Use a seqFeatureStore database to with Primer3 to design primers sets in which at least one primer of a pair spans an exon with a product size between 100 and 150 bp. Provide the script with a text file of transcript (mRNA) names that appear in the seqFeatureStore Database (GFF data structure) as well as a seqFeatureStore database base.
Requied
- Primer3 Release 2.3.5 or later.
- BioPerl
cat genes GRMZM2G006128_T02 perl getExonsForPrimers_inGene.pl maize.sqlite genes ID SEQLength primerSetNum primerOrient product_size start len tm gc% primerSeq GRMZM2G006128_T02 2044 1 left 123 1058 22 59.776 50.000 CTTTCTGTTCTTCAAGACGCCC GRMZM2G006128_T02 2044 1 right 123 1180 22 60.031 45.455 ATGCAACAACGGTAACTGAAGC GRMZM2G006128_T02 2044 2 left 124 1057 22 59.776 50.000 CCTTTCTGTTCTTCAAGACGCC GRMZM2G006128_T02 2044 2 right 124 1180 22 60.031 45.455 ATGCAACAACGGTAACTGAAGC GRMZM2G006128_T02 2044 3 left 125 1056 22 59.776 50.000 CCCTTTCTGTTCTTCAAGACGC GRMZM2G006128_T02 2044 3 right 125 1180 22 60.031 45.455 ATGCAACAACGGTAACTGAAGC GRMZM2G006128_T02 2044 4 left 134 653 22 59.904 54.545 GTCACGTCAGCTAGGTCTACAG GRMZM2G006128_T02 2044 4 right 134 786 22 59.838 45.455 TTCAGATTTGAGTGCGCATTCC GRMZM2G006128_T02 2044 5 left 132 876 22 60.224 50.000 CCCAGCAAACATCATATGTGCC GRMZM2G006128_T02 2044 5 right 132 1007 22 59.715 50.000 CAGATAATCGTTCTTGGCACGG
- use bp_seqfeature_load.pl. This script is a part of a collection of BioPerl Scripts that can be installed along with BioPerl.
- MySQL or SQLite is needed.
Use SQLite if you can, it is easier to install and use.
If you do use MySQL, the followging line in getExonsForPrimers_inGene.pl will need to be edited:
-adaptor => 'DBI::SQLite',
should be changed to
-adaptor => 'DBI::MySQL',
- Get GFF3: ftp://ftp.jgi-psf.org/pub/JGI_data/phytozome/v8.0/Zmays/annotation/Zmays_181_gene_exons.gff3.gz
- Get Genome FASTA: http://ftp.maizesequence.org/current/assembly/ZmB73_RefGen_v2.tar.gz
- To make the chromosome names the same in both the FASTA and GFF fils
- Due to inconsistencies in the names of chromosomes in the FASTA and GFF, the following code was used to combine and rename FASTA files. This will be spefic for this version of the Maize assembly.
for i in `ls *fasta` ; do j=`echo $i | awk -F '.' '{print $1}'` export j ; perl -pe 's/>(.+)/>$ENV{j} $1/' $i ; done > ZmB73_v2_renamed.fa
- rename chromosomes in GFF file
perl -pe 's/^(.+)\t/chr$1/' Zmays_181_gene.gff3 > Zmays_181_gene.renamed.gff3
- bp_seqfeature_load.pl -d maize.sqlite -a DBI::SQLite -c -f Zmays_181_gene.renamed.gff3
bp_seqfeature_load.pl
Usage: /usr/local/bin/bp_seqfeature_load.pl [options] gff_file1 gff_file2...
Options:
-d --dsn The database name (dbi:mysql:test)
-s --seqfeature The type of SeqFeature to create (Bio::DB::SeqFeature)
-a --adaptor The storage adaptor to use (DBI::mysql)
-v --verbose Turn on verbose progress reporting
--noverbose Turn off verbose progress reporting
-f --fast Activate fast loading (only some adaptors)
-T --temporary-directory Specify temporary directory for fast loading (/tmp)
-c --create Create the database and reinitialize it (will erase contents)
-u --user User to connect to database as
-p --password Password to use to connect to database
-S --subfeatures Turn on indexing of subfeatures (default)
--nosubfeatures Turn off indexing of subfeatures
-i --ignore-seqregion
If true, then ignore ##sequence-region directives in the
GFF3 file (default, create a feature for each region)
-z --zip If true, database tables will be compressed to save space
Please see http://www.sequenceontology.org/gff3.shtml for information
about the GFF3 format. BioPerl extends the format slightly by adding
a ##index-subfeatures directive. Set this to a true value if you wish
the database to be able to retrieve a feature's individual parts (such as the
exons of a transcript) independently of the top level feature:
##index-subfeatures 1
It is also possible to control the indexing of subfeatures on a case-by-case
basis by adding "index=1" or "index=0" to the feature's attribute list. This
should only be used for subfeatures.
Subfeature indexing is true by default. Set to false (0) to save lots
of database space and speed performance. You may use --nosubfeatures
to force this.