From b40fc01bbf02b17a81af09c6eb47557de47bc33f Mon Sep 17 00:00:00 2001
From: rbasso <rbasso@sharpgeeks.net>
Date: Thu, 9 Mar 2017 18:09:01 +0900
Subject: [PATCH 1/2] nucleotide-count: Make canonical-data.json compliant

---
 exercises/nucleotide-count/canonical-data.json | 10 +++++++++-
 1 file changed, 9 insertions(+), 1 deletion(-)

diff --git a/exercises/nucleotide-count/canonical-data.json b/exercises/nucleotide-count/canonical-data.json
index 6ec735e0e8..f9143764b8 100644
--- a/exercises/nucleotide-count/canonical-data.json
+++ b/exercises/nucleotide-count/canonical-data.json
@@ -1,9 +1,13 @@
 {
-  "nucleotide_counts": {
+  "exercise": "nucleotide-count",
+  "version": "1.0.0",
+  "cases": [
+  {
     "description": "count all nucleotides in a strand",
     "cases": [
       {
         "description": "empty strand",
+        "property": "nucleotideCounts",
         "strand": "",
         "expected": {
           "A": 0,
@@ -14,6 +18,7 @@
       },
       {
         "description": "strand with repeated nucleotide",
+        "property": "nucleotideCounts",
         "strand": "GGGGGGG",
         "expected": {
           "A": 0,
@@ -24,6 +29,7 @@
       },
       {
         "description": "strand with multiple nucleotides",
+        "property": "nucleotideCounts",
         "strand": "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC",
         "expected": {
           "A": 20,
@@ -34,6 +40,7 @@
       },
       {
         "description": "strand with invalid nucleotides",
+        "property": "nucleotideCounts",
         "strand": "AGXXACT",
         "expected": {
           "error": "Invalid nucleotide in strand"
@@ -41,4 +48,5 @@
       }
     ]
   }
+  ]
 }

From bff95bb2b6e8b1b8b68cff16d52df275e2cfcad3 Mon Sep 17 00:00:00 2001
From: rbasso <rbasso@sharpgeeks.net>
Date: Thu, 9 Mar 2017 18:10:29 +0900
Subject: [PATCH 2/2] nucleotide-count: Fix canonical-data.json formatting

---
 .../nucleotide-count/canonical-data.json      | 90 +++++++++----------
 1 file changed, 45 insertions(+), 45 deletions(-)

diff --git a/exercises/nucleotide-count/canonical-data.json b/exercises/nucleotide-count/canonical-data.json
index f9143764b8..c2752992d5 100644
--- a/exercises/nucleotide-count/canonical-data.json
+++ b/exercises/nucleotide-count/canonical-data.json
@@ -2,51 +2,51 @@
   "exercise": "nucleotide-count",
   "version": "1.0.0",
   "cases": [
-  {
-    "description": "count all nucleotides in a strand",
-    "cases": [
-      {
-        "description": "empty strand",
-        "property": "nucleotideCounts",
-        "strand": "",
-        "expected": {
-          "A": 0,
-          "C": 0,
-          "G": 0,
-          "T": 0
+    {
+      "description": "count all nucleotides in a strand",
+      "cases": [
+        {
+          "description": "empty strand",
+          "property": "nucleotideCounts",
+          "strand": "",
+          "expected": {
+            "A": 0,
+            "C": 0,
+            "G": 0,
+            "T": 0
+          }
+        },
+        {
+          "description": "strand with repeated nucleotide",
+          "property": "nucleotideCounts",
+          "strand": "GGGGGGG",
+          "expected": {
+            "A": 0,
+            "C": 0,
+            "G": 7,
+            "T": 0
+          }
+        },
+        {
+          "description": "strand with multiple nucleotides",
+          "property": "nucleotideCounts",
+          "strand": "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC",
+          "expected": {
+            "A": 20,
+            "C": 12,
+            "G": 17,
+            "T": 21
+          }
+        },
+        {
+          "description": "strand with invalid nucleotides",
+          "property": "nucleotideCounts",
+          "strand": "AGXXACT",
+          "expected": {
+            "error": "Invalid nucleotide in strand"
+          }
         }
-      },
-      {
-        "description": "strand with repeated nucleotide",
-        "property": "nucleotideCounts",
-        "strand": "GGGGGGG",
-        "expected": {
-          "A": 0,
-          "C": 0,
-          "G": 7,
-          "T": 0
-        }
-      },
-      {
-        "description": "strand with multiple nucleotides",
-        "property": "nucleotideCounts",
-        "strand": "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC",
-        "expected": {
-          "A": 20,
-          "C": 12,
-          "G": 17,
-          "T": 21
-        }
-      },
-      {
-        "description": "strand with invalid nucleotides",
-        "property": "nucleotideCounts",
-        "strand": "AGXXACT",
-        "expected": {
-          "error": "Invalid nucleotide in strand"
-        }
-      }
-    ]
-  }
+      ]
+    }
   ]
 }