Step 1: Grep for reads

If you need to use grep with multiple colors and search terms to visually inspect reads for problems.

What does it do

• quick grep tool to highlight sequence patterns in fastq files
• e.g., searching and vis for multi barcodes, primers, or remaining adapters
• supports reverse complement search --rc
• colors are red, blue, green, yellow, and up to 9 search terms per color
  • -r1 would be a search term colored in red
  • see also --help
• can multithread if .fastq was used as an input; .fastq.gz is slow
• creates an output file matching_ids.txt with all IDs where all searched sequence patterns were found.

Example code:

python3 searcher.py all.fastq -r1 "GGTTACACAAACCCTGGACA" -b2 "GGATTCATTCCCACGGTAAC" -rc --limit 20

terminal output

Step 2: Search for IDs in your demultiplexed fastq files

What does it do

Searches through FASTQ files (including gzipped formats) to find specific read IDs provided in a list. When a match is found, it extracts the associated sample name and compiles the results into a CSV file.

Files Required

• Read ID File (.txt): A text file containing one target read ID per line (e.g., matching_ids.txt (from Step 1)).
• Reads Folder: A directory containing your read files (.fastq or fastq.gz), which you want to screen.

Example code:

python3 ID_finder.py matching_ids.txt /fastq/

Output

The script generates a CSV file (default: ID_to_filename_output.csv) with the following two columns: ID, Filename

Terminal output

Quick start

Step 1:

python3 searcher.py all.fastq -r1 "GGTTACACAAACCCTGGACA" -b2 "GGATTCATTCCCACGGTAAC" -rc --limit 20

Step 2:

python3 ID_finder.py matching_ids.txt /fastq/