HCRProbeDesign is a command-line and Python package for designing HCR v3.0 split-initiator probe pairs from a target FASTA sequence. It tiles target sequences, filters by GC content, melting temperature, homopolymers, and hairpins, and can optionally enforce genome uniqueness with Bowtie2.
Key tools:
designProbes: primary probe design CLI.designProbesBatch: batch probe design for multi-record FASTA inputs.fetchMouseIndex: download, install, and register the mm10 Bowtie2 index.buildGenomeIndex: build and register a new reference genome index.listReferences: display installed reference genomes and default parameters.
Documentation: https://www.gofflab.org/HCRProbeDesign/
- Python >= 3.6
- Bowtie2 (
bowtie2andbowtie2-build) for genome masking and index building - Python dependencies are installed via
pip(primer3-py, biopython, beautifulsoup4, pysam, zipfile36, pyyaml)
pip install hcrprobedesigngit clone https://github.com/gofflab/HCRProbeDesign.git
cd HCRProbeDesign
# Optional: use the provided conda environment
conda env create -f environment.yaml
conda activate HCRProbeDesign
# Install the package
pip install -e .HCRProbeDesign stores configuration and Bowtie2 indices in a persistent user data directory
at ~/.hcrprobedesign/ so they survive package upgrades. Override the location with the
HCRPROBEDESIGN_DATA_DIR environment variable.
HCRProbeDesign keeps Bowtie2 index paths in ~/.hcrprobedesign/HCRconfig.yaml. The buildGenomeIndex
utility builds an index and registers it automatically.
buildGenomeIndex --species zebrafish --fasta /path/to/genome.fa --threads 8Notes:
--fastacan be repeated and can point to a directory; all.fa,.fasta, or.fnafiles inside will be used.- By default, indices are written under
~/.hcrprobedesign/indices/and the config is updated. - Use
--indices-dirto write indices elsewhere and--configto update a specific config file. - Use
--forceto overwrite an existing index or config entry.
If you are working with mouse (mm10), you can use the prebuilt index:
fetchMouseIndexThis updates HCRconfig.yaml so designProbes --species mouse works out of the box.
To see which reference genomes are registered and ready to use:
listReferencesThis prints each registered species, its Bowtie2 index location, whether the index files
are present on disk, the --species flag to use, and the current default parameters.
designProbes reads the first FASTA record in the input file. Use designProbesBatch for multi-record inputs.
>MyTarget
ACGTACGTACGTACGTACGTACGTACGTACGT
Before running designProbes with genome masking (default), register a reference species with
buildGenomeIndex or fetchMouseIndex. You can also supply --index directly or skip genome
masking with --no-genomemask.
designProbes targets.fa --species mouse --channel B1 --output probes.tsv --idt probes.idtBatch mode example:
designProbesBatch targets.fa --species mouse --channel B1 --output probes.tsv --idt probes.idtTo override the channel per record in batch mode, add channel= to the FASTA header:
>MyTarget channel=B2
ACGTACGTACGTACGTACGT
Common flags:
--no-genomemask: skip Bowtie2 genome masking (faster, but no uniqueness check).--index /path/to/index: override the Bowtie2 index path.--tileSize 52,--minGC,--maxGC,--maxProbes: tune probe selection.
Outputs:
- Probe designs are written to
--output(stdout by default). --idtwrites an IDT-friendly TSV for ordering.- Bowtie2 genome masking writes a SAM file named
{targetName}.samin the working directory.