From 394aed28eef17cf9984675ac68a9e0a49a38c2b0 Mon Sep 17 00:00:00 2001
From: ZapAnton <wc3ft2@gmail.com>
Date: Wed, 21 Nov 2018 11:22:33 +0300
Subject: [PATCH] nucleotide-count: Updated the exercise to the 1.3.0 version

Relevant PRs:
- https://github.com/exercism/problem-specifications/pull/666
- https://github.com/exercism/problem-specifications/pull/951
- https://github.com/exercism/problem-specifications/pull/957
- https://github.com/exercism/problem-specifications/pull/1126

Basically renamed the old test cases and the process function.
---
 exercises/nucleotide-count/Cargo.toml         |  2 +-
 .../tests/nucleotide-count.rs                 | 33 ++++++++++++++-----
 2 files changed, 25 insertions(+), 10 deletions(-)

diff --git a/exercises/nucleotide-count/Cargo.toml b/exercises/nucleotide-count/Cargo.toml
index 43ecd2d82..ae5eceadb 100644
--- a/exercises/nucleotide-count/Cargo.toml
+++ b/exercises/nucleotide-count/Cargo.toml
@@ -1,3 +1,3 @@
 [package]
 name = "nucleotide-count"
-version = "0.0.0"
+version = "1.3.0"
diff --git a/exercises/nucleotide-count/tests/nucleotide-count.rs b/exercises/nucleotide-count/tests/nucleotide-count.rs
index d6eb47f76..403ae9c53 100644
--- a/exercises/nucleotide-count/tests/nucleotide-count.rs
+++ b/exercises/nucleotide-count/tests/nucleotide-count.rs
@@ -2,7 +2,7 @@ extern crate nucleotide_count as dna;
 
 use std::collections::HashMap;
 
-fn check_dna(s: &str, pairs: &[(char, usize)]) {
+fn process_nucleotidecounts_case(s: &str, pairs: &[(char, usize)]) {
     // The reason for the awkward code in here is to ensure that the failure
     // message for assert_eq! is as informative as possible. A simpler
     // solution would simply check the length of the map, and then
@@ -11,6 +11,7 @@ fn check_dna(s: &str, pairs: &[(char, usize)]) {
     for &(k, v) in pairs.iter() {
         assert_eq!((k, m.remove(&k)), (k, Some(v)));
     }
+
     // may fail with a message that clearly shows all extra pairs in the map
     assert_eq!(m.iter().collect::<Vec<(&char, &usize)>>(), vec![]);
 }
@@ -58,22 +59,29 @@ fn counts_returns_result() {
 
 #[test]
 #[ignore]
-fn test_nucleotide_count_empty() {
-    check_dna("", &[('A', 0), ('T', 0), ('C', 0), ('G', 0)]);
+fn test_empty_strand() {
+    process_nucleotidecounts_case("", &[('A', 0), ('T', 0), ('C', 0), ('G', 0)]);
+}
+
+#[test]
+#[ignore]
+/// can count one nucleotide in single-character input
+fn test_can_count_one_nucleotide_in_singlecharacter_input() {
+    process_nucleotidecounts_case("G", &[('A', 0), ('C', 0), ('G', 1), ('T', 0)]);
 }
 
 #[test]
 #[ignore]
-fn test_nucleotide_count_only_guanine() {
-    check_dna("GGGGGGGG", &[('A', 0), ('T', 0), ('C', 0), ('G', 8)]);
+fn test_strand_with_repeated_nucleotide() {
+    process_nucleotidecounts_case("GGGGGGG", &[('A', 0), ('T', 0), ('C', 0), ('G', 7)]);
 }
 
 #[test]
 #[ignore]
-fn test_nucleotide_count_counts_all() {
-    check_dna(
-        "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAA\
-         GAGTGTCTGATAGCAGC",
+/// strand with multiple nucleotides
+fn test_strand_with_multiple_nucleotides() {
+    process_nucleotidecounts_case(
+        "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC",
         &[('A', 20), ('T', 21), ('C', 12), ('G', 17)],
     );
 }
@@ -83,3 +91,10 @@ fn test_nucleotide_count_counts_all() {
 fn counts_invalid_nucleotide_results_in_err() {
     assert_eq!(dna::nucleotide_counts("GGXXX"), Err('X'));
 }
+
+#[test]
+#[ignore]
+/// strand with invalid nucleotides
+fn test_strand_with_invalid_nucleotides() {
+    assert_eq!(dna::nucleotide_counts("AGXXACT"), Err('X'),);
+}