HandleBam implement these steps in RNA-seq pipeline:
- mapping quality filter
- deduplication
- set annotations
- stat gene expression data
optional functions:
- umi correction
- sequencing saturation
- centos-7.0+
- gcc-9.1.0
- cmake-3.17.2
| Library | Version | Description | Link |
|---|---|---|---|
| htslib | 1.9.0 | process bam/sam data | https://github.com/samtools/htslib/releases/download/1.9/htslib-1.9.tar.bz2 |
| spdlog | 1.5.0 | logging module | https://github.com/gabime/spdlog/archive/v1.5.0.zip |
| CLI11 | 1.9.0 | parse command line parameters | https://github.com/CLIUtils/CLI11/releases/download/v1.9.0/CLI11.hpp |
| libdeflate | 1.5 | accelerate bgzf IO | https://github.com/ebiggers/libdeflate/archive/v1.5.zip |
| ygg | master | interval tree for find overlapping | https://github.com/tinloaf/ygg.git |
| doctest | 2.3.7 | optional for unittest | https://github.com/onqtam/doctest/archive/2.3.7.tar.gz |
| fftw | 3.3.8 | for KDE |
- enter the code path
- modify the value of
libPathin file script/build.sh - run script/build.sh
- the compile results are saved in this directory: install/bin install/lib
Unit testing is already supported.
Repeat steps in Compile and modify step three: sh ./script/build.sh ON ,
then the binary executable file named unittest is saved in install/bin
HandleBam: mapping quality filter, deduplication, set annotation, stat gene expression data.
Usage: ./install/bin/handleBam [OPTIONS]
Options:
-h,--help Print this help message and exit
-I,-i TEXT REQUIRED Input bam filename or file list separated by comma
-O,-o TEXT REQUIRED Output bam filename
-A,-a TEXT:FILE REQUIRED Input annotation filename
-S,-s TEXT REQUIRED Output summary filename
-E,-e TEXT REQUIRED Output barcode gene expression filename
-Q,-q INT:POSITIVE Set mapping quality threshold, default 10
-C,-c INT:POSITIVE Set cpu cores, default detect
--save_lq Save low quality reads, default false
--save_dup Save duplicate reads, default false
--anno_mode INT:INT in [0 - 2] Select annotation mode, default 2
0->'v1'
1->'v2'
2->'v3'
--umi_on Open umi correction, default off
--umi_min_num INT:POSITIVE Minimum umi number for correction, default 5
--umi_mismatch INT:POSITIVE Maximum mismatch for umi correction, default 1
--sat_file TEXT Needs: --umi_on Output sequencing saturation file, default None
--scrna,--scRNA,--SCRNA Set scRNA mode, default false
--no_filter_matrix Needs: --scrna Not filter the gene expression matrix, default false
HandleBam version: 1.0.0
Required parameters:
- -i filename. Input bam filename
- -o filename. Output bam filename
- -a filename. Input annotation filename
- -s filename. Output summary filename
- -e filename. Output barcode gene expression filename
Optional parameters:
- -q integer. Set mapping quality threshold, default 10
- --save_lq. Save low quality reads(less than paramter of '-q'), default not save
- --save_dup. Save duplicate reads, default not save.
- --anno_mode integer. Select annotation mode, default is 2
- --umi_on. Open umi correction, default off
- --umi_min_num integer. Minimum umi number for correction, default 5
- --umi_mismatch integer. Maximum mismatch for umi correction, default 1
- --sat_file filename. Output sequencing saturation file, depend on --umi_on
$./install/bin/handleBam \
-i batch25/batch25.bam \
-o batch25/exp.bam \
-a batch25/batch25.gtf \
-s batch25/exp.summary.txt \
-e batch25/exp.barcode_gene_exp.txt
Input parameters: -i batch25/batch25.bam -a batch25/batch25.gtf
Ouput parameters: -o batch25/exp.bam -s batch25/exp.summary.txt -e batch25/exp.barcode_gene_exp.txt
$./install/bin/handleBam \
-i batch25/batch25.bam \
-o batch25/exp.bam \
-a batch25/batch25.gtf \
-s batch25/exp.summary.txt \
-e batch25/exp.barcode_gene_exp.txt \
--save_lq \
--save_dup
Save reads with low quality or duplicate, also set bam flags with BAM_FQCFAIL or BAM_FDUP
$./install/bin/handleBam \
-i batch25/batch25.bam \
-o batch25/exp.bam \
-a batch25/batch25.gtf \
-s batch25/exp.summary.txt \
-e batch25/exp.barcode_gene_exp.txt \
--anno_mode 1
Set annotation mode to Drop-seq V1, there will be more options to choose from in the future
$./install/bin/handleBam \
-i batch25/batch25.bam \
-o batch25/exp.bam \
-a batch25/batch25.gtf \
-s batch25/exp.summary.txt \
-e batch25/exp.barcode_gene_exp.txt \
--umi_on \
--umi_min_num 10 \
--umi_mismatch 2
Use umi correction for deduplicate
$./install/bin/handleBam \
-i batch25/batch25.bam \
-o batch25/exp.bam \
-a batch25/batch25.gtf \
-s batch25/exp.summary.txt \
-e batch25/exp.barcode_gene_exp.txt \
--umi_on \
--sat_file batch25/exp.saturation.txt
The result cantains three files:
-
output bam. The bam file contains gene annotation information
-
summary. Text file contains some stat metrics of filter, deduplication and annotation,example:
- filter and deduplication metrics table
TOTAL_READS PASS_FILTER UNIQUE_READS FAIL_FILTER_RATE DUPLICATION_RATE 9999404 6450176 4036230 35.4944 37.4245 - annotation metrics table
Mode 0/1:
TOTAL_READS READS_WRONG_STRAND READS_RIGHT_STRAND READ_AMBIGUOUS_GENE_FIXED AMBIGUOUS_READS_REJECTED 4036230 194315 3841915 0 0 Mode 2:
TOTAL_READS MAP EXONIC INTRONIC INTERGENIC TRANSCRIPTOME ANTISENSE 949906 949906 855200 354 42033 850051 9833 100.0 100.0 90.0 0.0 9.9 89.5 1.0 - umi correction metrics table(exists if using umi correction)
umi number stat:
BARCODE_GENE_NUM UMI_CNT_RAW UMI_CNT_DEDUP RAW_PCT DEDUP_PCT 9055411 7972608 6861844 131.97 116.19 umi mismatch positions:
POSITION CNT PCT 1 141568 9.67 2 220451 15.06 3 136248 9.31 umi mismatch types:
TYPE CNT PCT A_A 0 0.00 A_C 108891 7.44 A_G 167747 11.46 - sequencing saturation(exists if using parameter '--sat_file')
sample bar_x bar_y1 bar_y2 bin_x bin_y1 bin_y2 0.05 2 0.60219 1 166 0.602246 51 0.1 4 0.706105 1 330 0.706156 71 0.15 5 0.755016 1 492 0.755062 84 sample: sample data size divide by total data size
bar_x: using barcode as spot, mean reads per spot
bar_y1: sequencing saturation, 1 - (uniq/total)
bar_y2: median genes per spot
bin_x/bin_y1/bin_y2: using bin number 150 as spot -
gene expression. The text file composed of three columns, which are
Barcode\tGene\tTimes, example:Barcode Gene Times TATTGGTACACCTCACCTCC AL954705.1 8 TCTATCGGGCCTCGCTGTGC AL954705.1 16 ATGACACCACCGTCTTCCCT AL954705.1 1 Also output matrix market files: barcodes.tsv.gz genes.tsv.gz matrix.mtx.gz