PMID:17033696 #7
Description
Submitter 1 full name
Rodolfo Brandão Dias Ferreira
Submitter 1 ORCID
No response
Submitter 1 GitHub username
rodolfobrandao8
Submitter 2 full name
No response
Submitter 2 ORCID
No response
Submitter 2 GitHub username
No response
Submitter 3 full name
No response
Submitter 3 ORCID
No response
Submitter 3 GitHub username
No response
PMID
PMID:17033696
Title
Generation of gene deletions and gene replacements in Escherichia coli O157:H7 using a temperature sensitive allelic exchange system
Cloning Detail Level
Cloning information completely missing
Plasmids and Alleles
Plasmid pIB307: used for allelic exchange in E. coli O157:H7; temperature-sensitive plasmid derived from pMAK705 carrying a pSC101 mutant replicon (pH01); no repository identifier available.
Plasmid pHY10: used to delete the LEE4 operon in E. coli O157:H7; constructed by inserting a sacB-kan cassette between homologous flanking regions in pIB307; no repository identifier available.
Plasmid pAJR162: used to complement the LEE4 deletion in E. coli O157:H7; carries the full LEE4 operon cloned into pIB307; no repository identifier available.
Plasmid pMAK705: precursor of pIB307; constructed with pH01 replicon and CmR gene; no identifier in repository.
Allele ΔLEE4 (ZAP984): deletion of the LEE4 operon in E. coli O157:H7 strain ZAP198; no identifier listed in a public database.
Allele LEE4 complement (ZAP985): chromosomal complementation of ΔLEE4 in E. coli O157:H7; created by reintroducing LEE4 using pAJR162; no identifier listed in a public database.
Cloning Techniques Used
- Gibson Assembly
- Golden Gate
- Gateway Cloning
- CRISPR/Cas9
- Homologous Recombination
- Traditional Restriction Enzyme Cloning
- PCR Cloning
- Overlap Extension
- In-Fusion Cloning
- De-novo DNA synthesis
- Other (please specify in notes)
Cloning Text (if available)
"The allelic exchange method was used to delete and then repair the entire LEE4 operon from E. coli O157:H7 (ZAP198), generating strains ZAP984 and ZAP985, respectively. [...] These methods were used to create ZAP984 (ΔLEE4), using plasmid pHY10 and the complemented strain, ZAP985, using plasmid pAJR162." "Each flanking region for the LEE4 knockout was PCR amplified and cloned into the temperature sensitive vector pIB307 creating pHY3. A sacB-kan cassette was cloned between the flanking regions at the BamHI restriction site to create plasmid pHY10. [...] To allow subsequent ‘repair’ of any deletion, the LEE4 operon was amplified by long-range PCR and cloned into pIB307 to create construct pAJR162."
"The key reagent we use for the knockout strategy is the plasmid pIB307. The replicon from this plasmid is derived from the large antibiotic resistance plasmid R65 (10). This replicon and a tetracycline resistance gene were manipulated to form a smaller plasmid termed
pSC101. pSC101 has undergone in vitro mutagenesis with hydroxylamine, creating distinct mutants that varied in their temperature dependent replication (11). These included pH01, a pSC101 replicon mutant that was unable to replicate at 42°C but could replicate normally at 28°C. The replicon from pH01 was removed and ligated to the chloramphenicol resistance gene from pBR325. The resulting plasmid, pMAK705, was modified by the addition of the lacZ gene and its promoter (to facilitate screening) and the polylinker M13mp19 as a multiple cloning site (12). At a later date
the majority of the lac sequences were removed to decrease the plasmid’s size and homology with chromosomal DNA, thereby creating pIB307 (13)."
"An alternative method is to amplify the whole region including the flanking regions and the gene(s) to be deleted using long-range PCR. This can be cloned into the pIB307 vector and restricted by endonucleases at naturally occurring restriction sites to replace the gene(s) to be deleted with the sacB-kan cassette. This plasmid can then be used in the allelic exchange process."
Strains
ZAP198 | E. coli O157:H7 (Walla3) VT1-VT2-
ZAP984 | ZAP198 ΔLEE4
ZAP985 | ZAP784 LEE4 complement
Primers | Primer Sequence
pIB sp.5 | AGACAAATGGATCTCGTAAGCG
pIB sp.3 | GCTGTAACAAGTTGTCTCAGGTGT
Plasmids |
pIB307: Base vector for allelic exchange.
pAJR162: Contains LEE4 operon for complementation.
Cloning Strategies
{
"plasmid_name": "pHY10",
"backbone": "pIB307",
"insert": {
"left_flank": "958bp LEE4 upstream",
"right_flank": "610bp LEE4 downstream",
"cassette": "sacB-kan"
},
"antibiotic_resistance": "chloramphenicol, kanamycin",
"temperature_sensitive": true,
"used_for": "Deletion of LEE4 in E. coli O157:H7 (strain ZAP984)"
}
{
"plasmid_name": "pIB307",
"backbone": "pMAK705 (derived from pH01, a pSC101 mutant)",
"insert": null,
"antibiotic_resistance": "chloramphenicol",
"temperature_sensitive": true,
"used_for": "Base plasmid for allelic exchange; used to construct pHY10 and pAJR162"
}
Missing information (if any)
information is missing or insufficient to fully reproduce the cloning:
The primer sequences used to amplify the flanking regions of the LEE4 operon are not provided.
The exact nucleotide sequences of the flanking regions, the sacB-kan cassette, and the LEE4 operon are not included in the paper.
There are no plasmid maps or annotated sequences for pIB307, pHY10, or pAJR162.
Cloning details such as ligation protocols, enzyme concentrations, vector:insert ratios, and PCR conditions are not specified.
The orientation of cloned fragments and any additional restriction enzyme sites used (apart from BamHI) are not described.
The sequence of pSC101 mutant pH01 is not provided, nor is the full sequence of pIB307.
I started working on the article "Generation of gene deletions and gene replacements in Escherichia coli O157:H7 using a temperature sensitive allelic exchange system" to assess its reliability. The article mentions the use of a temperature-sensitive plasmid in Escherichia coli O157:H7. The first mention of plasmids appears in the Materials and Methods section, where it refers to plasmid pHY10—I was able to find this plasmid's sequence in GenBank.
The article also mentions plasmid pAJR162, but I couldn't find any references or the sequence for this plasmid. Instead, I found a sequence for a plasmid named pAS162.
In a "RESULTS AND DISCUSSION" a few more plasmids are also mentioned "The key reagent we use for the knockout strategy is the plasmid pIB307," but I couldn’t find any further mentions of it or the sequence of the pIB307 plasmid.
"These included pH01, a pSC101 replicon mutant that was unable to replicate at 42°C but could replicate normally at 28°C" I looked up the genes mentioned and only found the plasmid pSC101. I couldn't find any information about the plasmid pH01.
Present information (if any)
The paper describes a temperature-sensitive allelic exchange system used to generate gene deletions and replacements in Escherichia coli O157:H7. The key plasmid used is pIB307, a derivative of pSC101 (specifically the temperature-sensitive mutant pH01) that does not replicate at 42°C but replicates normally at 28°C. This vector was modified to include a multiple cloning site and a chloramphenicol resistance marker.
To delete the LEE4 operon, approximately 958 bp of left and 610 bp of right flanking regions were PCR-amplified and cloned into pIB307. A sacB-kan cassette was inserted between these flanks at the BamHI site, creating plasmid pHY10. This plasmid was transformed into the wild-type strain ZAP198, and recombinants were selected at 42°C (non-permissive for plasmid replication) using chloramphenicol. The intermediate strain with the chromosomally integrated cassette was called ZAP984.
To complement the deletion, the full LEE4 operon was amplified by long-range PCR and cloned into pIB307, forming pAJR162, which was used to generate ZAP985, the complemented strain.
Primers PIB sp.5 (AGACAAATGGATCTCGTAAGCG) and PIB sp.3 (GCTGTAACAAGTTGTCTCAGGTGT) were used for screening purposes.
Assumptions
To reproduce the cloning described in the paper, several assumptions would need to be made due to missing experimental details. First, the left and right flanking regions of the LEE4 operon, which are 958 bp and 610 bp respectively, are assumed to be PCR-amplified directly from the genomic DNA of E. coli O157:H7 strain ZAP198. The exact sequences of these regions are not provided, so one would need to refer to a publicly available genome sequence of a similar O157:H7 strain, such as EDL933 or Sakai, and select regions upstream and downstream of the LEE4 operon that do not overlap with adjacent genes. Primers would be designed accordingly, likely incorporating restriction sites compatible with the multiple cloning site of the destination plasmid, such as BamHI.
The plasmid backbone, pIB307, is derived from the pSC101 replicon (specifically the temperature-sensitive mutant pH01) and includes a chloramphenicol resistance gene. It is assumed to replicate at 28°C but not at 42°C. The plasmid likely contains a multiple cloning site derived from M13mp19 and may or may not include remnants of lacZ used for blue-white screening. The flanking regions and sacB-kan cassette are cloned into this plasmid to generate pHY10, which is used to create the LEE4 deletion strain (ZAP984). For complementation, the full LEE4 operon is amplified by long-range PCR and cloned into pIB307 to form pAJR162, which is used to complement ZAP984 and generate strain ZAP985.
The exact PCR conditions, ligation steps, enzyme concentrations, and vector:insert molar ratios are not specified in the paper, so standard conditions would be assumed. High-fidelity polymerase such as Phusion or Q5 would be used for amplifying all fragments. Ligation would likely be carried out using T4 DNA ligase, and transformation into competent E. coli would follow standard protocols.
Selection for the first recombination event (integration of the plasmid into the chromosome) would be done at 42°C in the presence of chloramphenicol, exploiting the non-permissive temperature of the plasmid's origin of replication. The second recombination event, which replaces the target locus with the cassette and removes the plasmid, would be selected at 28°C in the presence of kanamycin and sucrose.
Notes
No response