Skip to content
Merged
Changes from all commits
Commits
File filter

Filter by extension

Filter by extension

Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
90 changes: 49 additions & 41 deletions exercises/nucleotide-count/canonical-data.json
Original file line number Diff line number Diff line change
@@ -1,44 +1,52 @@
{
"nucleotide_counts": {
"description": "count all nucleotides in a strand",
"cases": [
{
"description": "empty strand",
"strand": "",
"expected": {
"A": 0,
"C": 0,
"G": 0,
"T": 0
"exercise": "nucleotide-count",
"version": "1.0.0",
"cases": [
{
"description": "count all nucleotides in a strand",
"cases": [
{
"description": "empty strand",
"property": "nucleotideCounts",
"strand": "",
"expected": {
"A": 0,
"C": 0,
"G": 0,
"T": 0
}
},
{
"description": "strand with repeated nucleotide",
"property": "nucleotideCounts",
"strand": "GGGGGGG",
"expected": {
"A": 0,
"C": 0,
"G": 7,
"T": 0
}
},
{
"description": "strand with multiple nucleotides",
"property": "nucleotideCounts",
"strand": "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC",
"expected": {
"A": 20,
"C": 12,
"G": 17,
"T": 21
}
},
{
"description": "strand with invalid nucleotides",
"property": "nucleotideCounts",
"strand": "AGXXACT",
"expected": {
"error": "Invalid nucleotide in strand"
}
}
},
{
"description": "strand with repeated nucleotide",
"strand": "GGGGGGG",
"expected": {
"A": 0,
"C": 0,
"G": 7,
"T": 0
}
},
{
"description": "strand with multiple nucleotides",
"strand": "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC",
"expected": {
"A": 20,
"C": 12,
"G": 17,
"T": 21
}
},
{
"description": "strand with invalid nucleotides",
"strand": "AGXXACT",
"expected": {
"error": "Invalid nucleotide in strand"
}
}
]
}
]
}
]
}