warning(pop) +#endif +// end catch_reporter_xml.cpp + +namespace Catch { + LeakDetector leakDetector; +} + +#ifdef __clang__ +#pragma clang diagnostic pop +#endif + +// end catch_impl.hpp +#endif + +#ifdef CATCH_CONFIG_MAIN +// start catch_default_main.hpp + +#ifndef __OBJC__ + +#if defined(CATCH_CONFIG_WCHAR) && defined(WIN32) && defined(_UNICODE) && !defined(DO_NOT_USE_WMAIN) +// Standard C/C++ Win32 Unicode wmain entry point +extern "C" int wmain (int argc, wchar_t * argv[], wchar_t * []) { +#else +// Standard C/C++ main entry point +int main (int argc, char * argv[]) { +#endif + + return Catch::Session().run( argc, argv ); +} + +#else // __OBJC__ + +// Objective-C entry point +int main (int argc, char * const argv[]) { +#if !CATCH_ARC_ENABLED + NSAutoreleasePool * pool = [[NSAutoreleasePool alloc] init]; +#endif + + Catch::registerTestMethods(); + int result = Catch::Session().run( argc, (char**)argv ); + +#if !CATCH_ARC_ENABLED + [pool drain]; +#endif + + return result; +} + +#endif // __OBJC__ + +// end catch_default_main.hpp +#endif + +#if !defined(CATCH_CONFIG_IMPL_ONLY) + +#ifdef CLARA_CONFIG_MAIN_NOT_DEFINED +# undef CLARA_CONFIG_MAIN +#endif + +#if !defined(CATCH_CONFIG_DISABLE) +////// +// If this config identifier is defined then all CATCH macros are prefixed with CATCH_ +#ifdef CATCH_CONFIG_PREFIX_ALL + +#define CATCH_REQUIRE( ... ) INTERNAL_CATCH_TEST( "CATCH_REQUIRE", Catch::ResultDisposition::Normal, __VA_ARGS__ ) +#define CATCH_REQUIRE_FALSE( ... ) INTERNAL_CATCH_TEST( "CATCH_REQUIRE_FALSE", Catch::ResultDisposition::Normal | Catch::ResultDisposition::FalseTest, __VA_ARGS__ ) + +#define CATCH_REQUIRE_THROWS( ... ) INTERNAL_CATCH_THROWS( "CATCH_REQUIRE_THROWS", Catch::ResultDisposition::Normal, __VA_ARGS__ ) +#define CATCH_REQUIRE_THROWS_AS( expr, exceptionType ) INTERNAL_CATCH_THROWS_AS( "CATCH_REQUIRE_THROWS_AS", exceptionType, Catch::ResultDisposition::Normal, expr ) +#define CATCH_REQUIRE_THROWS_WITH( expr, matcher ) INTERNAL_CATCH_THROWS_STR_MATCHES( "CATCH_REQUIRE_THROWS_WITH", Catch::ResultDisposition::Normal, matcher, expr ) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CATCH_REQUIRE_THROWS_MATCHES( expr, exceptionType, matcher ) INTERNAL_CATCH_THROWS_MATCHES( "CATCH_REQUIRE_THROWS_MATCHES", exceptionType, Catch::ResultDisposition::Normal, matcher, expr ) +#endif// CATCH_CONFIG_DISABLE_MATCHERS +#define CATCH_REQUIRE_NOTHROW( ... ) INTERNAL_CATCH_NO_THROW( "CATCH_REQUIRE_NOTHROW", Catch::ResultDisposition::Normal, __VA_ARGS__ ) + +#define CATCH_CHECK( ... ) INTERNAL_CATCH_TEST( "CATCH_CHECK", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CATCH_CHECK_FALSE( ... ) INTERNAL_CATCH_TEST( "CATCH_CHECK_FALSE", Catch::ResultDisposition::ContinueOnFailure | Catch::ResultDisposition::FalseTest, __VA_ARGS__ ) +#define CATCH_CHECKED_IF( ... ) INTERNAL_CATCH_IF( "CATCH_CHECKED_IF", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CATCH_CHECKED_ELSE( ... ) INTERNAL_CATCH_ELSE( "CATCH_CHECKED_ELSE", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CATCH_CHECK_NOFAIL( ... ) INTERNAL_CATCH_TEST( "CATCH_CHECK_NOFAIL", Catch::ResultDisposition::ContinueOnFailure | Catch::ResultDisposition::SuppressFail, __VA_ARGS__ ) + +#define CATCH_CHECK_THROWS( ... ) INTERNAL_CATCH_THROWS( "CATCH_CHECK_THROWS", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CATCH_CHECK_THROWS_AS( expr, exceptionType ) INTERNAL_CATCH_THROWS_AS( "CATCH_CHECK_THROWS_AS", exceptionType, Catch::ResultDisposition::ContinueOnFailure, expr ) +#define CATCH_CHECK_THROWS_WITH( expr, matcher ) INTERNAL_CATCH_THROWS_STR_MATCHES( "CATCH_CHECK_THROWS_WITH", Catch::ResultDisposition::ContinueOnFailure, matcher, expr ) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CATCH_CHECK_THROWS_MATCHES( expr, exceptionType, matcher ) INTERNAL_CATCH_THROWS_MATCHES( "CATCH_CHECK_THROWS_MATCHES", exceptionType, Catch::ResultDisposition::ContinueOnFailure, matcher, expr ) +#endif // CATCH_CONFIG_DISABLE_MATCHERS +#define CATCH_CHECK_NOTHROW( ... ) INTERNAL_CATCH_NO_THROW( "CATCH_CHECK_NOTHROW", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) + +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CATCH_CHECK_THAT( arg, matcher ) INTERNAL_CHECK_THAT( "CATCH_CHECK_THAT", matcher, Catch::ResultDisposition::ContinueOnFailure, arg ) + +#define CATCH_REQUIRE_THAT( arg, matcher ) INTERNAL_CHECK_THAT( "CATCH_REQUIRE_THAT", matcher, Catch::ResultDisposition::Normal, arg ) +#endif // CATCH_CONFIG_DISABLE_MATCHERS + +#define CATCH_INFO( msg ) INTERNAL_CATCH_INFO( "CATCH_INFO", msg ) +#define CATCH_WARN( msg ) INTERNAL_CATCH_MSG( "CATCH_WARN", Catch::ResultWas::Warning, Catch::ResultDisposition::ContinueOnFailure, msg ) +#define CATCH_CAPTURE( ... ) INTERNAL_CATCH_CAPTURE( INTERNAL_CATCH_UNIQUE_NAME(capturer), "CATCH_CAPTURE",__VA_ARGS__ ) + +#define CATCH_TEST_CASE( ... ) INTERNAL_CATCH_TESTCASE( __VA_ARGS__ ) +#define CATCH_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#define CATCH_METHOD_AS_TEST_CASE( method, ... ) INTERNAL_CATCH_METHOD_AS_TEST_CASE( method, __VA_ARGS__ ) +#define CATCH_REGISTER_TEST_CASE( Function, ... ) INTERNAL_CATCH_REGISTER_TESTCASE( Function, __VA_ARGS__ ) +#define CATCH_SECTION( ... ) INTERNAL_CATCH_SECTION( __VA_ARGS__ ) +#define CATCH_DYNAMIC_SECTION( ... ) INTERNAL_CATCH_DYNAMIC_SECTION( __VA_ARGS__ ) +#define CATCH_FAIL( ... ) INTERNAL_CATCH_MSG( "CATCH_FAIL", Catch::ResultWas::ExplicitFailure, Catch::ResultDisposition::Normal, __VA_ARGS__ ) +#define CATCH_FAIL_CHECK( ... ) INTERNAL_CATCH_MSG( "CATCH_FAIL_CHECK", Catch::ResultWas::ExplicitFailure, Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CATCH_SUCCEED( ... ) INTERNAL_CATCH_MSG( "CATCH_SUCCEED", Catch::ResultWas::Ok, Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) + +#define CATCH_ANON_TEST_CASE() INTERNAL_CATCH_TESTCASE() + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define CATCH_TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE( __VA_ARGS__ ) +#define CATCH_TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE( ... ) INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE( __VA_ARGS__ ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#else +#define CATCH_TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE( __VA_ARGS__ ) ) +#define CATCH_TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE( ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE( __VA_ARGS__ ) ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, __VA_ARGS__ ) ) +#endif + +#if !defined(CATCH_CONFIG_RUNTIME_STATIC_REQUIRE) +#define CATCH_STATIC_REQUIRE( ... ) static_assert( __VA_ARGS__ , #__VA_ARGS__ ); CATCH_SUCCEED( #__VA_ARGS__ ) +#define CATCH_STATIC_REQUIRE_FALSE( ... ) static_assert( !(__VA_ARGS__), "!(" #__VA_ARGS__ ")" ); CATCH_SUCCEED( #__VA_ARGS__ ) +#else +#define CATCH_STATIC_REQUIRE( ... ) CATCH_REQUIRE( __VA_ARGS__ ) +#define CATCH_STATIC_REQUIRE_FALSE( ... ) CATCH_REQUIRE_FALSE( __VA_ARGS__ ) +#endif + +// "BDD-style" convenience wrappers +#define CATCH_SCENARIO( ... ) CATCH_TEST_CASE( "Scenario: " __VA_ARGS__ ) +#define CATCH_SCENARIO_METHOD( className, ... ) INTERNAL_CATCH_TEST_CASE_METHOD( className, "Scenario: " __VA_ARGS__ ) +#define CATCH_GIVEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " Given: " << desc ) +#define CATCH_AND_GIVEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( "And given: " << desc ) +#define CATCH_WHEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " When: " << desc ) +#define CATCH_AND_WHEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " And when: " << desc ) +#define CATCH_THEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " Then: " << desc ) +#define CATCH_AND_THEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " And: " << desc ) + +// If CATCH_CONFIG_PREFIX_ALL is not defined then the CATCH_ prefix is not required +#else + +#define REQUIRE( ... ) INTERNAL_CATCH_TEST( "REQUIRE", Catch::ResultDisposition::Normal, __VA_ARGS__ ) +#define REQUIRE_FALSE( ... ) INTERNAL_CATCH_TEST( "REQUIRE_FALSE", Catch::ResultDisposition::Normal | Catch::ResultDisposition::FalseTest, __VA_ARGS__ ) + +#define REQUIRE_THROWS( ... ) INTERNAL_CATCH_THROWS( "REQUIRE_THROWS", Catch::ResultDisposition::Normal, __VA_ARGS__ ) +#define REQUIRE_THROWS_AS( expr, exceptionType ) INTERNAL_CATCH_THROWS_AS( "REQUIRE_THROWS_AS", exceptionType, Catch::ResultDisposition::Normal, expr ) +#define REQUIRE_THROWS_WITH( expr, matcher ) INTERNAL_CATCH_THROWS_STR_MATCHES( "REQUIRE_THROWS_WITH", Catch::ResultDisposition::Normal, matcher, expr ) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define REQUIRE_THROWS_MATCHES( expr, exceptionType, matcher ) INTERNAL_CATCH_THROWS_MATCHES( "REQUIRE_THROWS_MATCHES", exceptionType, Catch::ResultDisposition::Normal, matcher, expr ) +#endif // CATCH_CONFIG_DISABLE_MATCHERS +#define REQUIRE_NOTHROW( ... ) INTERNAL_CATCH_NO_THROW( "REQUIRE_NOTHROW", Catch::ResultDisposition::Normal, __VA_ARGS__ ) + +#define CHECK( ... ) INTERNAL_CATCH_TEST( "CHECK", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CHECK_FALSE( ... ) INTERNAL_CATCH_TEST( "CHECK_FALSE", Catch::ResultDisposition::ContinueOnFailure | Catch::ResultDisposition::FalseTest, __VA_ARGS__ ) +#define CHECKED_IF( ... ) INTERNAL_CATCH_IF( "CHECKED_IF", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CHECKED_ELSE( ... ) INTERNAL_CATCH_ELSE( "CHECKED_ELSE", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CHECK_NOFAIL( ... ) INTERNAL_CATCH_TEST( "CHECK_NOFAIL", Catch::ResultDisposition::ContinueOnFailure | Catch::ResultDisposition::SuppressFail, __VA_ARGS__ ) + +#define CHECK_THROWS( ... ) INTERNAL_CATCH_THROWS( "CHECK_THROWS", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define CHECK_THROWS_AS( expr, exceptionType ) INTERNAL_CATCH_THROWS_AS( "CHECK_THROWS_AS", exceptionType, Catch::ResultDisposition::ContinueOnFailure, expr ) +#define CHECK_THROWS_WITH( expr, matcher ) INTERNAL_CATCH_THROWS_STR_MATCHES( "CHECK_THROWS_WITH", Catch::ResultDisposition::ContinueOnFailure, matcher, expr ) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CHECK_THROWS_MATCHES( expr, exceptionType, matcher ) INTERNAL_CATCH_THROWS_MATCHES( "CHECK_THROWS_MATCHES", exceptionType, Catch::ResultDisposition::ContinueOnFailure, matcher, expr ) +#endif // CATCH_CONFIG_DISABLE_MATCHERS +#define CHECK_NOTHROW( ... ) INTERNAL_CATCH_NO_THROW( "CHECK_NOTHROW", Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) + +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CHECK_THAT( arg, matcher ) INTERNAL_CHECK_THAT( "CHECK_THAT", matcher, Catch::ResultDisposition::ContinueOnFailure, arg ) + +#define REQUIRE_THAT( arg, matcher ) INTERNAL_CHECK_THAT( "REQUIRE_THAT", matcher, Catch::ResultDisposition::Normal, arg ) +#endif // CATCH_CONFIG_DISABLE_MATCHERS + +#define INFO( msg ) INTERNAL_CATCH_INFO( "INFO", msg ) +#define UNSCOPED_INFO( msg ) INTERNAL_CATCH_UNSCOPED_INFO( "UNSCOPED_INFO", msg ) +#define WARN( msg ) INTERNAL_CATCH_MSG( "WARN", Catch::ResultWas::Warning, Catch::ResultDisposition::ContinueOnFailure, msg ) +#define CAPTURE( ... ) INTERNAL_CATCH_CAPTURE( INTERNAL_CATCH_UNIQUE_NAME(capturer), "CAPTURE",__VA_ARGS__ ) + +#define TEST_CASE( ... ) INTERNAL_CATCH_TESTCASE( __VA_ARGS__ ) +#define TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#define METHOD_AS_TEST_CASE( method, ... ) INTERNAL_CATCH_METHOD_AS_TEST_CASE( method, __VA_ARGS__ ) +#define REGISTER_TEST_CASE( Function, ... ) INTERNAL_CATCH_REGISTER_TESTCASE( Function, __VA_ARGS__ ) +#define SECTION( ... ) INTERNAL_CATCH_SECTION( __VA_ARGS__ ) +#define DYNAMIC_SECTION( ... ) INTERNAL_CATCH_DYNAMIC_SECTION( __VA_ARGS__ ) +#define FAIL( ... ) INTERNAL_CATCH_MSG( "FAIL", Catch::ResultWas::ExplicitFailure, Catch::ResultDisposition::Normal, __VA_ARGS__ ) +#define FAIL_CHECK( ... ) INTERNAL_CATCH_MSG( "FAIL_CHECK", Catch::ResultWas::ExplicitFailure, Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define SUCCEED( ... ) INTERNAL_CATCH_MSG( "SUCCEED", Catch::ResultWas::Ok, Catch::ResultDisposition::ContinueOnFailure, __VA_ARGS__ ) +#define ANON_TEST_CASE() INTERNAL_CATCH_TESTCASE() + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE( __VA_ARGS__ ) +#define TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#define TEMPLATE_PRODUCT_TEST_CASE( ... ) INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE( __VA_ARGS__ ) +#define TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#else +#define TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE( __VA_ARGS__ ) ) +#define TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) ) +#define TEMPLATE_PRODUCT_TEST_CASE( ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE( __VA_ARGS__ ) ) +#define TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, __VA_ARGS__ ) ) +#endif + +#if !defined(CATCH_CONFIG_RUNTIME_STATIC_REQUIRE) +#define STATIC_REQUIRE( ... ) static_assert( __VA_ARGS__, #__VA_ARGS__ ); SUCCEED( #__VA_ARGS__ ) +#define STATIC_REQUIRE_FALSE( ... ) static_assert( !(__VA_ARGS__), "!(" #__VA_ARGS__ ")" ); SUCCEED( "!(" #__VA_ARGS__ ")" ) +#else +#define STATIC_REQUIRE( ... ) REQUIRE( __VA_ARGS__ ) +#define STATIC_REQUIRE_FALSE( ... ) REQUIRE_FALSE( __VA_ARGS__ ) +#endif + +#endif + +#define CATCH_TRANSLATE_EXCEPTION( signature ) INTERNAL_CATCH_TRANSLATE_EXCEPTION( signature ) + +// "BDD-style" convenience wrappers +#define SCENARIO( ... ) TEST_CASE( "Scenario: " __VA_ARGS__ ) +#define SCENARIO_METHOD( className, ... ) INTERNAL_CATCH_TEST_CASE_METHOD( className, "Scenario: " __VA_ARGS__ ) + +#define GIVEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " Given: " << desc ) +#define AND_GIVEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( "And given: " << desc ) +#define WHEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " When: " << desc ) +#define AND_WHEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " And when: " << desc ) +#define THEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " Then: " << desc ) +#define AND_THEN( desc ) INTERNAL_CATCH_DYNAMIC_SECTION( " And: " << desc ) + +using Catch::Detail::Approx; + +#else // CATCH_CONFIG_DISABLE + +////// +// If this config identifier is defined then all CATCH macros are prefixed with CATCH_ +#ifdef CATCH_CONFIG_PREFIX_ALL + +#define CATCH_REQUIRE( ... ) (void)(0) +#define CATCH_REQUIRE_FALSE( ... ) (void)(0) + +#define CATCH_REQUIRE_THROWS( ... ) (void)(0) +#define CATCH_REQUIRE_THROWS_AS( expr, exceptionType ) (void)(0) +#define CATCH_REQUIRE_THROWS_WITH( expr, matcher ) (void)(0) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CATCH_REQUIRE_THROWS_MATCHES( expr, exceptionType, matcher ) (void)(0) +#endif// CATCH_CONFIG_DISABLE_MATCHERS +#define CATCH_REQUIRE_NOTHROW( ... ) (void)(0) + +#define CATCH_CHECK( ... ) (void)(0) +#define CATCH_CHECK_FALSE( ... ) (void)(0) +#define CATCH_CHECKED_IF( ... ) if (__VA_ARGS__) +#define CATCH_CHECKED_ELSE( ... ) if (!(__VA_ARGS__)) +#define CATCH_CHECK_NOFAIL( ... ) (void)(0) + +#define CATCH_CHECK_THROWS( ... ) (void)(0) +#define CATCH_CHECK_THROWS_AS( expr, exceptionType ) (void)(0) +#define CATCH_CHECK_THROWS_WITH( expr, matcher ) (void)(0) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CATCH_CHECK_THROWS_MATCHES( expr, exceptionType, matcher ) (void)(0) +#endif // CATCH_CONFIG_DISABLE_MATCHERS +#define CATCH_CHECK_NOTHROW( ... ) (void)(0) + +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CATCH_CHECK_THAT( arg, matcher ) (void)(0) + +#define CATCH_REQUIRE_THAT( arg, matcher ) (void)(0) +#endif // CATCH_CONFIG_DISABLE_MATCHERS + +#define CATCH_INFO( msg ) (void)(0) +#define CATCH_WARN( msg ) (void)(0) +#define CATCH_CAPTURE( msg ) (void)(0) + +#define CATCH_TEST_CASE( ... ) INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )) +#define CATCH_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )) +#define CATCH_METHOD_AS_TEST_CASE( method, ... ) +#define CATCH_REGISTER_TEST_CASE( Function, ... ) (void)(0) +#define CATCH_SECTION( ... ) +#define CATCH_DYNAMIC_SECTION( ... ) +#define CATCH_FAIL( ... ) (void)(0) +#define CATCH_FAIL_CHECK( ... ) (void)(0) +#define CATCH_SUCCEED( ... ) (void)(0) + +#define CATCH_ANON_TEST_CASE() INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )) + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define CATCH_TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ) ) +#define CATCH_TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), className ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE( ... ) CATCH_TEMPLATE_TEST_CASE( __VA_ARGS__ ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) CATCH_TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#else +#define CATCH_TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ) ) ) +#define CATCH_TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), className ) ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE( ... ) CATCH_TEMPLATE_TEST_CASE( __VA_ARGS__ ) +#define CATCH_TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) CATCH_TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#endif + +// "BDD-style" convenience wrappers +#define CATCH_SCENARIO( ... ) INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )) +#define CATCH_SCENARIO_METHOD( className, ... ) INTERNAL_CATCH_TESTCASE_METHOD_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ ), className ) +#define CATCH_GIVEN( desc ) +#define CATCH_AND_GIVEN( desc ) +#define CATCH_WHEN( desc ) +#define CATCH_AND_WHEN( desc ) +#define CATCH_THEN( desc ) +#define CATCH_AND_THEN( desc ) + +#define CATCH_STATIC_REQUIRE( ... ) (void)(0) +#define CATCH_STATIC_REQUIRE_FALSE( ... ) (void)(0) + +// If CATCH_CONFIG_PREFIX_ALL is not defined then the CATCH_ prefix is not required +#else + +#define REQUIRE( ... ) (void)(0) +#define REQUIRE_FALSE( ... ) (void)(0) + +#define REQUIRE_THROWS( ... ) (void)(0) +#define REQUIRE_THROWS_AS( expr, exceptionType ) (void)(0) +#define REQUIRE_THROWS_WITH( expr, matcher ) (void)(0) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define REQUIRE_THROWS_MATCHES( expr, exceptionType, matcher ) (void)(0) +#endif // CATCH_CONFIG_DISABLE_MATCHERS +#define REQUIRE_NOTHROW( ... ) (void)(0) + +#define CHECK( ... ) (void)(0) +#define CHECK_FALSE( ... ) (void)(0) +#define CHECKED_IF( ... ) if (__VA_ARGS__) +#define CHECKED_ELSE( ... ) if (!(__VA_ARGS__)) +#define CHECK_NOFAIL( ... ) (void)(0) + +#define CHECK_THROWS( ... ) (void)(0) +#define CHECK_THROWS_AS( expr, exceptionType ) (void)(0) +#define CHECK_THROWS_WITH( expr, matcher ) (void)(0) +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CHECK_THROWS_MATCHES( expr, exceptionType, matcher ) (void)(0) +#endif // CATCH_CONFIG_DISABLE_MATCHERS +#define CHECK_NOTHROW( ... ) (void)(0) + +#if !defined(CATCH_CONFIG_DISABLE_MATCHERS) +#define CHECK_THAT( arg, matcher ) (void)(0) + +#define REQUIRE_THAT( arg, matcher ) (void)(0) +#endif // CATCH_CONFIG_DISABLE_MATCHERS + +#define INFO( msg ) (void)(0) +#define WARN( msg ) (void)(0) +#define CAPTURE( msg ) (void)(0) + +#define TEST_CASE( ... ) INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )) +#define TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )) +#define METHOD_AS_TEST_CASE( method, ... ) +#define REGISTER_TEST_CASE( Function, ... ) (void)(0) +#define SECTION( ... ) +#define DYNAMIC_SECTION( ... ) +#define FAIL( ... ) (void)(0) +#define FAIL_CHECK( ... ) (void)(0) +#define SUCCEED( ... ) (void)(0) +#define ANON_TEST_CASE() INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ )) + +#ifndef CATCH_CONFIG_TRADITIONAL_MSVC_PREPROCESSOR +#define TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ) ) +#define TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), className ) +#define TEMPLATE_PRODUCT_TEST_CASE( ... ) TEMPLATE_TEST_CASE( __VA_ARGS__ ) +#define TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#else +#define TEMPLATE_TEST_CASE( ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ) ) ) +#define TEMPLATE_TEST_CASE_METHOD( className, ... ) INTERNAL_CATCH_EXPAND_VARGS( INTERNAL_CATCH_TEMPLATE_TEST_CASE_METHOD_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_M_P_L_A_T_E____T_E_S_T____ ), className ) ) +#define TEMPLATE_PRODUCT_TEST_CASE( ... ) TEMPLATE_TEST_CASE( __VA_ARGS__ ) +#define TEMPLATE_PRODUCT_TEST_CASE_METHOD( className, ... ) TEMPLATE_TEST_CASE_METHOD( className, __VA_ARGS__ ) +#endif + +#define STATIC_REQUIRE( ... ) (void)(0) +#define STATIC_REQUIRE_FALSE( ... ) (void)(0) + +#endif + +#define CATCH_TRANSLATE_EXCEPTION( signature ) INTERNAL_CATCH_TRANSLATE_EXCEPTION_NO_REG( INTERNAL_CATCH_UNIQUE_NAME( catch_internal_ExceptionTranslator ), signature ) + +// "BDD-style" convenience wrappers +#define SCENARIO( ... ) INTERNAL_CATCH_TESTCASE_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ ) ) +#define SCENARIO_METHOD( className, ... ) INTERNAL_CATCH_TESTCASE_METHOD_NO_REGISTRATION(INTERNAL_CATCH_UNIQUE_NAME( ____C_A_T_C_H____T_E_S_T____ ), className ) + +#define GIVEN( desc ) +#define AND_GIVEN( desc ) +#define WHEN( desc ) +#define AND_WHEN( desc ) +#define THEN( desc ) +#define AND_THEN( desc ) + +using Catch::Detail::Approx; + +#endif + +#endif // ! CATCH_CONFIG_IMPL_ONLY + +// start catch_reenable_warnings.h + + +#ifdef __clang__ +# ifdef __ICC // icpc defines the __clang__ macro +# pragma warning(pop) +# else +# pragma clang diagnostic pop +# endif +#elif defined __GNUC__ +# pragma GCC diagnostic pop +#endif + +// end catch_reenable_warnings.h +// end catch.hpp +#endif // TWOBLUECUBES_SINGLE_INCLUDE_CATCH_HPP_INCLUDED +