Skip to content

TiRNA: a coarse-grained method with temperature and ion effects for RNA structure folding and prediction.

Notifications You must be signed in to change notification settings

Tan-group/TiRNA

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

25 Commits
 
 
 
 

Repository files navigation

#TiRNA: a coarse-grained method with temperature and ion effects for RNA structure folding and prediction

##Overview

TiRNA is a coarse-grained computational method developed by Tan-group at Wuhan University for RNA structure modeling. The model incorporates the effects of temperature and ions to provide predictions for 3D structures and thermal stability of RNAs in monovalent/divalent ion solutions.

###Key Features:

  • (1) Three-bead coarse-grained representation (P, C4', and N1/N9);
  • (2) Force field accounting for temperature and ion effects;
  • (3) Replica-exchange Monte Carlo & Monte Carlo simulated annealing for structure sampling;

###Package Modules:

  • (1) RNA 3D Structure Prediction: Predicting 3D structures from sequences or secondary structures at given ion conditions;
  • (2) RNA Thermal Stability Prediction: Predicting structures at various temperatures which can be used for analyzing melting temperatures and thermally unfolding pathways.

##System Requirements

  • Operating System: Linux;
  • CPU: ≥8 cores with 2 threads;
  • Compiler: GCC ≥7.5 (supporting C++11 standard);
  • Python: Version ≥3.11.5;
  • Python Packages: Biopython ≥1.80 (pip install biopython).

##Installation

1.Download the TiRNA package

2.Verify dependencies

  • gcc --version # Should be ≥7.5;
  • python --version # Should be ≥3.11.5;
  • python -c "import Bio; print(f'Biopython version: {Bio.version}')" #≥1.70 .

Usage Examples

1.Prediction for RNA 3D Structure and Thermal Stability from Sequences

Location: Run in from-sequence/

Steps:

(1) Prepare sequence file (seq.dat)

  • Input your RNA sequence in seq.dat
  • Example:
  • GGCGAUGUCCAGCAGAUACACGUCGUUCGCACC

(2) Configure parameters (config.dat)

  • Sampling_type 1
  • Folding_steps 750000
  • Optimizing_steps 500000
  • C_Na 1000
  • C_Mg 0
  • N_cout 10

(3) Run the simulation with TiRNA

  • bash run.sh

2.RNA 3D Structure Prediction with Given Secondary Structure

  • Location: Run in from-2D-structure/

Steps:

(1) Prepare sequence and secondary structure (seq.dat)

  • Format: sequence followed by secondary structure in dot-bracket notation
  • Example:
  • GGAGGAAGGAGCCUCC
  • (((((......)))))

(2) Configure parameters (config.dat) - same as those in from-sequence

(3) Run the simulation with TiRNA

  • bash run.sh

3.RNA 3D Structure Prediction from Initial Structures

3A. From Initial Structure in PDB Format

  • Location: Run in from-3D-structure/PDB
  • Steps:
  • (1) Place your initial PDB structure file in the directory;
  • (2) Configure parameters in config.dat;
  • (3) Run with bash run.sh.

3B. From 3D Structure in CIF Format

  • Location: Run in from-3D-structure/CIF
  • Steps:
  • (1) Place your initial CIF structure file in the directory;
  • (2) Configure parameters in config.dat;
  • (3) Run with bash run.sh.

Configuration Parameters

Configuration Parameters

Parameter Description
Sampling_type 1 for replica-exchange Monte Carlo (REMC),0 for Monte Carlo simulated annealing(MCSA)
Folding_steps Number of steps for structure folding
Optimizing_steps Number of steps for structure optimization
C_Na Na⁺ concentration in mM
C_Mg Mg²⁺ concentration in mM
N_cout Number of output predicted 3D structures

Performance Recommendations:

For Replica-Exchange Monte Carlo (REMC, Sampling_type = 1):

  • Folding_steps: ≥500,000 steps recommended;
  • Optimizing_steps: ≥100,000 steps recommended.

For Monte Carlo Simulated Annealing (MCSA, Sampling_type = 0):

  • Folding_steps: ≥2,000,000 steps recommended;
  • Optimizing_steps: ≥100,000 steps recommended.

Application-specific recommendations

  • For more accurate 3D structure prediction:
    • REMC: Use ≥750,000 folding steps and ≥500,000 optimizing steps;
    • MCSA: Use ≥3,000,000 folding steps and ≥500,000 optimizing steps.
  • For more accurate thermal stability prediction:
    • REMC: Use ≥4,000,000 folding steps;
    • MCSA: Use ≥20,000,000 folding steps.

Output Files

After successful execution, results are saved in the results/ directory:

Directory Content Description
Folding_trajectory/ Folding trajectories at different temperatures
CG_structures/ Predicted top-N 3D CG structures
Secondary_structure/ Predicted top-N secondary structures in dot-bracket notation
All_atom_structure/ All-atom structures corresponding to top-N CG structures
Thermal_Stability/ Data for thermal stability analysis

Software Usage Notes:

  • Place all input files in the data directory before running the program.
  • Only seq.dat is accepted as the input sequence file.
  • The program will overwrite the result output folder on each run. To preserve previous results:
    • Rename the existing result folder, or
    • Move it to another location before execution.

Post-Processing

To refine the predicted all-atom structures and remove potential steric clashes or chain breaks, use QRNAS:

Support and Contact

For questions or issues regarding TiRNA, please contact: zjtan@whu.edu.cn.

References

  • [1] Wang X, Lou E, Yu S, Tan YL, Shi YZ, & Tan ZJ. 2025. TiRNA: a coarse-grained method with temperature and ion effects for RNA structure folding and prediction. In preparation.
  • [2] Wang X, Tan YL, Yu S, Shi YZ, & Tan ZJ. 2023. Predicting 3D structures and stabilities for complex RNA pseudoknots in ion solutions. Biophys J. 122, 1503-1516.
  • [3] Shi YZ, Wang FH, Wu YY, & Tan ZJ. 2014. A coarse-grained model with implicit salt for RNAs: Predicting 3D structure, stability and salt effect. J Chem Phys. 141, 105102.
  • [4] Stasiewicz J, Mukherjee S, Nithin C, & Bujnicki JM. 2019. QRNAS: Software tool for refinement of nucleic acid structures. BMC Struct Biol. 19, 5.

TiRNA Package - Tan Group, Wuhan University

About

TiRNA: a coarse-grained method with temperature and ion effects for RNA structure folding and prediction.

Resources

Stars

Watchers

Forks

Packages

 
 
 

Contributors